ID: 927892384

View in Genome Browser
Species Human (GRCh38)
Location 2:26759866-26759888
Sequence CACAAGTTCGAGGCTGTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927892377_927892384 12 Left 927892377 2:26759831-26759853 CCCCTTGAGAGTTCTGCGTCCAC No data
Right 927892384 2:26759866-26759888 CACAAGTTCGAGGCTGTCTTAGG No data
927892381_927892384 -7 Left 927892381 2:26759850-26759872 CCACTCTGGCCTTTTTCACAAGT No data
Right 927892384 2:26759866-26759888 CACAAGTTCGAGGCTGTCTTAGG No data
927892379_927892384 10 Left 927892379 2:26759833-26759855 CCTTGAGAGTTCTGCGTCCACTC No data
Right 927892384 2:26759866-26759888 CACAAGTTCGAGGCTGTCTTAGG No data
927892378_927892384 11 Left 927892378 2:26759832-26759854 CCCTTGAGAGTTCTGCGTCCACT No data
Right 927892384 2:26759866-26759888 CACAAGTTCGAGGCTGTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927892384 Original CRISPR CACAAGTTCGAGGCTGTCTT AGG Intergenic
No off target data available for this crispr