ID: 927883976

View in Genome Browser
Species Human (GRCh38)
Location 2:26707252-26707274
Sequence ACGGCTCCCACAGTAGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927883974_927883976 -3 Left 927883974 2:26707232-26707254 CCGGACAGGGTCAGCTGCTCACG 0: 1
1: 0
2: 2
3: 6
4: 141
Right 927883976 2:26707252-26707274 ACGGCTCCCACAGTAGTCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 81
927883971_927883976 2 Left 927883971 2:26707227-26707249 CCCACCCGGACAGGGTCAGCTGC 0: 1
1: 0
2: 0
3: 11
4: 148
Right 927883976 2:26707252-26707274 ACGGCTCCCACAGTAGTCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 81
927883970_927883976 5 Left 927883970 2:26707224-26707246 CCTCCCACCCGGACAGGGTCAGC 0: 1
1: 0
2: 2
3: 24
4: 153
Right 927883976 2:26707252-26707274 ACGGCTCCCACAGTAGTCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 81
927883966_927883976 29 Left 927883966 2:26707200-26707222 CCTGGGGCTGCTGGAATGCAGGA 0: 1
1: 0
2: 5
3: 54
4: 403
Right 927883976 2:26707252-26707274 ACGGCTCCCACAGTAGTCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 81
927883973_927883976 -2 Left 927883973 2:26707231-26707253 CCCGGACAGGGTCAGCTGCTCAC 0: 1
1: 0
2: 2
3: 23
4: 349
Right 927883976 2:26707252-26707274 ACGGCTCCCACAGTAGTCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 81
927883972_927883976 1 Left 927883972 2:26707228-26707250 CCACCCGGACAGGGTCAGCTGCT 0: 1
1: 0
2: 1
3: 11
4: 171
Right 927883976 2:26707252-26707274 ACGGCTCCCACAGTAGTCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 81
927883964_927883976 30 Left 927883964 2:26707199-26707221 CCCTGGGGCTGCTGGAATGCAGG 0: 1
1: 0
2: 2
3: 34
4: 367
Right 927883976 2:26707252-26707274 ACGGCTCCCACAGTAGTCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927883976 Original CRISPR ACGGCTCCCACAGTAGTCCC TGG Intronic
900218780 1:1496003-1496025 TCGGCTCCCACAGCAGAGCCAGG + Exonic
900226134 1:1534444-1534466 TCGGCTCCCACAGCAGAGCCAGG + Exonic
902626836 1:17681646-17681668 ACACCTCCCACAGCAGTCCTCGG + Intronic
904408583 1:30311319-30311341 ACTGCTCCCACAGCACCCCCAGG + Intergenic
905364239 1:37440197-37440219 AAGGCTGCCACAGTAATCCTGGG - Intergenic
924902597 1:248417547-248417569 ACCTCTTCCACAGTAGCCCCTGG + Intergenic
1062932324 10:1361366-1361388 ATGGCTTCCACATAAGTCCCTGG - Intronic
1064637380 10:17382771-17382793 ACCTCTTTCACAGTAGTCCCTGG - Intronic
1068808917 10:61233323-61233345 ACCTCTTCCACAATAGTCCCTGG - Intergenic
1070551025 10:77490936-77490958 AGGGCTCCTACAGTAGGCCCTGG - Intronic
1074410810 10:113227034-113227056 ACAGCTCCAAGAGTATTCCCTGG - Intergenic
1080436636 11:32250749-32250771 ATGGCTCCCACAGTAGCAGCAGG + Intergenic
1098291321 12:68959193-68959215 CCAGCACCCACAGCAGTCCCTGG + Intronic
1110951203 13:81493688-81493710 ATGGCTCCCACTGTAGCCTCTGG - Intergenic
1111265641 13:85808582-85808604 ACCACTCCCACACTAGTCCATGG + Intergenic
1115244101 14:31277305-31277327 ACCTCTTCCACAATAGTCCCTGG - Intergenic
1118871108 14:69742995-69743017 ACCTCTTCCACAATAGTCCCTGG + Intronic
1118938589 14:70311326-70311348 ACCTCTTCCACAATAGTCCCTGG - Intergenic
1123881837 15:24684021-24684043 ATGGCTCTCTCAGAAGTCCCAGG + Intergenic
1130660030 15:85824096-85824118 AAGGTTCCCACTGCAGTCCCTGG + Intergenic
1132122208 15:99185797-99185819 ACGGCTCTTTCAGCAGTCCCTGG + Intronic
1132608011 16:801517-801539 ACAGCTCCCACAGGAGCCCAAGG - Intergenic
1132787980 16:1668738-1668760 ACGGCACCCACAGCAGCCCTAGG - Intronic
1135704992 16:24667357-24667379 AGGGATCCCAAAGTATTCCCAGG + Intergenic
1141507988 16:84492111-84492133 ACCTCTTCCACAATAGTCCCTGG - Intronic
1145226732 17:21135863-21135885 ACCTCTTCCACAATAGTCCCTGG + Intronic
1146660547 17:34662673-34662695 AGGGCTCCCATAGGACTCCCGGG + Intergenic
1152123201 17:78431457-78431479 ACAGCTCCCCCAGGAGTCTCGGG - Intronic
1153657220 18:7293631-7293653 CCTGCCCTCACAGTAGTCCCTGG - Intergenic
1157912757 18:51633956-51633978 ACCTCTTCCACAGTAGTCCCTGG - Intergenic
1159391919 18:67804550-67804572 ACTGATCCCATAGTAGTCCTGGG + Intergenic
1160154112 18:76420047-76420069 ATGGCTCCCACAACAGCCCCAGG + Intronic
1161162662 19:2769676-2769698 ACGGGTCCCCAAGAAGTCCCTGG - Intronic
1167652567 19:50740943-50740965 GCGGCTCCTACTGTTGTCCCAGG - Intergenic
1168169397 19:54575842-54575864 CCGGTCCCCACAGTAGCCCCAGG + Exonic
1168289930 19:55352676-55352698 ACGGCTCCCTCAGCAGGACCAGG + Exonic
925743276 2:7024313-7024335 ACGGATCCCACGGGAGACCCAGG - Intronic
927883976 2:26707252-26707274 ACGGCTCCCACAGTAGTCCCTGG + Intronic
935319641 2:101873435-101873457 ACGGCTCCTGCAGTGGTTCCAGG + Intronic
935957634 2:108394090-108394112 ACCTCTTCCACAATAGTCCCTGG + Intergenic
936068601 2:109350334-109350356 ACGGCTCCCACAGCAGACAAGGG + Intronic
945677128 2:212869039-212869061 AGTACTCCCACAATAGTCCCAGG + Intergenic
948542289 2:238699374-238699396 CTGCCTCCCACAGGAGTCCCTGG + Intergenic
948547858 2:238745535-238745557 AAGGCTCCCAGAGCAGCCCCTGG + Intergenic
1172055800 20:32153415-32153437 CAGGCTGCCACAGCAGTCCCTGG + Intronic
1172767256 20:37357374-37357396 AGGGCACCCACAGTAGGCCTGGG - Intronic
1176264933 20:64204165-64204187 ACAGCTCCCACAGCAGCCTCAGG - Intronic
1177867907 21:26535087-26535109 AACACCCCCACAGTAGTCCCCGG - Intronic
1178406210 21:32325228-32325250 ACGGTTCCAAGAGCAGTCCCAGG - Exonic
1180108439 21:45634882-45634904 ACGGCTCCCACAGCAGCAGCCGG - Intergenic
1182145785 22:27995974-27995996 CCGGCTTCCACAGACGTCCCTGG - Intronic
952267590 3:31801536-31801558 AGGCCTCCCACAGCAGGCCCAGG + Intronic
953509715 3:43523863-43523885 ACAGCTTCCACTGTAGTCCCTGG - Intronic
958748516 3:98166091-98166113 ACACCTTCCACCGTAGTCCCTGG + Intergenic
961414439 3:126746986-126747008 GAGGCTCCCCCAGTACTCCCGGG - Intronic
962264555 3:133935683-133935705 ACAGCCCCCACAGTAGCCACTGG + Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
963870774 3:150410722-150410744 ACGCCTCCCACAGTAGCCGGGGG - Exonic
973245556 4:48007402-48007424 ACCGCTTCCACAATAGTCCCTGG + Intronic
984845417 4:184104085-184104107 ACAGCTCCCACAGATGGCCCTGG + Intronic
985422282 4:189796120-189796142 AATGCTCCCACAGCAGTACCAGG + Intergenic
988919677 5:35928837-35928859 ACAGCACCCACGGTGGTCCCAGG - Intronic
992292804 5:75296951-75296973 ACCTCTTCCACAATAGTCCCTGG - Intergenic
994741577 5:103625675-103625697 ACGGCTTCCACAGCAGGCCAAGG - Intergenic
1003722210 6:8716663-8716685 AGGCCTCCCACAGTTTTCCCTGG + Intergenic
1006171572 6:32096275-32096297 ACGGCTCCCACAGTCCTCACCGG + Intronic
1006792650 6:36714060-36714082 CCGGCTGCCACAGTGGTCCGGGG + Intronic
1018333543 6:162760239-162760261 ATGGCACACACAGGAGTCCCTGG + Intronic
1019144770 6:169969656-169969678 ACTGCTCCCACAGTCTTCTCTGG + Intergenic
1026108268 7:67437950-67437972 ACGGCACCCAGAGTAATACCTGG - Intergenic
1027201636 7:76067680-76067702 ACAGCTCCCACTGCAGTCACTGG + Intergenic
1032488994 7:132309772-132309794 GCAGCTCACACAGGAGTCCCTGG - Intronic
1044941973 8:97352785-97352807 AGGGCAGCCACAGTAGTCACTGG + Intergenic
1045040120 8:98215652-98215674 ATGGCCCCCATAGAAGTCCCTGG + Intronic
1047724290 8:127670748-127670770 AGGGCTCTTACAGTTGTCCCAGG + Intergenic
1049597419 8:143491201-143491223 ACGGATCCCACAGGAACCCCCGG + Intronic
1052024469 9:23559227-23559249 ACAGTGCCCACAGTTGTCCCAGG + Intergenic
1052527437 9:29636695-29636717 AAGTCTCCCACTGTGGTCCCCGG - Intergenic
1054340672 9:63859338-63859360 ACGGCTCCCACCGGATTCGCGGG + Intergenic
1062472934 9:136714090-136714112 AAGGCCCCCACAGTGCTCCCTGG - Intronic
1062514717 9:136926856-136926878 TCTGCTCTCACAGGAGTCCCTGG - Intronic
1187139648 X:16580702-16580724 ACGTCTTCCACGATAGTCCCTGG - Intergenic
1190829845 X:54049858-54049880 ACTGCTGCCACTGTAGTCACTGG - Intergenic
1192318627 X:70070587-70070609 ACCTCCCCCATAGTAGTCCCAGG + Intergenic
1193538443 X:82741442-82741464 ACCTCTTCCGCAGTAGTCCCTGG + Intergenic
1196873028 X:120130595-120130617 ACCGCTTGCACAATAGTCCCTGG + Intergenic
1200494288 Y:3862491-3862513 ACCTCTTCCACAATAGTCCCTGG - Intergenic
1200732535 Y:6758235-6758257 ACTGCACCCACAGTTGCCCCAGG + Intergenic