ID: 927887554

View in Genome Browser
Species Human (GRCh38)
Location 2:26727980-26728002
Sequence CATCGGCTTCGGCGACTACG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 24}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927887547_927887554 8 Left 927887547 2:26727949-26727971 CCTACTACTACTGCTTCATCACC 0: 2
1: 1
2: 0
3: 10
4: 142
Right 927887554 2:26727980-26728002 CATCGGCTTCGGCGACTACGTGG 0: 1
1: 1
2: 0
3: 3
4: 24
927887546_927887554 13 Left 927887546 2:26727944-26727966 CCAGGCCTACTACTACTGCTTCA 0: 1
1: 2
2: 0
3: 10
4: 168
Right 927887554 2:26727980-26728002 CATCGGCTTCGGCGACTACGTGG 0: 1
1: 1
2: 0
3: 3
4: 24
927887545_927887554 20 Left 927887545 2:26727937-26727959 CCTTCTTCCAGGCCTACTACTAC 0: 1
1: 1
2: 2
3: 11
4: 120
Right 927887554 2:26727980-26728002 CATCGGCTTCGGCGACTACGTGG 0: 1
1: 1
2: 0
3: 3
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927887554 Original CRISPR CATCGGCTTCGGCGACTACG TGG Exonic
900296963 1:1956742-1956764 CATTGACTTCGGCAGCTACGTGG - Exonic
922241025 1:223755628-223755650 CATCGGCTTTGGCATCTATGAGG + Exonic
1063613088 10:7579846-7579868 CATTGGCATCGGCAACGACGTGG - Exonic
1083670554 11:64297628-64297650 CGTGGGCTTTGGCGACTATGTGG + Exonic
1107468014 13:40666600-40666622 CAGCGGCTGCTGCGACTACCAGG + Intergenic
1125795545 15:42401789-42401811 CATTGGCTTCGCCATCTACGAGG + Exonic
1136155769 16:28380919-28380941 GAGTGGCTTGGGCGACTACGTGG - Intronic
1136207315 16:28734370-28734392 GAGTGGCTTGGGCGACTACGTGG + Intronic
1138132292 16:54490832-54490854 CATAGGCTTCAGAGACTACAAGG - Intergenic
1144328941 17:14207063-14207085 CCTCGGCTTCCGCTTCTACGTGG + Exonic
1155937803 18:31772356-31772378 AATGGGCTTCGGGGACTCCGGGG + Intergenic
1160597634 18:79988290-79988312 CATCCGCTTCGGCCACGACTGGG - Exonic
1161013189 19:1969925-1969947 GATCGGCTGCGGCAACTTCGGGG + Exonic
1163830233 19:19544042-19544064 CATCGGCTTCACCGCCTACCAGG + Exonic
1163845362 19:19635473-19635495 CACCAGCTGCGGCGACTGCGGGG - Exonic
927887554 2:26727980-26728002 CATCGGCTTCGGCGACTACGTGG + Exonic
929858120 2:45652364-45652386 CATAGGCTACGACGACTTCGTGG + Exonic
932837313 2:75049659-75049681 CATCAGCGCCGGCGACTATGAGG - Exonic
1169478071 20:5950327-5950349 CATCCGCGACGGCGACTTCGTGG - Exonic
1173663551 20:44750442-44750464 CATCGGCTTCGGCGACTTCGTGG + Exonic
1185301840 22:50084977-50084999 CATCGGCTTTGGCCACTCTGAGG + Intronic
977911046 4:102536857-102536879 CATCTGCTTAAGCGACTATGTGG + Intronic
1004169279 6:13283469-13283491 CATCCGCTTCAGTGACTACGTGG + Exonic
1007092725 6:39194172-39194194 CATCGGCTTCGGTGACTTTGTGG - Exonic
1024787379 7:52923758-52923780 CATAGGCTTGGGCGATTAAGTGG - Intergenic
1029448390 7:100627317-100627339 CCTCGACTTCGGCCGCTACGGGG - Exonic
1034128970 7:148698744-148698766 CACCGGCTCCGGCGACCGCGGGG - Intronic
1048966517 8:139618764-139618786 CATTGGGTTCGGGGACTACGTGG - Exonic
1058504769 9:105656275-105656297 CGACGGCTACGGCGACGACGCGG + Intergenic