ID: 927891534

View in Genome Browser
Species Human (GRCh38)
Location 2:26753379-26753401
Sequence CACCTGAAATCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 735169
Summary {0: 368, 1: 71808, 2: 207412, 3: 251313, 4: 204268}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927891534_927891543 16 Left 927891534 2:26753379-26753401 CCAAAGTGCTGGGATTTCAGGTG 0: 368
1: 71808
2: 207412
3: 251313
4: 204268
Right 927891543 2:26753418-26753440 GCCTGGGGCTAGGGTTTTTAAGG No data
927891534_927891547 28 Left 927891534 2:26753379-26753401 CCAAAGTGCTGGGATTTCAGGTG 0: 368
1: 71808
2: 207412
3: 251313
4: 204268
Right 927891547 2:26753430-26753452 GGTTTTTAAGGGTTTTGGAGAGG 0: 17
1: 51
2: 82
3: 85
4: 377
927891534_927891536 -1 Left 927891534 2:26753379-26753401 CCAAAGTGCTGGGATTTCAGGTG 0: 368
1: 71808
2: 207412
3: 251313
4: 204268
Right 927891536 2:26753401-26753423 GTAAGCCACTTCGCCTGGCCTGG No data
927891534_927891541 7 Left 927891534 2:26753379-26753401 CCAAAGTGCTGGGATTTCAGGTG 0: 368
1: 71808
2: 207412
3: 251313
4: 204268
Right 927891541 2:26753409-26753431 CTTCGCCTGGCCTGGGGCTAGGG No data
927891534_927891540 6 Left 927891534 2:26753379-26753401 CCAAAGTGCTGGGATTTCAGGTG 0: 368
1: 71808
2: 207412
3: 251313
4: 204268
Right 927891540 2:26753408-26753430 ACTTCGCCTGGCCTGGGGCTAGG No data
927891534_927891535 -6 Left 927891534 2:26753379-26753401 CCAAAGTGCTGGGATTTCAGGTG 0: 368
1: 71808
2: 207412
3: 251313
4: 204268
Right 927891535 2:26753396-26753418 CAGGTGTAAGCCACTTCGCCTGG No data
927891534_927891538 1 Left 927891534 2:26753379-26753401 CCAAAGTGCTGGGATTTCAGGTG 0: 368
1: 71808
2: 207412
3: 251313
4: 204268
Right 927891538 2:26753403-26753425 AAGCCACTTCGCCTGGCCTGGGG No data
927891534_927891548 29 Left 927891534 2:26753379-26753401 CCAAAGTGCTGGGATTTCAGGTG 0: 368
1: 71808
2: 207412
3: 251313
4: 204268
Right 927891548 2:26753431-26753453 GTTTTTAAGGGTTTTGGAGAGGG No data
927891534_927891537 0 Left 927891534 2:26753379-26753401 CCAAAGTGCTGGGATTTCAGGTG 0: 368
1: 71808
2: 207412
3: 251313
4: 204268
Right 927891537 2:26753402-26753424 TAAGCCACTTCGCCTGGCCTGGG No data
927891534_927891545 17 Left 927891534 2:26753379-26753401 CCAAAGTGCTGGGATTTCAGGTG 0: 368
1: 71808
2: 207412
3: 251313
4: 204268
Right 927891545 2:26753419-26753441 CCTGGGGCTAGGGTTTTTAAGGG No data
927891534_927891546 23 Left 927891534 2:26753379-26753401 CCAAAGTGCTGGGATTTCAGGTG 0: 368
1: 71808
2: 207412
3: 251313
4: 204268
Right 927891546 2:26753425-26753447 GCTAGGGTTTTTAAGGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927891534 Original CRISPR CACCTGAAATCCCAGCACTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr