ID: 927891550

View in Genome Browser
Species Human (GRCh38)
Location 2:26753441-26753463
Sequence GTTTTGGAGAGGGCTGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927891544_927891550 -1 Left 927891544 2:26753419-26753441 CCTGGGGCTAGGGTTTTTAAGGG No data
Right 927891550 2:26753441-26753463 GTTTTGGAGAGGGCTGAAGTGGG No data
927891542_927891550 4 Left 927891542 2:26753414-26753436 CCTGGCCTGGGGCTAGGGTTTTT No data
Right 927891550 2:26753441-26753463 GTTTTGGAGAGGGCTGAAGTGGG No data
927891539_927891550 12 Left 927891539 2:26753406-26753428 CCACTTCGCCTGGCCTGGGGCTA No data
Right 927891550 2:26753441-26753463 GTTTTGGAGAGGGCTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927891550 Original CRISPR GTTTTGGAGAGGGCTGAAGT GGG Intergenic
No off target data available for this crispr