ID: 927891542

View in Genome Browser
Species Human (GRCh38)
Location 2:26753414-26753436
Sequence AAAAACCCTAGCCCCAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927891542_927891550 4 Left 927891542 2:26753414-26753436 CCTGGCCTGGGGCTAGGGTTTTT No data
Right 927891550 2:26753441-26753463 GTTTTGGAGAGGGCTGAAGTGGG No data
927891542_927891551 5 Left 927891542 2:26753414-26753436 CCTGGCCTGGGGCTAGGGTTTTT No data
Right 927891551 2:26753442-26753464 TTTTGGAGAGGGCTGAAGTGGGG No data
927891542_927891549 3 Left 927891542 2:26753414-26753436 CCTGGCCTGGGGCTAGGGTTTTT No data
Right 927891549 2:26753440-26753462 GGTTTTGGAGAGGGCTGAAGTGG No data
927891542_927891552 20 Left 927891542 2:26753414-26753436 CCTGGCCTGGGGCTAGGGTTTTT No data
Right 927891552 2:26753457-26753479 AAGTGGGGAGATCGTTGATTAGG No data
927891542_927891548 -6 Left 927891542 2:26753414-26753436 CCTGGCCTGGGGCTAGGGTTTTT No data
Right 927891548 2:26753431-26753453 GTTTTTAAGGGTTTTGGAGAGGG No data
927891542_927891547 -7 Left 927891542 2:26753414-26753436 CCTGGCCTGGGGCTAGGGTTTTT No data
Right 927891547 2:26753430-26753452 GGTTTTTAAGGGTTTTGGAGAGG 0: 17
1: 51
2: 82
3: 85
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927891542 Original CRISPR AAAAACCCTAGCCCCAGGCC AGG (reversed) Intergenic
No off target data available for this crispr