ID: 927891548

View in Genome Browser
Species Human (GRCh38)
Location 2:26753431-26753453
Sequence GTTTTTAAGGGTTTTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927891534_927891548 29 Left 927891534 2:26753379-26753401 CCAAAGTGCTGGGATTTCAGGTG 0: 368
1: 71808
2: 207412
3: 251313
4: 204268
Right 927891548 2:26753431-26753453 GTTTTTAAGGGTTTTGGAGAGGG No data
927891542_927891548 -6 Left 927891542 2:26753414-26753436 CCTGGCCTGGGGCTAGGGTTTTT No data
Right 927891548 2:26753431-26753453 GTTTTTAAGGGTTTTGGAGAGGG No data
927891533_927891548 30 Left 927891533 2:26753378-26753400 CCCAAAGTGCTGGGATTTCAGGT 0: 385
1: 75426
2: 306750
3: 245351
4: 150298
Right 927891548 2:26753431-26753453 GTTTTTAAGGGTTTTGGAGAGGG No data
927891539_927891548 2 Left 927891539 2:26753406-26753428 CCACTTCGCCTGGCCTGGGGCTA No data
Right 927891548 2:26753431-26753453 GTTTTTAAGGGTTTTGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927891548 Original CRISPR GTTTTTAAGGGTTTTGGAGA GGG Intergenic
No off target data available for this crispr