ID: 927892379

View in Genome Browser
Species Human (GRCh38)
Location 2:26759833-26759855
Sequence GAGTGGACGCAGAACTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927892379_927892382 0 Left 927892379 2:26759833-26759855 CCTTGAGAGTTCTGCGTCCACTC No data
Right 927892382 2:26759856-26759878 TGGCCTTTTTCACAAGTTCGAGG No data
927892379_927892388 28 Left 927892379 2:26759833-26759855 CCTTGAGAGTTCTGCGTCCACTC No data
Right 927892388 2:26759884-26759906 TTAGGGCAAGTAGGAGGAGTTGG No data
927892379_927892385 11 Left 927892379 2:26759833-26759855 CCTTGAGAGTTCTGCGTCCACTC No data
Right 927892385 2:26759867-26759889 ACAAGTTCGAGGCTGTCTTAGGG No data
927892379_927892384 10 Left 927892379 2:26759833-26759855 CCTTGAGAGTTCTGCGTCCACTC No data
Right 927892384 2:26759866-26759888 CACAAGTTCGAGGCTGTCTTAGG No data
927892379_927892386 19 Left 927892379 2:26759833-26759855 CCTTGAGAGTTCTGCGTCCACTC No data
Right 927892386 2:26759875-26759897 GAGGCTGTCTTAGGGCAAGTAGG No data
927892379_927892387 22 Left 927892379 2:26759833-26759855 CCTTGAGAGTTCTGCGTCCACTC No data
Right 927892387 2:26759878-26759900 GCTGTCTTAGGGCAAGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927892379 Original CRISPR GAGTGGACGCAGAACTCTCA AGG (reversed) Intergenic
No off target data available for this crispr