ID: 927891533

View in Genome Browser
Species Human (GRCh38)
Location 2:26753378-26753400
Sequence ACCTGAAATCCCAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 778210
Summary {0: 385, 1: 75426, 2: 306750, 3: 245351, 4: 150298}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927891533_927891546 24 Left 927891533 2:26753378-26753400 CCCAAAGTGCTGGGATTTCAGGT 0: 385
1: 75426
2: 306750
3: 245351
4: 150298
Right 927891546 2:26753425-26753447 GCTAGGGTTTTTAAGGGTTTTGG No data
927891533_927891548 30 Left 927891533 2:26753378-26753400 CCCAAAGTGCTGGGATTTCAGGT 0: 385
1: 75426
2: 306750
3: 245351
4: 150298
Right 927891548 2:26753431-26753453 GTTTTTAAGGGTTTTGGAGAGGG No data
927891533_927891537 1 Left 927891533 2:26753378-26753400 CCCAAAGTGCTGGGATTTCAGGT 0: 385
1: 75426
2: 306750
3: 245351
4: 150298
Right 927891537 2:26753402-26753424 TAAGCCACTTCGCCTGGCCTGGG No data
927891533_927891543 17 Left 927891533 2:26753378-26753400 CCCAAAGTGCTGGGATTTCAGGT 0: 385
1: 75426
2: 306750
3: 245351
4: 150298
Right 927891543 2:26753418-26753440 GCCTGGGGCTAGGGTTTTTAAGG No data
927891533_927891535 -5 Left 927891533 2:26753378-26753400 CCCAAAGTGCTGGGATTTCAGGT 0: 385
1: 75426
2: 306750
3: 245351
4: 150298
Right 927891535 2:26753396-26753418 CAGGTGTAAGCCACTTCGCCTGG No data
927891533_927891538 2 Left 927891533 2:26753378-26753400 CCCAAAGTGCTGGGATTTCAGGT 0: 385
1: 75426
2: 306750
3: 245351
4: 150298
Right 927891538 2:26753403-26753425 AAGCCACTTCGCCTGGCCTGGGG No data
927891533_927891547 29 Left 927891533 2:26753378-26753400 CCCAAAGTGCTGGGATTTCAGGT 0: 385
1: 75426
2: 306750
3: 245351
4: 150298
Right 927891547 2:26753430-26753452 GGTTTTTAAGGGTTTTGGAGAGG 0: 17
1: 51
2: 82
3: 85
4: 377
927891533_927891540 7 Left 927891533 2:26753378-26753400 CCCAAAGTGCTGGGATTTCAGGT 0: 385
1: 75426
2: 306750
3: 245351
4: 150298
Right 927891540 2:26753408-26753430 ACTTCGCCTGGCCTGGGGCTAGG No data
927891533_927891545 18 Left 927891533 2:26753378-26753400 CCCAAAGTGCTGGGATTTCAGGT 0: 385
1: 75426
2: 306750
3: 245351
4: 150298
Right 927891545 2:26753419-26753441 CCTGGGGCTAGGGTTTTTAAGGG No data
927891533_927891541 8 Left 927891533 2:26753378-26753400 CCCAAAGTGCTGGGATTTCAGGT 0: 385
1: 75426
2: 306750
3: 245351
4: 150298
Right 927891541 2:26753409-26753431 CTTCGCCTGGCCTGGGGCTAGGG No data
927891533_927891536 0 Left 927891533 2:26753378-26753400 CCCAAAGTGCTGGGATTTCAGGT 0: 385
1: 75426
2: 306750
3: 245351
4: 150298
Right 927891536 2:26753401-26753423 GTAAGCCACTTCGCCTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927891533 Original CRISPR ACCTGAAATCCCAGCACTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr