ID: 927891551

View in Genome Browser
Species Human (GRCh38)
Location 2:26753442-26753464
Sequence TTTTGGAGAGGGCTGAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927891542_927891551 5 Left 927891542 2:26753414-26753436 CCTGGCCTGGGGCTAGGGTTTTT No data
Right 927891551 2:26753442-26753464 TTTTGGAGAGGGCTGAAGTGGGG No data
927891544_927891551 0 Left 927891544 2:26753419-26753441 CCTGGGGCTAGGGTTTTTAAGGG No data
Right 927891551 2:26753442-26753464 TTTTGGAGAGGGCTGAAGTGGGG No data
927891539_927891551 13 Left 927891539 2:26753406-26753428 CCACTTCGCCTGGCCTGGGGCTA No data
Right 927891551 2:26753442-26753464 TTTTGGAGAGGGCTGAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927891551 Original CRISPR TTTTGGAGAGGGCTGAAGTG GGG Intergenic
No off target data available for this crispr