ID: 927892382

View in Genome Browser
Species Human (GRCh38)
Location 2:26759856-26759878
Sequence TGGCCTTTTTCACAAGTTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927892376_927892382 27 Left 927892376 2:26759806-26759828 CCTGCAATAAGGGAGTCTGGTGC No data
Right 927892382 2:26759856-26759878 TGGCCTTTTTCACAAGTTCGAGG No data
927892379_927892382 0 Left 927892379 2:26759833-26759855 CCTTGAGAGTTCTGCGTCCACTC No data
Right 927892382 2:26759856-26759878 TGGCCTTTTTCACAAGTTCGAGG No data
927892378_927892382 1 Left 927892378 2:26759832-26759854 CCCTTGAGAGTTCTGCGTCCACT No data
Right 927892382 2:26759856-26759878 TGGCCTTTTTCACAAGTTCGAGG No data
927892377_927892382 2 Left 927892377 2:26759831-26759853 CCCCTTGAGAGTTCTGCGTCCAC No data
Right 927892382 2:26759856-26759878 TGGCCTTTTTCACAAGTTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927892382 Original CRISPR TGGCCTTTTTCACAAGTTCG AGG Intergenic
No off target data available for this crispr