ID: 927885282

View in Genome Browser
Species Human (GRCh38)
Location 2:26714444-26714466
Sequence TCCCCAAGCACTGTGTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 1, 2: 2, 3: 47, 4: 410}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927885282_927885294 27 Left 927885282 2:26714444-26714466 CCCTGGGACACAGTGCTTGGGGA 0: 1
1: 1
2: 2
3: 47
4: 410
Right 927885294 2:26714494-26714516 TGGGGAGGGGTTGAGCAGGAAGG 0: 1
1: 0
2: 5
3: 83
4: 893
927885282_927885290 14 Left 927885282 2:26714444-26714466 CCCTGGGACACAGTGCTTGGGGA 0: 1
1: 1
2: 2
3: 47
4: 410
Right 927885290 2:26714481-26714503 GCCCAACTGCTGCTGGGGAGGGG 0: 1
1: 0
2: 5
3: 36
4: 365
927885282_927885285 7 Left 927885282 2:26714444-26714466 CCCTGGGACACAGTGCTTGGGGA 0: 1
1: 1
2: 2
3: 47
4: 410
Right 927885285 2:26714474-26714496 CTCTCAGGCCCAACTGCTGCTGG 0: 1
1: 0
2: 1
3: 42
4: 681
927885282_927885286 8 Left 927885282 2:26714444-26714466 CCCTGGGACACAGTGCTTGGGGA 0: 1
1: 1
2: 2
3: 47
4: 410
Right 927885286 2:26714475-26714497 TCTCAGGCCCAACTGCTGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 192
927885282_927885288 12 Left 927885282 2:26714444-26714466 CCCTGGGACACAGTGCTTGGGGA 0: 1
1: 1
2: 2
3: 47
4: 410
Right 927885288 2:26714479-26714501 AGGCCCAACTGCTGCTGGGGAGG 0: 1
1: 0
2: 2
3: 29
4: 393
927885282_927885287 9 Left 927885282 2:26714444-26714466 CCCTGGGACACAGTGCTTGGGGA 0: 1
1: 1
2: 2
3: 47
4: 410
Right 927885287 2:26714476-26714498 CTCAGGCCCAACTGCTGCTGGGG 0: 1
1: 0
2: 3
3: 28
4: 234
927885282_927885289 13 Left 927885282 2:26714444-26714466 CCCTGGGACACAGTGCTTGGGGA 0: 1
1: 1
2: 2
3: 47
4: 410
Right 927885289 2:26714480-26714502 GGCCCAACTGCTGCTGGGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 290
927885282_927885284 -8 Left 927885282 2:26714444-26714466 CCCTGGGACACAGTGCTTGGGGA 0: 1
1: 1
2: 2
3: 47
4: 410
Right 927885284 2:26714459-26714481 CTTGGGGACTGTGCACTCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 187
927885282_927885293 23 Left 927885282 2:26714444-26714466 CCCTGGGACACAGTGCTTGGGGA 0: 1
1: 1
2: 2
3: 47
4: 410
Right 927885293 2:26714490-26714512 CTGCTGGGGAGGGGTTGAGCAGG 0: 1
1: 0
2: 8
3: 56
4: 514

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927885282 Original CRISPR TCCCCAAGCACTGTGTCCCA GGG (reversed) Intronic
900295145 1:1945276-1945298 TCCCCAAGCACTGACTCCTGGGG + Intronic
900387362 1:2416704-2416726 GGCCCAGGCACTGTTTCCCACGG - Intergenic
900533243 1:3165022-3165044 TCCCCAAGCACCATGTCACTTGG - Intronic
901511390 1:9719776-9719798 TCCCCAAGCAGGGTCTCCCAGGG + Intronic
903022747 1:20405369-20405391 TTCCCAAGTCGTGTGTCCCAAGG - Intergenic
904988721 1:34574010-34574032 TCCCCAACCAGTGGGTGCCAGGG + Intergenic
905281263 1:36850807-36850829 GCCACAAAGACTGTGTCCCAGGG - Intronic
905755969 1:40509189-40509211 CCCTAAAGCACTGTCTCCCAGGG - Exonic
905952635 1:41964760-41964782 TCCCCAGGGGCTCTGTCCCAGGG - Intronic
906489387 1:46256214-46256236 TACCCAGGCACTGTGGCACATGG - Intronic
906676957 1:47700290-47700312 TCCACAAATACTGTGTCACACGG - Intergenic
907600176 1:55760895-55760917 CCCCCAAGTGCTCTGTCCCAGGG - Intergenic
907651864 1:56302818-56302840 TCACCATGCTCTGTGCCCCAGGG - Intergenic
908030103 1:59990002-59990024 TCCCAAAACGCTTTGTCCCAAGG + Intronic
910099342 1:83559945-83559967 GCCTGAAGCACTGTTTCCCAAGG - Intergenic
910422462 1:87080946-87080968 CCCCCAAGCACTTTAGCCCATGG - Intronic
910642036 1:89473732-89473754 CCCTCAGGCACTCTGTCCCAGGG - Intergenic
911669540 1:100592418-100592440 CCCCCAAGTGCTCTGTCCCAGGG - Intergenic
912076682 1:105884297-105884319 CCCCCAAGTGCTGTGTCCCAGGG + Intergenic
912133314 1:106628346-106628368 CCCCCAAGTGCTCTGTCCCAGGG + Intergenic
912270990 1:108209056-108209078 CCCCCAAGTGCTCTGTCCCAGGG + Intergenic
912893209 1:113557575-113557597 CCCTCAGGCACTCTGTCCCAGGG - Intronic
912966291 1:114240106-114240128 TCCCCAGGTGCTGTCTCCCAGGG - Intergenic
915077314 1:153319892-153319914 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
915662818 1:157417914-157417936 TTCCCAACCTCTGTGTCTCAGGG + Intergenic
915758119 1:158282789-158282811 TCCCCAGGTACTCTGTCCCAGGG + Intergenic
916985966 1:170191692-170191714 TCCCCAGGCACTCTATCCCAGGG + Intergenic
917091782 1:171360064-171360086 CCCCCATGCACTCTGTCCCAGGG - Intergenic
918844738 1:189594857-189594879 ACCCACAGCACTGTGTCCCGAGG - Intergenic
919982427 1:202650650-202650672 TCCCAGAGCACTCTATCCCAGGG - Intronic
919982833 1:202653009-202653031 TCCCCCAGCTCTGCATCCCATGG + Intronic
920428711 1:205899957-205899979 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
920635685 1:207700764-207700786 TTCCTCAGCACTGTGTCCCCAGG + Intronic
923623422 1:235595573-235595595 TCCCCATCCACCCTGTCCCATGG + Intronic
923690861 1:236191937-236191959 CCCCCAAGTGCTCTGTCCCAGGG + Intronic
924493956 1:244568453-244568475 TCCCCAGGTGCTCTGTCCCAGGG + Intronic
924551497 1:245082257-245082279 TACTCAAGCAGTGTGTCCTAAGG + Intronic
1063483919 10:6401662-6401684 TCCCAAAGCTCTGATTCCCACGG + Intergenic
1064713645 10:18152548-18152570 TCCCAAGTCACTATGTCCCAAGG - Intronic
1065427469 10:25620041-25620063 TCCCCAGGTGCTCTGTCCCACGG - Intergenic
1068575189 10:58676575-58676597 TCCCCAGGTGCTCTGTCCCAGGG - Intronic
1068724344 10:60284440-60284462 TTCACAAGCTCTGTGTCCCTGGG - Intronic
1069093431 10:64229559-64229581 CCCCCAGGTGCTGTGTCCCAGGG + Intergenic
1069139885 10:64810045-64810067 TCCCCAGGTTCTTTGTCCCAGGG + Intergenic
1071001977 10:80841361-80841383 TCCCCAGGTGCTCTGTCCCAAGG + Intergenic
1071052916 10:81473313-81473335 TCCCCAAGTTCTTTGTGCCAAGG - Intergenic
1072872341 10:99133267-99133289 TCCCCAGGTGCTCTGTCCCAGGG - Intronic
1073626009 10:105097817-105097839 TTCCCAAGTATGGTGTCCCATGG + Intronic
1073698173 10:105893958-105893980 CCCCCAGGTGCTGTGTCCCAGGG - Intergenic
1073803064 10:107064982-107065004 CCCCCAAGCACTGTTTCCCTGGG + Intronic
1074903629 10:117840775-117840797 ACCACATACACTGTGTCCCAGGG - Intergenic
1075385252 10:122050969-122050991 CACCCAAGCCCTTTGTCCCAGGG + Intronic
1075734335 10:124654772-124654794 TCCCCCAGCTCTGAGTCCCTGGG + Intronic
1076475449 10:130748600-130748622 TCCCCAAGCTCTGTGGCCTGTGG - Intergenic
1076887415 10:133269052-133269074 GCCCACAGCACTGTGGCCCAGGG - Intronic
1077061041 11:617981-618003 TCCACAAGCACTATGGCCCCCGG - Exonic
1077216059 11:1395598-1395620 TCCCCACCCACTGTGGCCCTGGG + Intronic
1077701327 11:4444813-4444835 TCCCCAACCCCTGTGCCACAGGG + Intergenic
1078602393 11:12745082-12745104 TTCCCCAGCAGTGTCTCCCAGGG - Intronic
1079588032 11:22149988-22150010 TCCCCAGGGGCTCTGTCCCAGGG + Intergenic
1079885582 11:25984182-25984204 TCCCCAAGCACAATATTCCAAGG - Intergenic
1080075537 11:28143259-28143281 TCCTCAAGGACTGTATCACATGG - Intronic
1080513750 11:33001080-33001102 TCCCCAGGGACTCTGTCCCAGGG + Intergenic
1082903567 11:58282922-58282944 TCCCCAAGTGCTCTGTCCCAGGG + Intergenic
1083049081 11:59761125-59761147 TCCCCAAGGACGGAGTTCCAAGG + Intronic
1083709347 11:64538703-64538725 TGCCCCAGGACTGTGTCCCAAGG - Intergenic
1084897421 11:72283796-72283818 CTCCCAATCACTGTGTCACAGGG - Intergenic
1084913994 11:72414133-72414155 TCCCCAGGCAGTGTGTGCCAAGG + Intronic
1085003423 11:73061838-73061860 TCCCCAAGTGCTCTGTCCCAGGG - Intronic
1086732779 11:90270673-90270695 TCCCCAGGTGCTTTGTCCCAGGG + Intergenic
1086784400 11:90948741-90948763 TCCCAAAGCACTTTTTCACAGGG + Intergenic
1087393267 11:97566719-97566741 TACCCCAGCACTGGTTCCCATGG - Intergenic
1087456836 11:98397115-98397137 TCCCCTGGGACTGTGGCCCACGG + Intergenic
1088152124 11:106757963-106757985 TCCCCAGGTGCTCTGTCCCAGGG + Intronic
1088702588 11:112426587-112426609 CCCCCAGGCACTCTGTCCCAGGG - Intergenic
1088902252 11:114127112-114127134 TCACCAAGCTCTGTGATCCAGGG - Intronic
1089602757 11:119625401-119625423 CCCACAAGGTCTGTGTCCCAGGG + Intronic
1090271348 11:125388554-125388576 TCCCCAAAAACTTTGTCCCTTGG + Intronic
1090312741 11:125756438-125756460 TCCCCCAGTGCTCTGTCCCAGGG - Intergenic
1092471998 12:8788777-8788799 TCACCAAGCAGTGAGTACCACGG + Intergenic
1092696982 12:11183270-11183292 TCCCCAACAGCTGGGTCCCAGGG + Intergenic
1092703296 12:11256875-11256897 CCCCCAGGTACTCTGTCCCAGGG - Intergenic
1094723787 12:33091470-33091492 TACACAAGGACAGTGTCCCAGGG + Intergenic
1095231273 12:39742903-39742925 TATCCAGGCACTGTTTCCCACGG - Intronic
1097412164 12:59268429-59268451 CCCCCAGGCACTGTGTCTCAGGG - Intergenic
1097517002 12:60618304-60618326 CCCCCAGGTACTCTGTCCCAGGG - Intergenic
1097880254 12:64680322-64680344 CCCCCAAGCACTGTTTCTCTGGG - Intronic
1098151825 12:67555320-67555342 CCCCCAGGTACTCTGTCCCAGGG + Intergenic
1098674025 12:73266422-73266444 CCCCAAGGCACTCTGTCCCAGGG - Intergenic
1099030875 12:77524313-77524335 TCCCCAGGTACTCTGTCCCAGGG - Intergenic
1099744934 12:86689925-86689947 TCCCCAGGTGCTCTGTCCCAGGG + Intronic
1099943915 12:89222610-89222632 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1101278362 12:103225988-103226010 TCCCCTGGAACTCTGTCCCAAGG - Intergenic
1101287053 12:103325585-103325607 ACCCAAAGAACTTTGTCCCAAGG - Intronic
1101506525 12:105351934-105351956 TCCCAAAGCAGTGTGACACATGG + Intronic
1101629609 12:106480287-106480309 TTTCAAAGCTCTGTGTCCCATGG + Intronic
1102963636 12:117110307-117110329 TCCCCAGCCACTGTGTCCATGGG - Intergenic
1103718987 12:122963531-122963553 TCACCTAGCTCTGTGACCCAGGG - Intronic
1104859295 12:131916330-131916352 TCCCCAGGCACCGGGCCCCAGGG + Intronic
1105421266 13:20254429-20254451 CCCCCAAGCATTGTGTCCAGTGG - Intergenic
1105552432 13:21410470-21410492 CCCCCAGGTGCTGTGTCCCAGGG + Intronic
1105645750 13:22316058-22316080 TCCCCCGGTGCTGTGTCCCAGGG + Intergenic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106125039 13:26894302-26894324 TACCTCAGCACTCTGTCCCAGGG - Intergenic
1106336548 13:28788815-28788837 CCCCCAGGTACTCTGTCCCAGGG + Intergenic
1107373996 13:39782508-39782530 TCCCTAAATACTGTGTGCCATGG + Intronic
1107641917 13:42452780-42452802 CCCCCAGGTACTCTGTCCCAGGG + Intergenic
1107860477 13:44655609-44655631 TCCAAAAGGCCTGTGTCCCAAGG - Intergenic
1110199685 13:72833860-72833882 TCCCCAGGTGCTCTGTCCCAGGG + Intronic
1110755284 13:79166295-79166317 TCCACAAGCACTGTACACCAGGG - Intergenic
1111187429 13:84757190-84757212 TACCCCAGCACTGGTTCCCAAGG + Intergenic
1111591443 13:90352760-90352782 TACCCTAGCACTGGGTCCCATGG - Intergenic
1111641658 13:90977551-90977573 TCCCCAGGAGCTTTGTCCCAGGG - Intergenic
1112546474 13:100376460-100376482 CCCCCAGGTACTCTGTCCCAGGG + Intronic
1112860981 13:103829629-103829651 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1113779118 13:112965867-112965889 GTCCCAAGCCGTGTGTCCCAAGG - Intronic
1114341986 14:21754606-21754628 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
1114600566 14:23953031-23953053 TCCCTAACCACTCTGTCCCCAGG - Intergenic
1114604800 14:23988175-23988197 TCCCTAACCACTCTGTCCCCAGG - Intronic
1114610250 14:24035741-24035763 TCCCTAACCACTCTGTCCCCAGG - Intergenic
1114724197 14:24917114-24917136 TCCCCTAGAAATGTGTACCAGGG - Intronic
1114844932 14:26309442-26309464 TCCCCAGGTACTCTGTCCCAGGG - Intergenic
1115157322 14:30356149-30356171 TCCGGAAGCATTTTGTCCCAAGG - Intergenic
1115842696 14:37490061-37490083 TCCCCAGGTGCTCTGTCCCAGGG + Intronic
1116493704 14:45536272-45536294 CTCCCAGGCACTCTGTCCCAAGG + Intergenic
1117859403 14:60073990-60074012 CCCCCAGGTACTCTGTCCCAGGG - Intergenic
1118149970 14:63178973-63178995 TTGCCAAGCACTGTGTCCACAGG - Intergenic
1118678733 14:68217009-68217031 TCCCCAAGTCCTGTGTCCTCTGG + Intronic
1120137312 14:80885155-80885177 TCCCCAGGTGCTGTGTCTCAGGG - Intronic
1121647224 14:95526732-95526754 TCCCCAACCACTGTGAAACAGGG + Intergenic
1122088058 14:99320614-99320636 TGCCCAAGCGCTGACTCCCACGG - Intergenic
1123637142 15:22370746-22370768 CCCCCAAGTGCTCTGTCCCAGGG + Intergenic
1125227214 15:37408686-37408708 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
1125354503 15:38803082-38803104 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1125715332 15:41816796-41816818 TCCCCAAGCCATGTGAACCATGG - Intronic
1126577104 15:50208085-50208107 CCCCCAAGCACTGGATGCCAGGG + Intronic
1129169716 15:73800169-73800191 TCACCAAGGCCTGGGTCCCAGGG + Intergenic
1129560447 15:76560773-76560795 TCCCCCAGCACTGCATCCCTGGG - Intronic
1129637211 15:77332672-77332694 TTTCCAAGCACCCTGTCCCATGG + Intronic
1129971423 15:79780869-79780891 TCCCCAGGCACTGTGTCCCAGGG - Intergenic
1130394415 15:83489608-83489630 TCCAAAAGCACTGTGCCCTAGGG - Intronic
1130441965 15:83963536-83963558 CCCCCAGGTACTCTGTCCCAGGG - Intronic
1130669064 15:85894219-85894241 TGTCAAGGCACTGTGTCCCAGGG - Intergenic
1131950459 15:97675651-97675673 TACCCCAGTACTGTTTCCCAAGG + Intergenic
1132415004 15:101613387-101613409 TCCCCAAGTAGGGTGTACCAGGG - Intergenic
1133132891 16:3688740-3688762 TCCCAAAGCACTGAGTTCCCAGG + Intronic
1136044308 16:27603173-27603195 TCCCCAAGTACTCTGCCCCAAGG - Intronic
1136866774 16:33765625-33765647 TCTCTAAGCACTGTACCCCAAGG + Intergenic
1137239279 16:46641020-46641042 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
1137868763 16:51929392-51929414 TCCCCAGGCACTGCATCTCAAGG - Intergenic
1138667622 16:58585480-58585502 TCCCCAAGAACGCTGTCCCGTGG - Exonic
1138843606 16:60538886-60538908 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1139510760 16:67427248-67427270 GCCCCAAGCCCTGTCTCCCTTGG - Intergenic
1141118182 16:81329793-81329815 TCACCCTGCACTGTCTCCCACGG + Intronic
1141287453 16:82685759-82685781 GCCCTCAGCCCTGTGTCCCAGGG + Intronic
1203105388 16_KI270728v1_random:1350577-1350599 TCTCTAAGCACTGTACCCCAAGG - Intergenic
1203128126 16_KI270728v1_random:1611791-1611813 TCTCTAAGCACTGTACCCCAAGG + Intergenic
1142685041 17:1572701-1572723 TCCCCAAGCACTGTTGGCCCTGG + Intronic
1142687835 17:1587927-1587949 TCCCCAAGCACTGTTGGCCCTGG + Intronic
1143024850 17:3935465-3935487 TCTCCAAGCACTGGGGCCAAGGG - Intronic
1143352092 17:6296528-6296550 TCTCCAAGCCCTGTGTCCCGAGG + Intergenic
1146817373 17:35953704-35953726 CCCCCAGGTACTCTGTCCCAGGG + Intergenic
1147364442 17:39951185-39951207 TCCCCAAGCAGTGGGTCACTGGG + Intergenic
1147602639 17:41755588-41755610 TCCCCAAGCACGGTGTGCCCTGG - Exonic
1148071635 17:44911917-44911939 TTCCCAACAACTGTGACCCATGG + Intronic
1148675595 17:49442944-49442966 TCCCCAGGGACGGTGTGCCAAGG + Intronic
1148865052 17:50624034-50624056 CCCCCAGCCCCTGTGTCCCAGGG - Exonic
1149281229 17:55108030-55108052 CCCCCAGGTGCTGTGTCCCAGGG + Intronic
1149562575 17:57619301-57619323 TTGTGAAGCACTGTGTCCCAAGG - Intronic
1150298347 17:64027447-64027469 TCACCGATCACTGTGTCCAAGGG + Intergenic
1150823424 17:68454446-68454468 TGCCCTATCCCTGTGTCCCAGGG - Intronic
1151187247 17:72373423-72373445 ACCCCAAGCATGGTGTCCCATGG - Intergenic
1151223056 17:72627837-72627859 TCCCAAAGCAGTGTGTGCAATGG + Intergenic
1152341339 17:79727312-79727334 TCTCTAAGCACTGTACCCCAAGG + Intergenic
1152473919 17:80505282-80505304 TCTCCAGACACTGTGTCCCTAGG - Intergenic
1152742606 17:82024931-82024953 TCCCCAAGCCCTGGACCCCACGG + Intronic
1152769148 17:82156890-82156912 TCCCCAAGCACGGTGCCCTGGGG + Intronic
1152782896 17:82234247-82234269 ACCCCAGGCAGTGTGTCCTAAGG + Exonic
1152801044 17:82330795-82330817 TCCCCAACCACTGCAGCCCAGGG - Intronic
1155021338 18:21899895-21899917 TCCCTATACACTGTGTCCTATGG - Intergenic
1157067256 18:44366558-44366580 CCCCCAAGTACTCTGTCTCAGGG + Intergenic
1157288122 18:46391303-46391325 ACCTGAACCACTGTGTCCCATGG + Intronic
1157880081 18:51313203-51313225 TCCTGAAGCACTGACTCCCAAGG - Intergenic
1158390812 18:57043544-57043566 CCACCATTCACTGTGTCCCAAGG + Intergenic
1158585154 18:58726427-58726449 CCCTCAAGCACTGAGTCCCCTGG - Intronic
1159029756 18:63218816-63218838 TCCCCATCCACTCTGTCCCTTGG + Intronic
1159490624 18:69129338-69129360 TCCCCAAGCCCTTTAGCCCATGG + Intergenic
1159779522 18:72645048-72645070 GCGACAAGCACTGTGTCCAAGGG - Intergenic
1159903798 18:74072364-74072386 TTCCCAAGGACTTTGGCCCAAGG + Intergenic
1161029676 19:2051790-2051812 TCCCCAGGCAGGGTGGCCCAGGG - Intergenic
1161703500 19:5806990-5807012 TTCCCCAGCCCTGTGTCCCTGGG - Intergenic
1163664543 19:18597101-18597123 CCCCCCAGCAGTGTGGCCCAGGG + Intronic
1163686962 19:18717273-18717295 TCCCCTAGCACCCTCTCCCAGGG + Intronic
1163690250 19:18734867-18734889 CCTCCAGGCACTGGGTCCCAGGG - Intronic
1164720478 19:30428403-30428425 TCCAAAAGAACTGAGTCCCAAGG - Intronic
1164824109 19:31271695-31271717 TCCACCAGCACAGGGTCCCAGGG + Intergenic
1165816105 19:38643276-38643298 TCCCCAGACACTGAGTCCCTAGG - Intergenic
1166363813 19:42268693-42268715 GCTCCAAGCACTCTGTCACATGG + Intronic
1166633730 19:44431069-44431091 TCTCCCTGCACTGTGTCTCAGGG + Intronic
1167135713 19:47614040-47614062 TCCTCCTGGACTGTGTCCCAAGG - Intronic
1168644657 19:58052379-58052401 TCCCCAAAGGCTCTGTCCCAGGG - Intronic
925151373 2:1617778-1617800 TCCCCAGGCACCGTCTCCCCAGG + Intergenic
925444393 2:3915355-3915377 AGCCCAAGCACAGTGGCCCAGGG + Intergenic
925885027 2:8388071-8388093 CACCCAAGCACTGTGTCCTGTGG + Intergenic
927117206 2:19916756-19916778 TCCCCAGGTGCTTTGTCCCAGGG - Intronic
927370612 2:22350947-22350969 TCACAAAGCACTCTGTCCCCTGG + Intergenic
927398837 2:22687302-22687324 TTCCCATGCAATGTGTTCCAAGG + Intergenic
927733861 2:25500615-25500637 TGGCAAAGCACTGTCTCCCAAGG - Intronic
927885282 2:26714444-26714466 TCCCCAAGCACTGTGTCCCAGGG - Intronic
929256094 2:39813285-39813307 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
931030438 2:58168978-58169000 TCCCCACGTGCTCTGTCCCAGGG - Intronic
931074002 2:58689020-58689042 CCCCCAGGTGCTGTGTCCCAGGG - Intergenic
931696750 2:64876636-64876658 TCCCAACGCACGGAGTCCCAAGG - Intergenic
931801231 2:65760153-65760175 TCCCAAAACACTGAGTCCCTGGG - Intergenic
934871861 2:97873277-97873299 TCCCCAGGTGCTCTGTCCCAGGG - Intronic
936620712 2:114094246-114094268 TACCCCAGCACTGGTTCCCAAGG + Intergenic
937143178 2:119619116-119619138 TCCCCAGGTGCTCTGTCCCAGGG - Intronic
937266274 2:120616522-120616544 TCCCCAAGCCCTGTGCCCAGAGG + Intergenic
938966610 2:136394331-136394353 TCCCCAAGCACGGTGTGCCACGG + Intergenic
939101447 2:137899008-137899030 ACCCCCAGCTCTGTGGCCCATGG + Intergenic
939946964 2:148421961-148421983 CCCCCAGGTGCTGTGTCCCAGGG - Intronic
940326736 2:152433596-152433618 CACCCAAGCACTGTGTCCAGGGG - Intronic
940408046 2:153328414-153328436 CCCCCAAGTGCTCTGTCCCAGGG + Intergenic
940946547 2:159624224-159624246 CCCCCAGGTGCTGTGTCCCAGGG - Intergenic
940999061 2:160181517-160181539 TCCCCAGGTGCTCTGTCCCAGGG - Intronic
942924142 2:181411714-181411736 TAACCAAGCACTTTGTCCCTTGG - Intergenic
943067513 2:183104772-183104794 TACAGAAGAACTGTGTCCCATGG - Intergenic
943409838 2:187533094-187533116 TCCCCAGGTGCTCTGTCCCAGGG - Intronic
944421611 2:199536873-199536895 CCCCCAAGTGCTCTGTCCCAAGG - Intergenic
945178556 2:207068094-207068116 TCCTCAAGCTCTTAGTCCCAGGG + Intergenic
945388657 2:209236144-209236166 TGCTCAAGCAGTGTGTCCAATGG + Intergenic
945980868 2:216309540-216309562 AAACCAATCACTGTGTCCCAGGG - Intronic
946336241 2:219038539-219038561 TCCCTTTGGACTGTGTCCCAAGG - Exonic
948068668 2:235102219-235102241 TCCCCAAGTTCTCTTTCCCACGG - Intergenic
948883921 2:240873703-240873725 ACCCCAGGCACCGTGTCCCTGGG - Intronic
1168825570 20:811234-811256 TCCCCAATCCCTGACTCCCAGGG + Intergenic
1168906321 20:1406821-1406843 TCACCAAGCAGTGTGTACCAAGG + Intergenic
1171513353 20:25706313-25706335 CCCCCAAGTGCTGTGTCCCAGGG + Intergenic
1172253063 20:33493448-33493470 TCCCCAAGGACTCTGGCTCAGGG - Intronic
1175126543 20:56756403-56756425 TCCACTAGCACAGAGTCCCAGGG - Intergenic
1175148793 20:56916717-56916739 TTCCCAACCACTGTGTCACCGGG - Intergenic
1175854516 20:62113326-62113348 ACCCCCAGCAGGGTGTCCCAGGG - Intergenic
1177136419 21:17309147-17309169 CCCCCAGGTACTCTGTCCCAGGG - Intergenic
1180057935 21:45368647-45368669 TCCTCTCGCTCTGTGTCCCATGG - Intergenic
1181278671 22:21703280-21703302 TCCCCGTGCAGTGTGGCCCATGG - Intronic
1181507249 22:23367969-23367991 TTCCCAGGCACTGTGTCTCAGGG - Intergenic
1181632967 22:24160993-24161015 GCCTCAAACACTGAGTCCCATGG - Intronic
1182443814 22:30379062-30379084 TCCTCAAGCACTGGGAGCCATGG - Exonic
1182952449 22:34390425-34390447 TCCCCAGGTACTCTGTCCCAGGG + Intergenic
1183021453 22:35030554-35030576 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1184512626 22:44942359-44942381 TCCCCGAGCTGTGTGTTCCAGGG - Intronic
1185345973 22:50310970-50310992 TCCCCCAGCCCTGTGTCCCCTGG + Exonic
949580564 3:5383886-5383908 TGCCCAGGTGCTGTGTCCCAGGG + Intergenic
949801152 3:7905959-7905981 CCCCCAAGTGCTCTGTCCCAGGG + Intergenic
949917497 3:8975989-8976011 TGCCTAAGTAGTGTGTCCCATGG + Intergenic
949943580 3:9173042-9173064 CCCCTAAGCACTGTGCACCAGGG + Intronic
950078749 3:10206247-10206269 TCCCCAGGCACTGTGTGCAGAGG - Intronic
950673348 3:14540135-14540157 TCCCCAAGCCCTGGGTCTCCAGG + Intronic
950764940 3:15266628-15266650 ACCCCAGGCCCTGTGCCCCAAGG + Intronic
951172232 3:19555364-19555386 CCCCAAAGCACTTTGGCCCATGG + Intergenic
951347181 3:21560756-21560778 TCCCCAGGTGCTCTGTCCCAGGG + Intronic
951629076 3:24699077-24699099 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
952924185 3:38309223-38309245 TCCACATGCACTTTCTCCCAGGG - Intronic
953816636 3:46163444-46163466 CCCGCAGGCACTCTGTCCCAGGG + Intergenic
954697648 3:52436155-52436177 TGCCCAGGCACTGGGCCCCAAGG - Intronic
955622276 3:60877435-60877457 TGCCAAAGCACTGTTTCCCCAGG - Intronic
957162912 3:76633638-76633660 TTCCCAAGCACTTTCTTCCATGG + Intronic
957474883 3:80709961-80709983 TCCCCTGGTGCTGTGTCCCAGGG - Intergenic
957783680 3:84851451-84851473 TCCCCAAGAACTGTTTCACTTGG + Intergenic
957811548 3:85228933-85228955 TCCCCAGGTACTCTGTCCCAGGG + Intronic
958434481 3:94080520-94080542 TCCCCAGGTGCTCTGTCCCAGGG + Intronic
959025696 3:101237246-101237268 CCCCCAGGTACTCTGTCCCAGGG - Intronic
959453806 3:106534577-106534599 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
959534655 3:107470891-107470913 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
959815851 3:110672087-110672109 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
960579877 3:119267697-119267719 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
961232037 3:125322655-125322677 TGCAAAATCACTGTGTCCCAGGG - Intronic
961819500 3:129567981-129568003 TCCCCAAGCCCTCTGTCCACGGG - Intronic
961826223 3:129600540-129600562 TCCATAAGCTGTGTGTCCCAGGG - Intronic
962642321 3:137400433-137400455 TCCCCAAGTGCTGTGTCTCAGGG + Intergenic
963456631 3:145554480-145554502 GCCCCTGGAACTGTGTCCCAAGG - Intergenic
964561983 3:158007253-158007275 TTCCAAATCACTGAGTCCCACGG + Intergenic
965618687 3:170621263-170621285 TCCCCAGGTGCTCTGTCCCAGGG + Intronic
969574884 4:8030965-8030987 TCCCCCAGCACTGTGTCTATGGG + Intronic
969952652 4:10854019-10854041 CCCCCAGGCACTCTGTCTCAGGG + Intergenic
970714763 4:18908273-18908295 TCCCCAAGTGTTCTGTCCCAGGG - Intergenic
970763475 4:19518579-19518601 TCCCTAGGCTCTGTGTCCCAGGG + Intergenic
971424672 4:26503947-26503969 GCCCCAAGCACAGAGTCTCAGGG + Intergenic
972255840 4:37354456-37354478 CCCCCAGGCACTCTGTCCCAGGG + Intronic
972580198 4:40388381-40388403 TTCCCAAGCACTCTGTCTAAAGG - Intergenic
972990200 4:44814800-44814822 CCACCAGGCACTCTGTCCCAGGG + Intergenic
973798437 4:54451725-54451747 CCCCCAAGTGCTCTGTCCCAGGG - Intergenic
973808468 4:54547858-54547880 GATCCAAGCACTGTGTCTCAAGG + Intergenic
975096678 4:70464777-70464799 TCCCCAGGTGCTTTGTCCCAGGG - Intronic
976616372 4:87081628-87081650 CCACAAAGCACTGTTTCCCATGG - Intronic
977438928 4:97037703-97037725 CCCCCAAGTGCTCTGTCCCAGGG + Intergenic
979967143 4:127088708-127088730 CCCTCAGGCACTCTGTCCCAGGG - Intergenic
980733191 4:136848588-136848610 CCCCCAAGTGCTCTGTCCCAGGG + Intergenic
981794903 4:148585206-148585228 CCCCCAAGTGCTCTGTCCCAGGG + Intergenic
981846563 4:149176370-149176392 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
983485852 4:168330992-168331014 CCCCCAAGTGCTCTGTCCCAGGG + Intergenic
983974757 4:173920112-173920134 CTCCCAGGCACTGTGGCCCAAGG - Intergenic
984293360 4:177823111-177823133 TCACCAAGCACTGGGTTTCATGG + Intronic
984493716 4:180468915-180468937 CCCCCAAGTGCTCTGTCCCAAGG - Intergenic
984526012 4:180860346-180860368 CCCCCAGGTACTCTGTCCCAGGG + Intergenic
985345639 4:189001821-189001843 TCCGCAGGCACTCTGCCCCAAGG + Intergenic
985416634 4:189742038-189742060 TCCCCAAGGACTGTGACATAAGG - Intergenic
985802988 5:2017987-2018009 TGTCCAAGCACTGTTACCCAAGG - Intergenic
987019298 5:13852898-13852920 CCCCCAGGCGCTCTGTCCCAGGG - Intronic
987303297 5:16616568-16616590 TCCCCCTGCACTGGGTCCCCGGG + Intronic
988772543 5:34447402-34447424 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
989363991 5:40634990-40635012 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
989492803 5:42077213-42077235 CCCCCAGGCACTTTTTCCCAGGG - Intergenic
990290081 5:54341192-54341214 GCCCCTGGCACTGTGCCCCATGG + Intergenic
990490935 5:56302294-56302316 TCACAAAGCACAGTGTCACAAGG + Intergenic
991150126 5:63358064-63358086 TACCTCAGCACTGTTTCCCATGG + Intergenic
991161422 5:63507796-63507818 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
991417183 5:66405147-66405169 CCCCCAGGTACTCTGTCCCAGGG + Intergenic
993410431 5:87567136-87567158 CCCCCAGGTGCTGTGTCCCAGGG + Intergenic
993685485 5:90932309-90932331 TTTCCAAGCTCTGTTTCCCAGGG + Intronic
994211980 5:97097021-97097043 TTCCCAAGCCCAGGGTCCCAGGG + Intronic
995811107 5:116108285-116108307 TCCCCAGGTGCTCTGTCCCAGGG + Intronic
996426574 5:123319941-123319963 CCCCCAGGCACTCTGTCCCAGGG + Intergenic
997004568 5:129803337-129803359 GCCCCAGGTACTCTGTCCCAGGG + Intergenic
997220315 5:132157030-132157052 CCCCCAAGTGCTCTGTCCCAAGG + Intergenic
997889133 5:137659483-137659505 TCCCCAAGAACTGTTTTCCTTGG + Intronic
998644642 5:144048596-144048618 CCCGCAAGTGCTGTGTCCCAGGG - Intergenic
998955327 5:147432471-147432493 CCCCCATCCACTGTGACCCAGGG - Intronic
998976894 5:147658640-147658662 CCCTCAAGTGCTGTGTCCCAGGG + Intronic
1000047284 5:157532140-157532162 TCTCCAGCCACTGTGTCTCATGG + Intronic
1000806866 5:165806089-165806111 TCCCAGAGCACTGTAGCCCATGG + Intergenic
1002895722 6:1379009-1379031 TCCCCAAGCTCTGCGGGCCACGG + Intergenic
1005778323 6:29161646-29161668 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1007251786 6:40500229-40500251 TCACCCAGCTCTGTGTCCCAGGG + Intronic
1008074028 6:47127126-47127148 TACCCCAGCACTGATTCCCACGG + Intergenic
1008425186 6:51348918-51348940 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1009455306 6:63849216-63849238 TCCCCAGGTGCTCTGTCCCAGGG - Intronic
1009458799 6:63888168-63888190 TCCCCCAGTGCTCTGTCCCAGGG - Intronic
1010006275 6:70998544-70998566 TCCCCCGGCACTCTGCCCCAGGG - Intergenic
1010276382 6:73972629-73972651 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
1011120130 6:83942991-83943013 CCCCCAGGCACTCTGTCCCAGGG - Intronic
1011214176 6:84987453-84987475 CCCCCAGGCGCTTTGTCCCAGGG - Intergenic
1011318649 6:86065398-86065420 TCCCCAGGTCCTCTGTCCCAGGG + Intergenic
1011340258 6:86306501-86306523 TTCCCAGGTGCTGTGTCCCAGGG + Intergenic
1011578243 6:88827918-88827940 CCCCCAGGTACTCTGTCCCAGGG - Intronic
1011742730 6:90378696-90378718 TCCCCAAGGACATTGTCTCAGGG + Intergenic
1012922369 6:105233616-105233638 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1013025079 6:106263371-106263393 CCCCCAGGTGCTGTGTCCCAGGG - Intronic
1013038035 6:106405413-106405435 CCCCCAAGTGCTCTGTCCCAGGG - Intergenic
1013682641 6:112541863-112541885 TCCCCCAGTGCTCTGTCCCAGGG - Intergenic
1014393551 6:120894932-120894954 CCCTCAGGCACTCTGTCCCAGGG + Intergenic
1015162972 6:130173806-130173828 CCCCCAGGCACTCTGTCCCATGG + Intronic
1016111515 6:140230659-140230681 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
1016563377 6:145423495-145423517 TCCACAAGCACTGTGGCCAGGGG - Intergenic
1016691491 6:146943219-146943241 TCCCCAGGTACTCTGTCCCAGGG + Intergenic
1016918147 6:149264261-149264283 TCCCTAAGGAATGTGTGCCAGGG + Intronic
1017844747 6:158247228-158247250 TCTACAAGCACTTTATCCCAGGG - Intronic
1018913264 6:168116557-168116579 TCCCCAAGCACTGTGCTCCCTGG + Intergenic
1018919063 6:168158360-168158382 TCGCCAAGCAGAGGGTCCCACGG + Intergenic
1018928472 6:168223272-168223294 TGCCCCAGAACTGGGTCCCAAGG + Intergenic
1020126262 7:5534001-5534023 TCCCCAAGGCCTGAGTCCAAAGG + Intronic
1020636010 7:10696415-10696437 TCCCCAGGTACTCTGTCCTAGGG - Intergenic
1020867997 7:13590779-13590801 CCCCCAGGGACTCTGTCCCAGGG + Intergenic
1021197237 7:17687277-17687299 TAGCCAAACACTGTGTCCCAGGG + Intergenic
1021322351 7:19227409-19227431 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
1021483991 7:21147067-21147089 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
1022615663 7:31927325-31927347 CCCCCAAGTGCTCTGTCCCAGGG - Intronic
1024064885 7:45724374-45724396 TCACCAAACACTGGGACCCATGG + Intergenic
1024699947 7:51896076-51896098 TCCAGAAGCATTGAGTCCCAGGG - Intergenic
1025637895 7:63339740-63339762 CCCCCAAGTGCTCTGTCCCAGGG + Intergenic
1025644802 7:63408359-63408381 CCCCCAAGTGCTCTGTCCCAGGG - Intergenic
1025840154 7:65139284-65139306 TCCCCAAGCACAGTTTTCCATGG - Intergenic
1025882909 7:65556680-65556702 TCCCCAAGCACAGTTTTCCATGG + Intergenic
1025890535 7:65645924-65645946 TCCCCAAGCACAGTTTTCCATGG - Intergenic
1027446026 7:78274549-78274571 CCCCCAAGTGCTCTGTCCCAGGG + Intronic
1027910675 7:84245965-84245987 TCCCCAGGTGCTCTGTCCCAGGG + Intronic
1028079672 7:86559503-86559525 GGCCCCAGCACTGTATCCCAAGG + Intergenic
1028080353 7:86567706-86567728 TCCCCAGGTACTCTGTTCCAAGG - Intergenic
1028353496 7:89878838-89878860 TCCCAGAGCACTGTAGCCCATGG + Intergenic
1029673041 7:102047201-102047223 GCGCCAAGCACTGTGCCACATGG - Intronic
1029694281 7:102202762-102202784 TCCCCAAGCTGTGTGTCCCCGGG - Intronic
1029850532 7:103457113-103457135 TCCCCAGGTACTCTGTCCCAGGG + Intergenic
1030534075 7:110744276-110744298 TCCCCAGGTGCTCTGTCCCAGGG - Intronic
1030703033 7:112662171-112662193 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1030943759 7:115690362-115690384 TCCCCAATCCCTGTGACCTATGG + Intergenic
1031511544 7:122656705-122656727 TCCCTAAGGACTCTGCCCCAGGG - Intronic
1032085643 7:128882081-128882103 TCCCCATGCACTGTGTCCCCAGG + Intronic
1035386030 7:158473631-158473653 TCCCCAAACATGGTGTCCCAAGG + Intronic
1036551242 8:9816483-9816505 TCCCCAGGTGCTTTGTCCCAGGG - Intergenic
1036660467 8:10705110-10705132 GCTCCAATCACTGTGGCCCAGGG - Intronic
1036750950 8:11443556-11443578 ACCCCAGCCACTGTGCCCCATGG + Intronic
1038211623 8:25523570-25523592 CCCCCAAGTGCTCTGTCCCAGGG - Intergenic
1039754795 8:40512049-40512071 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1040355044 8:46608954-46608976 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
1041838291 8:62241852-62241874 CCCCCAGGTGCTGTGTCCCAGGG + Intergenic
1043223784 8:77699208-77699230 TAACTAAGCACTGTGTCCCTTGG + Intergenic
1044450952 8:92335518-92335540 CCCTCAGGCACTTTGTCCCAGGG + Intergenic
1045212163 8:100109196-100109218 TCCCCAGGTGCTCTGTCCCAGGG - Intronic
1046067936 8:109218620-109218642 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1046886856 8:119376894-119376916 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
1047483055 8:125302690-125302712 TCCCCAACCCCTCTGTCTCAGGG - Intronic
1047569508 8:126082736-126082758 TTCCCCAGCACTCTTTCCCATGG - Intergenic
1048914064 8:139165283-139165305 CCCCCAGGTGCTGTGTCCCAGGG + Intergenic
1049045471 8:140147933-140147955 TCCCCCACCACTGAGTTCCAGGG - Intronic
1049670788 8:143868929-143868951 ACCTCAAGCACTGTGTCTGAGGG + Exonic
1050300462 9:4253224-4253246 TCCCCAGGTGCTCTGTCCCAGGG + Intronic
1051321902 9:15914257-15914279 CCCCCAGGTACTCTGTCCCAGGG + Intronic
1051548767 9:18305736-18305758 CCCCCAAGTGCTGTGTCCCAAGG - Intergenic
1053290886 9:36879099-36879121 TGCCCAAGGACAGAGTCCCATGG + Intronic
1055061471 9:72073030-72073052 TCCCCAGGTGCTCTGTCCCAAGG - Intergenic
1055494614 9:76841827-76841849 CCCCCAAGTGCTCTGTCCCAGGG - Intronic
1056176740 9:84043692-84043714 TCCCCAGGTTCTCTGTCCCAGGG + Intergenic
1056850135 9:90076702-90076724 CCCACAGGCACTGTGTCCCAGGG + Intergenic
1058200124 9:102028521-102028543 CCCCTGGGCACTGTGTCCCAGGG + Intergenic
1059220751 9:112615669-112615691 GCCCCAAACACTGTTTCTCATGG + Intronic
1059241683 9:112811404-112811426 TGCCCAACAACTGTGGCCCAAGG - Intronic
1060739163 9:126086578-126086600 CCTCAAAGCCCTGTGTCCCAAGG - Intergenic
1062195285 9:135269536-135269558 TGCCCTAGGACTCTGTCCCATGG - Intergenic
1062249159 9:135585697-135585719 GTCCCAAGCTCTGTGTCTCAGGG + Intergenic
1185529284 X:804725-804747 TCCCCAGGGACAGTGTCCCAGGG + Intergenic
1186929181 X:14369737-14369759 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
1186960906 X:14735845-14735867 CTCCCAGGCGCTGTGTCCCAGGG + Intergenic
1188921884 X:35987217-35987239 TCCCCAGGTGCTCTGTCCCAGGG + Intronic
1189210770 X:39280315-39280337 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1189717017 X:43877407-43877429 GGCCCCAACACTGTGTCCCAGGG + Intronic
1189850247 X:45170309-45170331 GCCTCCAGCACTGTGGCCCAGGG + Intronic
1190495042 X:51020683-51020705 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1190803464 X:53813676-53813698 CCCCCAGGCACTCCGTCCCAGGG + Intergenic
1190803527 X:53813945-53813967 CCCTCAGGCACTCTGTCCCAGGG + Intergenic
1191071984 X:56410638-56410660 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1191094302 X:56658780-56658802 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1191097393 X:56688225-56688247 TCCCCAGGTGCTCTGTCCCAAGG + Intergenic
1191606294 X:63066163-63066185 CCCCCAGGCGCTCTGTCCCAGGG - Intergenic
1191657495 X:63613998-63614020 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
1191762583 X:64661810-64661832 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1191809751 X:65174488-65174510 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1191824197 X:65346831-65346853 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
1192933925 X:75838890-75838912 CCCCCAAGTGCTCTGTCCCAGGG + Intergenic
1193003607 X:76591038-76591060 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1193071930 X:77315195-77315217 CCCCCAAGTTCTCTGTCCCAGGG - Intergenic
1193161323 X:78232673-78232695 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1193404513 X:81084433-81084455 TCCCCAGGTACTCTGTCCCAGGG - Intergenic
1193409372 X:81144028-81144050 CCCCCAAGTGCTCTGTCCCAAGG - Intronic
1193793664 X:85847015-85847037 CCCCCAAGTGCTCTGTCCCAGGG + Intergenic
1194537128 X:95119293-95119315 CCCCCAGACACTTTGTCCCAGGG + Intergenic
1194635736 X:96343150-96343172 TCCCCAGGAGCTCTGTCCCAAGG + Intergenic
1194771844 X:97915781-97915803 CCCCCAAGTGCTCTGTCCCAGGG - Intergenic
1194953372 X:100152938-100152960 CCCCCAGGCACCCTGTCCCAGGG + Intergenic
1194959026 X:100214383-100214405 CCCCCAAGTACTCTGACCCAGGG + Intergenic
1195414268 X:104602856-104602878 TCCCCAGGTGCTCTGTCCCAGGG - Intronic
1195948231 X:110238577-110238599 TCCCCAGGTGCTCTGTCCCAGGG - Intronic
1196367771 X:114942823-114942845 TCCCCAGGTGCTCTGTCCCAGGG + Intergenic
1197830625 X:130638755-130638777 TACCCAAGGACTGGGTCCCATGG - Intronic
1198020017 X:132648315-132648337 TCCTCATGCACTGGGACCCACGG - Intronic
1198072204 X:133159882-133159904 TCCCCAGGTGCTTTGTCCCAGGG - Intergenic
1198085670 X:133279461-133279483 CCCCCAAGTGCTCTGTCCCAGGG - Intergenic
1198555856 X:137792562-137792584 TCCCCAGGTGCTCTGTCCCAGGG - Intergenic
1199401661 X:147405785-147405807 ACCCCAGGTGCTGTGTCCCAGGG - Intergenic
1201422249 Y:13812319-13812341 TCCCCAGGTACTCTTTCCCAGGG + Intergenic
1201688751 Y:16737687-16737709 CCCCCAAGTGCTCTGTCCCAGGG + Intergenic
1201707185 Y:16950119-16950141 TCCCCAGGTCCTCTGTCCCAGGG - Intergenic