ID: 927884477

View in Genome Browser
Species Human (GRCh38)
Location 2:26710119-26710141
Sequence CCGCACCCTCTGCCAAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927884464_927884477 12 Left 927884464 2:26710084-26710106 CCACGTCCCTCCCACCCTGTCCT 0: 1
1: 0
2: 16
3: 121
4: 1007
Right 927884477 2:26710119-26710141 CCGCACCCTCTGCCAAGGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 127
927884467_927884477 2 Left 927884467 2:26710094-26710116 CCCACCCTGTCCTTGCGAGATGT 0: 1
1: 0
2: 0
3: 4
4: 96
Right 927884477 2:26710119-26710141 CCGCACCCTCTGCCAAGGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 127
927884470_927884477 -3 Left 927884470 2:26710099-26710121 CCTGTCCTTGCGAGATGTTCCCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 927884477 2:26710119-26710141 CCGCACCCTCTGCCAAGGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 127
927884465_927884477 6 Left 927884465 2:26710090-26710112 CCCTCCCACCCTGTCCTTGCGAG 0: 1
1: 0
2: 1
3: 29
4: 319
Right 927884477 2:26710119-26710141 CCGCACCCTCTGCCAAGGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 127
927884461_927884477 25 Left 927884461 2:26710071-26710093 CCTCAGCTGGGCCCCACGTCCCT 0: 1
1: 0
2: 4
3: 26
4: 363
Right 927884477 2:26710119-26710141 CCGCACCCTCTGCCAAGGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 127
927884469_927884477 -2 Left 927884469 2:26710098-26710120 CCCTGTCCTTGCGAGATGTTCCC 0: 1
1: 0
2: 1
3: 5
4: 88
Right 927884477 2:26710119-26710141 CCGCACCCTCTGCCAAGGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 127
927884466_927884477 5 Left 927884466 2:26710091-26710113 CCTCCCACCCTGTCCTTGCGAGA 0: 1
1: 0
2: 0
3: 14
4: 194
Right 927884477 2:26710119-26710141 CCGCACCCTCTGCCAAGGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 127
927884471_927884477 -8 Left 927884471 2:26710104-26710126 CCTTGCGAGATGTTCCCGCACCC 0: 1
1: 0
2: 0
3: 1
4: 43
Right 927884477 2:26710119-26710141 CCGCACCCTCTGCCAAGGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 127
927884462_927884477 14 Left 927884462 2:26710082-26710104 CCCCACGTCCCTCCCACCCTGTC 0: 1
1: 0
2: 26
3: 240
4: 1428
Right 927884477 2:26710119-26710141 CCGCACCCTCTGCCAAGGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 127
927884463_927884477 13 Left 927884463 2:26710083-26710105 CCCACGTCCCTCCCACCCTGTCC 0: 1
1: 0
2: 3
3: 79
4: 858
Right 927884477 2:26710119-26710141 CCGCACCCTCTGCCAAGGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 127
927884468_927884477 1 Left 927884468 2:26710095-26710117 CCACCCTGTCCTTGCGAGATGTT 0: 1
1: 0
2: 0
3: 3
4: 99
Right 927884477 2:26710119-26710141 CCGCACCCTCTGCCAAGGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927884477 Original CRISPR CCGCACCCTCTGCCAAGGGT GGG Intronic
900763194 1:4486651-4486673 CTGCACCCTCTGCCCAGGCACGG - Intergenic
901457162 1:9369651-9369673 TCCCACCCTCTGCCAAGGGGTGG - Intergenic
904490250 1:30854211-30854233 CTGCACCTTCCGCCAATGGTAGG + Intergenic
905875516 1:41429633-41429655 CAGCACCCTGAGCCCAGGGTTGG - Intergenic
905979582 1:42211501-42211523 TAGCAACCTCTGCCAAGGCTGGG + Intronic
906197470 1:43937762-43937784 CCGCACCCTCTACCAACCCTCGG - Intergenic
916868782 1:168889028-168889050 CAGCCCCCTCTGTCAAGGCTTGG + Intergenic
918646522 1:186912084-186912106 GCGCACCCATTGGCAAGGGTGGG + Intronic
918778123 1:188665010-188665032 TTACACCCTCTGCCAAGGTTGGG - Intergenic
919471714 1:197987477-197987499 CCCCACGCCCTGCCAAGTGTAGG + Intergenic
919491855 1:198213774-198213796 CAGCCACCTCTGTCAAGGGTGGG + Intronic
920669357 1:207991444-207991466 ACACACCCTCTGCCAGGGGCAGG + Intergenic
922796111 1:228340644-228340666 CCGCCTCCTCTGCCCAGGCTGGG + Intronic
1065279504 10:24120333-24120355 CCTCCCCGTCTCCCAAGGGTGGG - Intronic
1065385728 10:25131395-25131417 CTCCACCCTCTGCCAAAAGTGGG + Intergenic
1070289697 10:75106053-75106075 TCGGACCCTATCCCAAGGGTAGG - Intronic
1070857699 10:79620262-79620284 CCCCACCCCCAGCCAAGGGAAGG - Intergenic
1073542697 10:104326138-104326160 CCGCTCCCTCTCCCGAGAGTGGG - Intronic
1073800732 10:107038678-107038700 CCCCGCCCCCTGCCCAGGGTTGG - Intronic
1077014030 11:392185-392207 CAGCCCTCTCTGCCAAGGGGAGG + Intergenic
1077085529 11:747958-747980 CCTCGCCCTCCGCCCAGGGTGGG + Intronic
1080036532 11:27718431-27718453 CAGCACCATCTGGGAAGGGTGGG + Intronic
1084426044 11:69085086-69085108 CAGGACCCTCTGCCCAGGGCTGG - Intronic
1084549994 11:69835434-69835456 CCGCATCCTCTTCCCAGGCTGGG + Intergenic
1084649353 11:70479584-70479606 CCCCACCCACTGCAAAGGGCTGG + Intronic
1087269014 11:96092459-96092481 CCGGCCCCTCAGCCCAGGGTGGG - Exonic
1091154661 11:133361742-133361764 CCGCAGCCGCTCCCAAGGGCTGG + Intronic
1091645410 12:2268966-2268988 CCCCACCCCCTGCCCAGGGTCGG + Intronic
1096871314 12:54594125-54594147 CAGTACCCTCTGCCAAGCCTGGG - Intergenic
1097221780 12:57455402-57455424 CTGTACCCTTGGCCAAGGGTAGG + Exonic
1097269734 12:57766646-57766668 CAGCGCCCTCTGCTAAGAGTCGG + Intronic
1102490925 12:113289072-113289094 GCTCACCCTCTGCCGAGGGCTGG + Intronic
1104931227 12:132340494-132340516 ACTCACCCACTGCCAAGGGAGGG - Intergenic
1104971870 12:132534451-132534473 TCGCACCCTCTGCCAGGGCGGGG + Intronic
1105446993 13:20466019-20466041 CTTCACCTTCTGCCATGGGTGGG + Intronic
1105590902 13:21792016-21792038 CCTCACCCTCTGCCCAGCCTTGG - Intergenic
1106572007 13:30935294-30935316 CCCCACCCTCTGACCAGGGAGGG + Intronic
1108589006 13:51895692-51895714 CCCCACCCTCTGCCCTGGGATGG + Intergenic
1110090432 13:71439395-71439417 CCCTTCCCTCTGACAAGGGTGGG + Intronic
1124177768 15:27442162-27442184 CTGTGCCCTCTGCCAAGGCTGGG - Intronic
1125755717 15:42063374-42063396 CCGCACCCTCTGCCAATACTGGG + Intergenic
1127191258 15:56532996-56533018 TTCCAACCTCTGCCAAGGGTTGG - Intergenic
1131198433 15:90375897-90375919 TCACAGCCTCTGCCAATGGTGGG + Intergenic
1131833803 15:96370486-96370508 CCGGAACCTCGGCCAAGGCTGGG + Intergenic
1133008709 16:2898396-2898418 CTGCATCCTCTGCCCAAGGTTGG - Intronic
1134058120 16:11182836-11182858 CCCCACCGCATGCCAAGGGTTGG + Intergenic
1137714150 16:50587714-50587736 CCAAACCCTGGGCCAAGGGTGGG + Intronic
1138457159 16:57127777-57127799 CCCGACCCTCTGCCCAGGGCTGG - Intronic
1142027619 16:87823000-87823022 CCTCACCCCCAGCCAAGGGAGGG - Intergenic
1142145739 16:88492293-88492315 CCCCACCCAATCCCAAGGGTGGG + Intronic
1144481853 17:15636263-15636285 CCCCACCCCCTGCCAGGTGTCGG - Exonic
1147166159 17:38594549-38594571 CCCCACCTGCTGCCCAGGGTTGG - Intronic
1148553467 17:48564292-48564314 CCGGACCCTCGGCCCAGGCTGGG + Intronic
1149634748 17:58157498-58157520 CCGCACCCTCTGCAATGGAGAGG - Intergenic
1150286844 17:63959511-63959533 CCGCAGCCTCTGCCAGGAGGTGG - Intronic
1151575711 17:74951742-74951764 TGGCACCCGCTGCCCAGGGTGGG - Intronic
1152918955 17:83056095-83056117 CAGCACCCACTGCCTAGGGGAGG - Intergenic
1155905622 18:31447709-31447731 CCCCACCCTAAACCAAGGGTAGG - Intergenic
1156505158 18:37586017-37586039 TGCCGCCCTCTGCCAAGGGTAGG - Intergenic
1160992969 19:1868196-1868218 CCCCACCCCCTGCCCAGTGTGGG + Intergenic
1161327353 19:3670198-3670220 CCGCACCCTCAGGCAGGCGTGGG - Intronic
1161405855 19:4090778-4090800 CCGTACCATCTGCCAGGGCTGGG - Intronic
1163289454 19:16369999-16370021 ACGCCACCTCTGCAAAGGGTAGG + Intronic
1164137541 19:22427961-22427983 CCGCTCCCTCTGCCTGGCGTTGG + Intronic
1167104099 19:47420262-47420284 CCTCACCCTCAGCCAAGACTTGG + Intergenic
926217429 2:10914045-10914067 CCGGCACCTCTGCCAAGGCTGGG + Exonic
927884477 2:26710119-26710141 CCGCACCCTCTGCCAAGGGTGGG + Intronic
928316831 2:30252884-30252906 TCTCACCCTCAGCCCAGGGTAGG - Intronic
933651223 2:84851988-84852010 CCACAGCCTGTGCCAAGGGGAGG - Intronic
935653318 2:105399780-105399802 ACGCACCCTCTCCCAGGGATGGG - Intronic
944001448 2:194843075-194843097 GCGCACCCTCTCCTAAGGGGTGG + Intergenic
944122122 2:196251574-196251596 TAGCACCCTCTGCCAAGAATGGG - Intronic
944704885 2:202278892-202278914 CCTACCCCTCTGCCAAGGTTAGG - Intronic
948481470 2:238253098-238253120 CCCCACCATCGGCCATGGGTAGG - Exonic
1169405059 20:5315810-5315832 CCGCAGCCTCTGCTCAGCGTGGG + Intergenic
1170688296 20:18588351-18588373 CTGCACCCTCTGCCGAGAGCCGG - Intronic
1174483134 20:50845096-50845118 CCACACCCTCTTCACAGGGTGGG - Intronic
1176020215 20:62958883-62958905 CTGCACCCTCTTCTGAGGGTGGG - Intronic
1179038502 21:37781312-37781334 CCCCAGCCTCTGCCAAAGTTCGG - Intronic
1179980261 21:44891834-44891856 CCGCAGCCTCTGCCATGGCAAGG - Exonic
1180631960 22:17235931-17235953 CTGCACCCCCTGCCCTGGGTTGG - Intergenic
1181560531 22:23697155-23697177 CCACACCCTGTGCCAAGGAGGGG - Exonic
1182277639 22:29200614-29200636 CCCCATCCCATGCCAAGGGTGGG - Intergenic
1183530507 22:38351023-38351045 TCCCACCCTCTGCCAAAGATGGG + Intronic
1185128224 22:49023436-49023458 CAGCCCCCTCTGCCATGGGCTGG + Intergenic
950483103 3:13256849-13256871 CTGCACCCTCTCCCCAGGGTAGG - Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953404217 3:42652658-42652680 CCACACCCTCTGTCAAGCTTTGG + Intergenic
961623215 3:128240741-128240763 CCTGACTCTCTGCCAAGGGCAGG - Intronic
969244944 4:5925806-5925828 CATCCCCCGCTGCCAAGGGTGGG - Intronic
969351167 4:6598784-6598806 GCGTACTCTCTGCCAAGGCTGGG - Intronic
969523620 4:7693049-7693071 CGGCACCCTCGGCCAGGGCTGGG - Intronic
978027646 4:103897035-103897057 CAGCAGCCTCTGTCAAGGCTGGG + Intergenic
982421808 4:155208080-155208102 CCGCACCCTCGCCCAGGGCTGGG - Intergenic
985973919 5:3399948-3399970 CCTCACCATCTGTCAATGGTTGG - Intergenic
987698005 5:21356859-21356881 CCGCTCCCTCTGCTAAGCCTGGG - Intergenic
988470180 5:31530550-31530572 CTGCAACCTCTGCCTAGGGTGGG - Intronic
991742435 5:69695525-69695547 CCGCTCCCTCTGCTAAGCCTGGG + Intergenic
991755259 5:69859679-69859701 CCGCTCCCTCTGCTAAGCCTGGG - Intergenic
991794009 5:70275263-70275285 CCGCTCCCTCTGCTAAGCCTGGG + Intergenic
991821825 5:70570838-70570860 CCGCTCCCTCTGCTAAGCCTGGG + Intergenic
991834586 5:70734827-70734849 CCGCTCCCTCTGCTAAGCCTGGG - Intergenic
991886386 5:71274805-71274827 CCGCTCCCTCTGCTAAGCCTGGG + Intergenic
997470151 5:134113169-134113191 CCCCAGCCTCTTCCCAGGGTGGG - Intergenic
998806501 5:145922178-145922200 ACACACCCTCTGCCCAGGTTAGG + Intergenic
999264237 5:150256156-150256178 TAGCAACCTCTGCAAAGGGTTGG - Intronic
999314822 5:150576589-150576611 CAGCACCTTCTCCCAAGGGTGGG + Intergenic
1000055480 5:157602514-157602536 CAGCACCCTGTGGCAAGGGGTGG + Intergenic
1000963869 5:167631788-167631810 CCCCACCCTCAGGCAAGGCTAGG + Intronic
1003030483 6:2596716-2596738 CCCCAGCCACTGCAAAGGGTGGG - Intergenic
1003385312 6:5661971-5661993 GCTCACCCTCTTCCAAGTGTGGG - Intronic
1005552844 6:26941545-26941567 CCGCTCCCTCTGCTAAGCCTGGG + Intergenic
1005667883 6:28076600-28076622 CCAGACCCTCTGCCCAGTGTGGG - Intergenic
1006155645 6:32011521-32011543 CCGCACCCTCAGCCCAGGTAAGG - Intergenic
1006161976 6:32044375-32044397 CCGCACCCTCAGCCCAGGTAAGG - Exonic
1007636840 6:43304814-43304836 TCGAACCCTCTGCCTAGGGCCGG + Exonic
1011753401 6:90475729-90475751 CCCCACCCTCTGCCCAGCATAGG + Intergenic
1011802754 6:91036418-91036440 CCCCACCTTCTCCCAAGGATGGG - Intergenic
1028389663 7:90300899-90300921 CCTCAGCCTCTGCCAAGTGTTGG + Intronic
1028496125 7:91463267-91463289 CTCCACCCTCTGCCAGAGGTGGG + Intergenic
1033644289 7:143288644-143288666 CCGCGCTTCCTGCCAAGGGTGGG + Intronic
1034336862 7:150329535-150329557 CAGCACCCTGTCCCAAGAGTGGG + Intronic
1039438488 8:37578262-37578284 CTGGACCCTCTGCCAAGGAGGGG + Intergenic
1042903116 8:73747257-73747279 CCCCCTCGTCTGCCAAGGGTGGG + Intronic
1049249619 8:141581172-141581194 CCCCACCCTCTCTCAAGGGGTGG - Intergenic
1049427513 8:142544002-142544024 TCGCAACCTCTGCCAAGGCTGGG + Intronic
1049873913 8:145003026-145003048 CCGCAGACTCCGCCAAGGGCTGG - Intergenic
1057996309 9:99823893-99823915 CCGCCCCCGCTCCCCAGGGTTGG + Intronic
1061008569 9:127942285-127942307 CCGTGCCCTCTGCCCAGGGCTGG - Exonic
1062183812 9:135205572-135205594 TCTCACCCTCTGCCATGGGTTGG + Intergenic
1188137245 X:26505011-26505033 CCGCCCCCTCTACCCAGAGTGGG + Intergenic
1189487091 X:41442410-41442432 CCGCCCCTTCTCCCCAGGGTGGG + Intergenic
1189511411 X:41665859-41665881 CCTCTGCCTCTGCCCAGGGTAGG - Intronic
1194346363 X:92771521-92771543 CTTCACCCTCTACCAAGGGCTGG + Intergenic
1200654699 Y:5888170-5888192 CTTCACCCTCTACCAAGGGCTGG + Intergenic
1201782857 Y:17742674-17742696 CTCCACCCTCAGCCAATGGTAGG - Intergenic
1201818696 Y:18163313-18163335 CTCCACCCTCAGCCAATGGTAGG + Intergenic