ID: 927891539

View in Genome Browser
Species Human (GRCh38)
Location 2:26753406-26753428
Sequence TAGCCCCAGGCCAGGCGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927891539_927891550 12 Left 927891539 2:26753406-26753428 CCACTTCGCCTGGCCTGGGGCTA No data
Right 927891550 2:26753441-26753463 GTTTTGGAGAGGGCTGAAGTGGG No data
927891539_927891546 -4 Left 927891539 2:26753406-26753428 CCACTTCGCCTGGCCTGGGGCTA No data
Right 927891546 2:26753425-26753447 GCTAGGGTTTTTAAGGGTTTTGG No data
927891539_927891545 -10 Left 927891539 2:26753406-26753428 CCACTTCGCCTGGCCTGGGGCTA No data
Right 927891545 2:26753419-26753441 CCTGGGGCTAGGGTTTTTAAGGG No data
927891539_927891551 13 Left 927891539 2:26753406-26753428 CCACTTCGCCTGGCCTGGGGCTA No data
Right 927891551 2:26753442-26753464 TTTTGGAGAGGGCTGAAGTGGGG No data
927891539_927891548 2 Left 927891539 2:26753406-26753428 CCACTTCGCCTGGCCTGGGGCTA No data
Right 927891548 2:26753431-26753453 GTTTTTAAGGGTTTTGGAGAGGG No data
927891539_927891549 11 Left 927891539 2:26753406-26753428 CCACTTCGCCTGGCCTGGGGCTA No data
Right 927891549 2:26753440-26753462 GGTTTTGGAGAGGGCTGAAGTGG No data
927891539_927891547 1 Left 927891539 2:26753406-26753428 CCACTTCGCCTGGCCTGGGGCTA No data
Right 927891547 2:26753430-26753452 GGTTTTTAAGGGTTTTGGAGAGG 0: 17
1: 51
2: 82
3: 85
4: 377
927891539_927891552 28 Left 927891539 2:26753406-26753428 CCACTTCGCCTGGCCTGGGGCTA No data
Right 927891552 2:26753457-26753479 AAGTGGGGAGATCGTTGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927891539 Original CRISPR TAGCCCCAGGCCAGGCGAAG TGG (reversed) Intergenic
No off target data available for this crispr