ID: 927891545

View in Genome Browser
Species Human (GRCh38)
Location 2:26753419-26753441
Sequence CCTGGGGCTAGGGTTTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927891527_927891545 30 Left 927891527 2:26753366-26753388 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 927891545 2:26753419-26753441 CCTGGGGCTAGGGTTTTTAAGGG No data
927891539_927891545 -10 Left 927891539 2:26753406-26753428 CCACTTCGCCTGGCCTGGGGCTA No data
Right 927891545 2:26753419-26753441 CCTGGGGCTAGGGTTTTTAAGGG No data
927891531_927891545 21 Left 927891531 2:26753375-26753397 CCTCCCAAAGTGCTGGGATTTCA 0: 1326
1: 296799
2: 267546
3: 155755
4: 134271
Right 927891545 2:26753419-26753441 CCTGGGGCTAGGGTTTTTAAGGG No data
927891533_927891545 18 Left 927891533 2:26753378-26753400 CCCAAAGTGCTGGGATTTCAGGT 0: 385
1: 75426
2: 306750
3: 245351
4: 150298
Right 927891545 2:26753419-26753441 CCTGGGGCTAGGGTTTTTAAGGG No data
927891529_927891545 27 Left 927891529 2:26753369-26753391 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 927891545 2:26753419-26753441 CCTGGGGCTAGGGTTTTTAAGGG No data
927891534_927891545 17 Left 927891534 2:26753379-26753401 CCAAAGTGCTGGGATTTCAGGTG 0: 368
1: 71808
2: 207412
3: 251313
4: 204268
Right 927891545 2:26753419-26753441 CCTGGGGCTAGGGTTTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927891545 Original CRISPR CCTGGGGCTAGGGTTTTTAA GGG Intergenic
No off target data available for this crispr