ID: 927893534

View in Genome Browser
Species Human (GRCh38)
Location 2:26767161-26767183
Sequence CTCTCACAGCTCCCCAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 523}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927893527_927893534 4 Left 927893527 2:26767134-26767156 CCAGAGTCCCTCCTTCCTGGGAG 0: 1
1: 0
2: 5
3: 37
4: 491
Right 927893534 2:26767161-26767183 CTCTCACAGCTCCCCAGGCCAGG 0: 1
1: 0
2: 3
3: 64
4: 523
927893524_927893534 6 Left 927893524 2:26767132-26767154 CCCCAGAGTCCCTCCTTCCTGGG 0: 1
1: 0
2: 7
3: 59
4: 482
Right 927893534 2:26767161-26767183 CTCTCACAGCTCCCCAGGCCAGG 0: 1
1: 0
2: 3
3: 64
4: 523
927893526_927893534 5 Left 927893526 2:26767133-26767155 CCCAGAGTCCCTCCTTCCTGGGA 0: 1
1: 0
2: 4
3: 48
4: 847
Right 927893534 2:26767161-26767183 CTCTCACAGCTCCCCAGGCCAGG 0: 1
1: 0
2: 3
3: 64
4: 523
927893529_927893534 -4 Left 927893529 2:26767142-26767164 CCTCCTTCCTGGGAGTTTCCTCT 0: 1
1: 0
2: 4
3: 29
4: 381
Right 927893534 2:26767161-26767183 CTCTCACAGCTCCCCAGGCCAGG 0: 1
1: 0
2: 3
3: 64
4: 523
927893522_927893534 29 Left 927893522 2:26767109-26767131 CCTGTTCTTTTATGACTGTGATA 0: 1
1: 0
2: 1
3: 17
4: 217
Right 927893534 2:26767161-26767183 CTCTCACAGCTCCCCAGGCCAGG 0: 1
1: 0
2: 3
3: 64
4: 523
927893530_927893534 -7 Left 927893530 2:26767145-26767167 CCTTCCTGGGAGTTTCCTCTCAC 0: 1
1: 0
2: 3
3: 23
4: 306
Right 927893534 2:26767161-26767183 CTCTCACAGCTCCCCAGGCCAGG 0: 1
1: 0
2: 3
3: 64
4: 523
927893528_927893534 -3 Left 927893528 2:26767141-26767163 CCCTCCTTCCTGGGAGTTTCCTC 0: 1
1: 0
2: 8
3: 42
4: 393
Right 927893534 2:26767161-26767183 CTCTCACAGCTCCCCAGGCCAGG 0: 1
1: 0
2: 3
3: 64
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927893534 Original CRISPR CTCTCACAGCTCCCCAGGCC AGG Intronic
900114989 1:1024577-1024599 CCCTCCGAGCTCCCCAGGTCGGG + Intronic
900308832 1:2023854-2023876 CTCTCGCAGCTCGGGAGGCCAGG + Intronic
900397237 1:2458118-2458140 CTGTCAGAGCTCCCGAGGACAGG - Intronic
900589551 1:3453653-3453675 ATCTCACGGCCGCCCAGGCCAGG + Intergenic
900895242 1:5478746-5478768 CTCTGACAGCTCCCCACGGCTGG + Intergenic
900896596 1:5487134-5487156 CTCTCACAGATCCCAAATCCAGG - Intergenic
901066216 1:6495971-6495993 CACTCCCAGCTCCCAAGCCCTGG + Intronic
901229583 1:7634347-7634369 TTCCCACAGCTGCCCAGGTCTGG - Intronic
901510932 1:9717753-9717775 CGCTCACAGCGCCCCAGGCAGGG - Intronic
901584202 1:10273965-10273987 CTCTCACTGCTGCCCAGGCTGGG + Intronic
902111031 1:14078539-14078561 TTCTCACAGCTCTGCAGGCTGGG + Intergenic
902122269 1:14176436-14176458 CTGCCACAGCTGCCCAGGGCAGG + Intergenic
902268636 1:15287382-15287404 GACTCACAGTTCCCCAGGGCTGG + Intronic
902503762 1:16926538-16926560 CTCCCTCCGCTCCCCATGCCAGG - Intronic
902690750 1:18108958-18108980 TGCTCACAACTCCCCAGCCCCGG - Intronic
903012664 1:20342551-20342573 CTCTCACAGGGCTCCAGGCCTGG - Exonic
903187270 1:21635688-21635710 CCCTCACAACTCCCCAGGCGGGG + Intronic
903282500 1:22257887-22257909 CACTCACAGCTCCCTGGGCATGG + Intergenic
903388783 1:22948708-22948730 CTCTCACAGTTCCAGAAGCCAGG + Intergenic
903393809 1:22983915-22983937 CTCTAGCAGCTGCCTAGGCCAGG - Intergenic
904961978 1:34340538-34340560 CTCTCAGACTTCTCCAGGCCAGG - Intergenic
905137218 1:35808590-35808612 CGGTCACCGCCCCCCAGGCCCGG - Intronic
905318242 1:37097207-37097229 CTCTCACATCACCCCAGGCTGGG - Intergenic
905350267 1:37341007-37341029 CTCTCTCAGCTGCCCTTGCCTGG - Intergenic
905749526 1:40450193-40450215 CTCGCCCAGCTCCCCAAGCCCGG - Intronic
905892088 1:41524009-41524031 CTGCCACAGCCACCCAGGCCAGG - Intronic
906142355 1:43541169-43541191 CCATCTCACCTCCCCAGGCCAGG - Intronic
906240021 1:44237069-44237091 TTCTCACAAGTCCCCGGGCCAGG - Intronic
907551446 1:55308473-55308495 CCCTCAGAGCTGCCCAGCCCAGG - Intergenic
907841785 1:58165290-58165312 CTCTCACATCCCTCCGGGCCAGG - Intronic
910938151 1:92504108-92504130 CTCTCCCAGCTCCCTCGGCCCGG - Intergenic
911102599 1:94106096-94106118 CTCTCACAGCCTCTAAGGCCAGG + Intronic
911468449 1:98284921-98284943 CTCCCCCAGCCCCCCAGCCCCGG + Intergenic
912084532 1:105982268-105982290 TTCTCACAGCTCCCCCAGGCAGG - Intergenic
912558252 1:110531665-110531687 ACAGCACAGCTCCCCAGGCCAGG + Intergenic
913061765 1:115215205-115215227 TTCTCCCAGTGCCCCAGGCCCGG - Intergenic
915077384 1:153320328-153320350 CTCTCACAGCTTCCCTTGGCTGG + Intergenic
915735342 1:158081028-158081050 GCCCCCCAGCTCCCCAGGCCAGG + Intronic
916264240 1:162874452-162874474 CTCTTACAGTTCCGGAGGCCAGG + Intergenic
918361050 1:183758513-183758535 CTCTCACAGCTCTGGAGGCTGGG + Intronic
919695273 1:200568151-200568173 CACTCACAGCTGCCCAGACGGGG + Intronic
920295892 1:204956137-204956159 CACTGACATCTCCCCAGCCCCGG + Intronic
920301651 1:204992585-204992607 CTCACCCTGTTCCCCAGGCCTGG - Intronic
921944057 1:220874450-220874472 CTGTCCCAGCCCACCAGGCCCGG - Intergenic
922346570 1:224701322-224701344 CTCTCACAGCTCTGGAGGCTGGG + Intronic
922661594 1:227435108-227435130 CCATCTCAGCTCCCCAGGCTTGG + Intergenic
922722122 1:227904553-227904575 CTCTCACACGGCCCCAGCCCTGG + Intergenic
922758478 1:228109600-228109622 CTCCCTCAGCTCCCCACCCCGGG - Intergenic
922768872 1:228171291-228171313 CTGAGAAAGCTCCCCAGGCCGGG + Intronic
922938272 1:229437489-229437511 CTCTCTCTGTTGCCCAGGCCTGG - Intergenic
923015128 1:230120645-230120667 GACGCACAGCTCCCCAGGGCTGG + Intronic
923171574 1:231421958-231421980 CTCTCCCCGCTCCCCAGCCTCGG - Exonic
923261957 1:232276142-232276164 CTCTCCCACCTCCCCAAGGCAGG + Intergenic
923559570 1:235028280-235028302 TTTTCAAAGCTCCCCAGGCGAGG + Intergenic
1062786390 10:268834-268856 ATCCCACAGCTCCCCAAGTCTGG - Intergenic
1064442948 10:15370538-15370560 CGCTCCCGGCTCCCCACGCCGGG - Intronic
1064852565 10:19725437-19725459 GACTCACAGTTCCACAGGCCTGG - Intronic
1065129702 10:22608319-22608341 CCCTCACTGCTCCCCCTGCCTGG - Intronic
1066694072 10:38062253-38062275 CTCTCACAGCTCTGGAGGCAGGG - Intronic
1066704595 10:38164406-38164428 CTCTCACAGTTCCGCAGGCTGGG - Intergenic
1066985983 10:42466792-42466814 CTCTCACAGTTCTGCAGGCTGGG + Intergenic
1067044064 10:42974718-42974740 CCCTCACCCCACCCCAGGCCTGG + Intergenic
1067522604 10:47019560-47019582 CTTCCACCTCTCCCCAGGCCTGG - Intergenic
1068610685 10:59056894-59056916 CTCTCACATATCCCCAAACCTGG - Intergenic
1068752114 10:60606891-60606913 CTCTCACTGCTCCCCAGATCCGG + Intronic
1069618782 10:69823574-69823596 CTCACCCAGGTCCCCAAGCCAGG + Intronic
1069958035 10:72063500-72063522 CTCCCACAGTTCCGCCGGCCTGG + Intronic
1070669443 10:78367808-78367830 CCCTCACACTTCCCCAGGCCTGG - Intergenic
1070814364 10:79313531-79313553 CTCTCTCTGTTCCCCAAGCCTGG - Exonic
1070887915 10:79921106-79921128 GTCCTTCAGCTCCCCAGGCCCGG - Intergenic
1071021594 10:81063719-81063741 TTCTCACAGCTCTGGAGGCCAGG - Intergenic
1071518438 10:86314484-86314506 CTCTGATATTTCCCCAGGCCAGG - Intronic
1071559383 10:86633163-86633185 TACTCAGAGATCCCCAGGCCTGG + Intergenic
1071877903 10:89862359-89862381 CTCTCTCAACTCCCAATGCCTGG - Intergenic
1072353722 10:94585442-94585464 CGCTCACTGCACTCCAGGCCTGG - Intronic
1072601714 10:96937336-96937358 CTCTCACAGCTCTGGAGTCCAGG - Intronic
1072735737 10:97878145-97878167 AGCCCACTGCTCCCCAGGCCAGG - Intronic
1073138733 10:101233980-101234002 GCCTCCCTGCTCCCCAGGCCTGG - Intergenic
1073539060 10:104303400-104303422 CTTCCACAGGTCCCTAGGCCAGG - Intronic
1074149198 10:110743041-110743063 CTCTCAGAGCACCTCAAGCCTGG + Intronic
1074853656 10:117457885-117457907 CTGAATCAGCTCCCCAGGCCTGG + Intergenic
1075455249 10:122580857-122580879 TTCTCACAGCTCCCCAGTCCCGG + Exonic
1075455835 10:122584313-122584335 TTCTCACAGCTGCCCACTCCTGG + Exonic
1075456883 10:122590656-122590678 TTCTCACAGCTGCCCAGTCCCGG + Exonic
1075457372 10:122593560-122593582 TTCTCACAGTTTCCCAGTCCCGG + Exonic
1075457958 10:122597016-122597038 TTCTCACAGCTGCCCACTCCTGG + Exonic
1075458447 10:122600055-122600077 TTCTCACAGCTTCCCAGTCCCGG + Exonic
1076177288 10:128377797-128377819 CCCTCAGAACTCCCCAGGCAAGG + Intergenic
1076350884 10:129814463-129814485 TTCTCACAGTTCCTAAGGCCGGG - Intergenic
1076501085 10:130936565-130936587 CTCTCACAGATCTTCAGGCAGGG - Intergenic
1076620167 10:131781968-131781990 AACTCACAGCTCCCAGGGCCAGG - Intergenic
1076725399 10:132410669-132410691 CCCTCACAGCTCCCAGGACCAGG - Intronic
1076910966 10:133389353-133389375 CTGTCACAGCTCCCGGGTCCCGG + Intronic
1076988037 11:253477-253499 CTCTTGCAGCTCTCCAGGTCGGG + Intergenic
1077185657 11:1234352-1234374 CTTTCCCAGCTCCCGAGCCCAGG + Intronic
1077227617 11:1445232-1445254 CCCTCGCAGCCGCCCAGGCCCGG + Intronic
1077336724 11:2008524-2008546 CTCTCACAGCTCTGCAAGCCAGG - Intergenic
1077366227 11:2162411-2162433 CCCTCCCAGCTCCCCAGAACAGG + Intergenic
1077445179 11:2587473-2587495 CCCTCCCTGTTCCCCAGGCCTGG - Intronic
1078634238 11:13033943-13033965 GTCTCACAGTTCCGGAGGCCAGG - Intergenic
1079248964 11:18773348-18773370 CTCTGTCACCTTCCCAGGCCCGG - Intronic
1080482649 11:32667557-32667579 CTGTCACAGCTCCCTTGGCTAGG + Intronic
1080559116 11:33445942-33445964 TTCTCACAGTTCCACAGGCCAGG - Intergenic
1080619862 11:33978394-33978416 CCCTCAAAGCTCTCCAGGCAAGG + Intergenic
1080740097 11:35055839-35055861 GACTCACAGCTCCGCAGGGCTGG - Intergenic
1081632269 11:44697738-44697760 CTCTCACTCCTGACCAGGCCTGG + Intergenic
1082029532 11:47594345-47594367 CCCTCACGCCTCCCCACGCCCGG - Exonic
1083162960 11:60867098-60867120 CAGTCACAGCTCCTCAGGCAGGG - Intergenic
1083955066 11:65978471-65978493 TTCCCACTGCACCCCAGGCCTGG + Intronic
1084000260 11:66292113-66292135 CTCTCACGCCGCCCCAGGCCCGG - Intronic
1084794507 11:71496198-71496220 CCCTCACAGTTCCAGAGGCCAGG + Intronic
1084931720 11:72561541-72561563 CTGTAACAGCTCCTGAGGCCAGG - Intergenic
1084961835 11:72720963-72720985 CTCTAAGCGCTTCCCAGGCCTGG + Intronic
1085736815 11:79046189-79046211 ATCTCACAGCTGACCAGGCTGGG - Intronic
1085743491 11:79095927-79095949 CTCTAACAGCAGGCCAGGCCGGG + Intronic
1086224774 11:84494563-84494585 CTCACACAGATCACCAGCCCAGG - Intronic
1087779824 11:102290435-102290457 TTCTCACAGCTTTGCAGGCCAGG + Intergenic
1088148497 11:106714794-106714816 CTGTAACAGCTCCCCAGCCCTGG + Intronic
1088649174 11:111942262-111942284 CTATCACTGCTCCACATGCCTGG - Intronic
1088772323 11:113047677-113047699 GGCTCACAGTTCCCCAGGGCTGG + Intronic
1088971598 11:114779341-114779363 CCCCCACACCGCCCCAGGCCAGG - Intergenic
1089366831 11:117925826-117925848 CCCACCCAGCTCCCCAGCCCAGG + Intronic
1089461542 11:118657025-118657047 CTGTGACAGCTCCTCAGCCCTGG - Exonic
1089498429 11:118919252-118919274 CTCCCCCAGGTCCTCAGGCCAGG - Intronic
1089583469 11:119495764-119495786 CTCCCACAGCTTCCCCGGCCTGG + Intergenic
1090052138 11:123388842-123388864 TTCTCACAGTTCCGGAGGCCAGG - Intergenic
1090640131 11:128722949-128722971 CTCTCACAGTTCTGGAGGCCAGG + Intronic
1202819708 11_KI270721v1_random:63706-63728 CTCTCACAGCTCTGCAAGCCAGG - Intergenic
1092241659 12:6839654-6839676 CCGTCCCAGCTCCCCAGGCCTGG - Exonic
1092346598 12:7720475-7720497 CTCTCTCAGTTGCCCAGGCTGGG + Intergenic
1092408289 12:8235668-8235690 CTCTCACGGTACCACAGGCCTGG - Intergenic
1093646160 12:21587599-21587621 GTCTCACAGTTCCACAGGGCTGG - Intronic
1096265247 12:50117498-50117520 CTCTCAAGGCTCCTCAGGACTGG + Intronic
1096783282 12:54003065-54003087 CACGCAGAGCGCCCCAGGCCCGG - Exonic
1097029513 12:56080910-56080932 ATCTCAGACCTCCCCAGGGCAGG - Intronic
1097040409 12:56152927-56152949 CTCTCCCAGCGCCCCTGGCAAGG + Intronic
1097198432 12:57258004-57258026 CTCACACAGTTCCCCCGGCCTGG - Exonic
1099522453 12:83681453-83681475 CTCTCACAGCTTCCCTTGTCTGG - Intergenic
1101874663 12:108590241-108590263 CTCTCCAAGCACCCCCGGCCTGG - Exonic
1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG + Intronic
1101997794 12:109537418-109537440 TTCTCGCTGCTCCCCTGGCCTGG + Intergenic
1103466324 12:121144726-121144748 CTCTATCACCTCCCCAGTCCAGG - Intronic
1103738809 12:123077960-123077982 CTCTCCCAGCAGCCCATGCCTGG + Intronic
1103844334 12:123891037-123891059 CTCTCACAGTTCTGGAGGCCAGG + Intronic
1103865218 12:124046171-124046193 CTCTAGCACTTCCCCAGGCCTGG + Intronic
1104505499 12:129328065-129328087 CTTTCACAACTTCCCAGGCTGGG + Intronic
1104584824 12:130039556-130039578 GACTCACAGTTCCCCAGGGCTGG + Intergenic
1104683848 12:130771540-130771562 CCCTCACAGCTCCCACAGCCAGG + Intergenic
1104733751 12:131123339-131123361 CTCTTAAAGCTTCCCAGGGCCGG - Intronic
1104929236 12:132329457-132329479 CCCTCACCGCTCCCCGGGGCGGG - Intergenic
1106227152 13:27794085-27794107 CTCTCAGCCCTGCCCAGGCCCGG - Exonic
1107058365 13:36130775-36130797 CTCTCCCAGCTCCTCCGCCCTGG + Intronic
1107065913 13:36214373-36214395 CAATGAGAGCTCCCCAGGCCGGG + Intronic
1107128021 13:36865400-36865422 ATCTCAGAGCTCACCAGCCCTGG + Intronic
1107818998 13:44269391-44269413 CTCTAACAGCCCCCCAGGCTTGG + Intergenic
1108153705 13:47563825-47563847 CTCTCACAGCTTCCCTTGGCTGG - Intergenic
1108182904 13:47858612-47858634 CTCTCACCATTCCCCAGACCTGG + Intergenic
1108281476 13:48866394-48866416 CTCTCACAGTCCCGCAGGCTAGG - Intergenic
1108721593 13:53138271-53138293 CTCTCAGATCTGCCCCGGCCTGG + Intergenic
1108910523 13:55545592-55545614 CACTCACAGTTCCGCATGCCTGG + Intergenic
1109626687 13:64983248-64983270 CTCTCACAGCTTCCCTTGGCTGG + Intergenic
1110124999 13:71931678-71931700 GACTCACAGTTCCCCAGGGCTGG - Intergenic
1111283381 13:86056235-86056257 GACTCACAGCTCCACATGCCTGG - Intergenic
1112433458 13:99373542-99373564 GGCTCACAGCTCCTCAGGGCAGG - Intronic
1113709151 13:112452686-112452708 CTCTCACTGCTCTCCAGTGCTGG + Intergenic
1113777818 13:112958722-112958744 CTCATGCAGCTCCTCAGGCCTGG + Intronic
1113888425 13:113724077-113724099 CTCTCACCTCCCCCCAGGCAGGG + Intronic
1117282028 14:54250866-54250888 CTCTCTCGGCTCCCCAAGCATGG - Intergenic
1117891969 14:60431837-60431859 CTCTCATAGATCCAGAGGCCAGG - Intronic
1118180080 14:63483787-63483809 CTCAAAAAGCTCCCGAGGCCAGG + Intronic
1119693166 14:76692530-76692552 CTCTCACAGCCCTGGAGGCCAGG + Intergenic
1119766871 14:77195905-77195927 CCATCACAGCTCCCCAAGGCAGG + Intronic
1120693855 14:87622193-87622215 GTTCCACAGATCCCCAGGCCAGG + Intergenic
1120766023 14:88326866-88326888 GTCTCACAGCTACCCCGGGCTGG - Intronic
1122613171 14:102999488-102999510 CTTTCAGAGCTCCCAAGTCCAGG - Intronic
1122621058 14:103057754-103057776 CCCGCGCCGCTCCCCAGGCCCGG - Intergenic
1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG + Intergenic
1122649960 14:103220768-103220790 CGCGCAGAGCTCCCCAAGCCTGG - Intergenic
1122813929 14:104303101-104303123 CACTGAGAGCTCCCCAGCCCAGG - Intergenic
1122882928 14:104698091-104698113 TCCTCAGAGCTCCCCAGCCCCGG - Intronic
1122970540 14:105150415-105150437 CTGTCACAGGTCACCAGGCTTGG - Intronic
1123047579 14:105526468-105526490 CGCTCCCAGGTCCCCAGGTCCGG + Intergenic
1123171082 14:106373536-106373558 CGCCCACAGATCCCGAGGCCGGG - Intergenic
1123630051 15:22254969-22254991 CTCTCACAGTTCTGGAGGCCAGG + Intergenic
1124229909 15:27935527-27935549 ATCTCTCAGCACCCCAGCCCAGG + Intronic
1124615707 15:31240580-31240602 CTCTCATAGCTGGCCAGGCGAGG - Intergenic
1124998483 15:34747112-34747134 CTCTGACAGCCCACCAGGCACGG - Intergenic
1125439108 15:39682493-39682515 TTCTCACTGCTCCCCAGGAAGGG + Intronic
1126080491 15:44956689-44956711 CTCTCACATCTCCACAGGCTTGG + Exonic
1126379307 15:48029617-48029639 GTATCACAGCACCCCAGGGCAGG + Intergenic
1126512969 15:49501425-49501447 CTTTCACAGATCCCTAGGGCAGG - Intronic
1127381914 15:58437978-58438000 CTCTCACAGAGACCCAGGACTGG + Intronic
1128146053 15:65333112-65333134 CCCTCACCGGCCCCCAGGCCAGG - Intronic
1128300843 15:66565542-66565564 GTCTCAGAGCTCCCCAGGCACGG - Intronic
1128748346 15:70130735-70130757 CTGTCACACCTCCCCAGTGCAGG - Intergenic
1129481127 15:75827294-75827316 GGCTCTCAGCTCCCCAGACCAGG + Intergenic
1130095984 15:80856655-80856677 CTGTCACAGCTCCCTGGCCCTGG + Intronic
1130370618 15:83283486-83283508 CGCTCGCAGGTCCCAAGGCCAGG + Intronic
1130517086 15:84633807-84633829 CTCTCTCCGCTCCCCAGCCTCGG + Intergenic
1130585053 15:85174202-85174224 ATGTCACAGCTGCCCAGGCTGGG - Intergenic
1131628805 15:94153692-94153714 AACTCACAGCTCCACATGCCTGG + Intergenic
1131793600 15:95990952-95990974 TTCTCACTGCTCCCCAGCTCAGG - Intergenic
1132096345 15:98987901-98987923 CTCTCACAGCTTCCCTTGGCTGG - Intronic
1132349993 15:101133552-101133574 CTCACACAGCCCCCCATGGCTGG - Intergenic
1132488220 16:208559-208581 CTCTCACAACTCCCCAGAAGAGG - Intronic
1132525908 16:414646-414668 CTCCCACAGCTGCCGTGGCCTGG + Intergenic
1132826444 16:1907776-1907798 ATCTCAGAGCTCCCCAGGGTTGG + Intergenic
1132902781 16:2267656-2267678 CACTCACAACTCCCCCGTCCAGG + Intronic
1132989686 16:2786420-2786442 ATCTCACTGCTCCCTGGGCCGGG - Intronic
1133276495 16:4641234-4641256 CCCTAACACTTCCCCAGGCCTGG + Intronic
1133299757 16:4775158-4775180 CTCTGGAAGCTCCCCAGTCCTGG + Intergenic
1133470643 16:6072052-6072074 GACTCACAGCTCCACAGGGCTGG + Intronic
1133809907 16:9154009-9154031 CTCTCACTGCACCCCACTCCTGG + Intergenic
1135149336 16:19991906-19991928 CACTCACAGCTGCCCAGGAGAGG - Intergenic
1135554380 16:23423961-23423983 CTAACACAGCTCCCCTGCCCTGG + Intronic
1136107644 16:28041656-28041678 CTAACAGATCTCCCCAGGCCTGG + Intronic
1136267872 16:29131535-29131557 CCCTCAGGGCGCCCCAGGCCAGG + Intergenic
1136273068 16:29159775-29159797 CTCTCACAGCGGCCCAGGGCCGG - Intergenic
1136417769 16:30113989-30114011 CACTCCCAGCTGCCCAGGGCTGG - Intergenic
1137781109 16:51098575-51098597 CTCTCACATTCCCCCAAGCCTGG - Intergenic
1138806412 16:60094661-60094683 GACTCACAGTTCCCCAGGTCTGG - Intergenic
1139371832 16:66473804-66473826 CACTCACAGCCCCCCAGCTCTGG + Intronic
1140046083 16:71441484-71441506 CTGTCACAGCTGCCCACGGCCGG - Intergenic
1140277770 16:73526142-73526164 ATCTCACAGCTGCCCTGGACTGG - Intergenic
1140600046 16:76464435-76464457 CTGTCACAGTTCCCCAGGACTGG - Intronic
1141170451 16:81687396-81687418 CCCTCAGAGGTGCCCAGGCCTGG + Intronic
1141682345 16:85551967-85551989 CTTGGAGAGCTCCCCAGGCCTGG - Intergenic
1141795710 16:86272338-86272360 CTCTCACACCTTCCCAGGGCTGG + Intergenic
1141819694 16:86436785-86436807 CTAGCAAAGCTCCCCAGGCGAGG - Intergenic
1141925650 16:87167117-87167139 AACTCACAGGTCCTCAGGCCTGG + Intronic
1141973037 16:87495690-87495712 CTCTCACAGTTCTGGAGGCCAGG - Intergenic
1142029664 16:87832238-87832260 CTCCCCTAGCTCACCAGGCCTGG - Exonic
1142071175 16:88091882-88091904 CCCTCAGGGCGCCCCAGGCCAGG + Intronic
1142076617 16:88121577-88121599 CTCTCACAGTGGCCCAGGGCCGG - Intergenic
1142226588 16:88880678-88880700 CTCCCACAGCTCTGCTGGCCAGG + Intronic
1142356991 16:89605959-89605981 CCCTCACACCAGCCCAGGCCGGG - Intergenic
1142666463 17:1466653-1466675 CTCACTCTGTTCCCCAGGCCTGG + Intronic
1143094506 17:4470608-4470630 ATCTCTCTGCTCCCCAGCCCGGG + Intronic
1143476694 17:7207284-7207306 CTCTCCCTGATCCCCAGCCCAGG - Intronic
1144735397 17:17552791-17552813 CTTTCTGAGCTCCCCAGGGCAGG + Intronic
1144834713 17:18150819-18150841 CTGCCACCTCTCCCCAGGCCCGG + Exonic
1145796266 17:27656998-27657020 ATCTCACACCTCCTCATGCCTGG - Intergenic
1146679639 17:34797829-34797851 CTCGCACAGTTCCCAAGGTCTGG + Intergenic
1146953753 17:36923888-36923910 CACTAACAGTTCCCCAGGCAGGG - Intergenic
1147374814 17:40017179-40017201 CTATGACTGCTCCCCAGCCCTGG + Exonic
1148048765 17:44759239-44759261 CTGTCGCTGCTCCCCACGCCCGG + Exonic
1148851363 17:50557038-50557060 CTCTTCCACCTCCCCAGGCTGGG - Intergenic
1149304710 17:55336276-55336298 CACCCCCTGCTCCCCAGGCCAGG + Intergenic
1149893250 17:60408877-60408899 CTCTGACATCACCCCATGCCAGG + Intronic
1150003875 17:61457713-61457735 CTCCCACAGGCCACCAGGCCGGG - Intronic
1150289235 17:63972100-63972122 CTCCCTGAGCTCCCCAGCCCTGG - Intronic
1150590337 17:66556810-66556832 GACTCACAGATCCACAGGCCTGG - Intronic
1150647013 17:66985078-66985100 CGATCACAGCTGCCCAGGCTGGG - Intronic
1151154896 17:72117553-72117575 CTATTCCAGTTCCCCAGGCCGGG - Intergenic
1151441703 17:74133505-74133527 TTCTCCCTGCCCCCCAGGCCAGG + Intergenic
1151486152 17:74402100-74402122 CACTCCCAGCTCCCCGGTCCTGG + Intergenic
1151530256 17:74699689-74699711 CTCTCACAGCTAAGGAGGCCAGG - Intronic
1151686564 17:75650637-75650659 CACTCACAGCTCCGCATGCCTGG + Intronic
1151724349 17:75875831-75875853 CTCGCACAGGCCCCCAGGCCTGG - Intronic
1151985594 17:77541253-77541275 CTTTCCCAGCTCCTCAGACCAGG + Intergenic
1152123408 17:78432604-78432626 CTGTCACAGCCTCCCAGGCCAGG + Intronic
1152305008 17:79515246-79515268 CTCCCACTGCTCCCCAGGCCAGG + Intronic
1152323049 17:79619310-79619332 CTCTCACAGTTCTGGAGGCCAGG + Intergenic
1152516142 17:80826017-80826039 TCCTCAGAGCTCCCCAGGGCCGG - Intronic
1152584903 17:81184643-81184665 CTCTCAGAGCTCCCCTGCTCTGG - Intergenic
1152608809 17:81305804-81305826 CTCCTACAGCTCCCAGGGCCGGG - Intergenic
1152724874 17:81940225-81940247 CTGGCACAGCTCCCCAGGCAGGG + Exonic
1153149092 18:2069863-2069885 CACACACATCTCCCCAGCCCTGG + Intergenic
1153691789 18:7601418-7601440 CTCTCACAGTTCTGGAGGCCAGG + Intronic
1154060488 18:11055539-11055561 CTGTCACAGCTCCCTTTGCCTGG - Intronic
1156008582 18:32470977-32470999 CTCCCGCAGCTCCCGCGGCCCGG + Intergenic
1157215175 18:45776556-45776578 ATCTCACACCTCCCAAGGTCAGG + Intergenic
1157257711 18:46153318-46153340 CTCTCAGCTCTCACCAGGCCAGG - Intergenic
1157324316 18:46657782-46657804 CTCTCCCCGCTCCCCCTGCCAGG + Intergenic
1158538569 18:58330829-58330851 CTCTGACAGCTCCTGAGGGCTGG - Exonic
1158615567 18:58983481-58983503 CACTCACAGCTTCCTATGCCTGG + Intronic
1160033083 18:75279071-75279093 TTCTCCCACCACCCCAGGCCAGG - Intronic
1160394157 18:78559642-78559664 CTACCACAGCTCCCCAGGCAGGG - Intergenic
1160395946 18:78572382-78572404 CATTCACAGCTTCCCAGGACTGG - Intergenic
1160395959 18:78572448-78572470 CATTCACAGCTTCCCAGGACTGG - Intergenic
1160395975 18:78572514-78572536 CATTCACAGCTTCCCAGGACTGG - Intergenic
1160395991 18:78572580-78572602 CATTCACAGCTTCCCAGGACTGG - Intergenic
1160396007 18:78572646-78572668 CATTCACAGCTTCCCAGGACTGG - Intergenic
1160491832 18:79344646-79344668 CTCTGACATCTCCTCAGGCTGGG - Intronic
1160546494 18:79660253-79660275 TTCTGACAGCTCCCCTGACCCGG - Intergenic
1160571269 18:79819159-79819181 CTCTCACTGCTCACCAAGGCCGG + Intergenic
1160595808 18:79973298-79973320 CTCTCACAGCTTTGCAGGCGGGG - Exonic
1160747984 19:720489-720511 CCCTCACCTCTCCCCAGGCCCGG - Intronic
1160747998 19:720517-720539 CTCTCGCCCCTCCCCAGACCCGG - Intronic
1161378949 19:3954427-3954449 CTCTCAGAGCTCCAGAGGTCAGG + Intergenic
1161577190 19:5060815-5060837 CTCTCACAGCTTTCCTGGCGAGG + Intronic
1161619965 19:5292779-5292801 CAGTCACAGCTCCCCCGGGCTGG + Intronic
1161851491 19:6740045-6740067 CTCTCTCAGCCGCCCCGGCCTGG - Intronic
1162673962 19:12284441-12284463 CTCTCAGAGCTCCGCGGCCCCGG - Intronic
1163461529 19:17440846-17440868 CTCTCAATGCCCCCCAAGCCTGG - Intronic
1163782297 19:19256971-19256993 ATCTTACCGGTCCCCAGGCCTGG + Exonic
1165080696 19:33304410-33304432 CTCCCACAACTCCACAGGCCGGG - Intergenic
1165685672 19:37817660-37817682 CTCTCCCGCCTCCTCAGGCCCGG + Intergenic
1166534452 19:43563537-43563559 GTCTGACTGCTCCCCAGGCCAGG + Intronic
1166747847 19:45150379-45150401 CTCTCACAGCACCCCACTCCTGG + Exonic
1166834510 19:45659148-45659170 CTGTCACAGCTTCCCATTCCTGG + Intergenic
1167158978 19:47755531-47755553 CTCTCCCAGAACCCCCGGCCTGG - Intronic
1168349508 19:55668103-55668125 CTCTGACAGCCACCCAGGCAAGG - Intronic
924972996 2:147891-147913 CACTCACAGCTCCACATGGCTGG + Intergenic
925183288 2:1830717-1830739 CCTCCACAGTTCCCCAGGCCTGG - Intronic
926519948 2:13897887-13897909 TTCTCACAGCTCCACTGGGCAGG - Intergenic
927869553 2:26614915-26614937 CTCTCAAAGCTCCCAAGAGCAGG - Intronic
927893534 2:26767161-26767183 CTCTCACAGCTCCCCAGGCCAGG + Intronic
929537723 2:42793710-42793732 CCCTCACAGCCCGCCTGGCCTGG + Intergenic
931173936 2:59834027-59834049 CTCCCTCAGCACCCCAGGCTGGG + Intergenic
931835494 2:66094677-66094699 CTCCCCCAGCTCCCCACCCCAGG + Intergenic
931899761 2:66774639-66774661 GTCTCACAACTCCTCAGACCTGG - Intergenic
932322843 2:70834626-70834648 CTCTCTCTGGTACCCAGGCCTGG - Intronic
932334268 2:70920987-70921009 ATCGCAGAGCTCCTCAGGCCTGG - Intronic
932373491 2:71213044-71213066 TCCCCACTGCTCCCCAGGCCAGG - Intronic
932780560 2:74556104-74556126 CTCCCACAGCTGCCCAACCCAGG - Intronic
932858151 2:75260497-75260519 ATCTCTCAGCTACCCTGGCCTGG + Intergenic
933606357 2:84388625-84388647 CTGTCACAGTCTCCCAGGCCTGG + Intergenic
933805688 2:85996864-85996886 CCCCTCCAGCTCCCCAGGCCTGG - Intergenic
934064370 2:88326591-88326613 TTCTCACAGCTCTGGAGGCCAGG - Intergenic
934492857 2:94773616-94773638 CTGTCACAGGCCCCGAGGCCTGG - Intergenic
934885531 2:98021211-98021233 ATCTGACGGCTCCCCAGGGCTGG + Intergenic
935274435 2:101463781-101463803 CTCCCACAGCTCACCAGGTGTGG - Intronic
935680830 2:105635707-105635729 CTCCTACAGCTCGCCAAGCCAGG - Intergenic
936020939 2:108994314-108994336 CTCTCTCTGCTCCCCAGCCAGGG + Intergenic
938080388 2:128367044-128367066 ATCTCACAGCCCCCAGGGCCAGG + Intergenic
938082226 2:128376351-128376373 CCCTCCCAGCACCCCAGCCCAGG - Intergenic
938114280 2:128592570-128592592 CTCTGACAACTACCCAAGCCAGG - Intergenic
938139911 2:128787037-128787059 CTCTCAGAGCTGTCCTGGCCAGG + Intergenic
938144019 2:128819365-128819387 ATCTCAGAACTCCCTAGGCCAGG + Intergenic
940134970 2:150425482-150425504 TTCTGCCAGCTCCCCCGGCCTGG + Intergenic
940302499 2:152189872-152189894 TTCCCACAGCTCCAAAGGCCTGG + Intergenic
941143577 2:161815451-161815473 GTCTCACAGCTCCATATGCCTGG - Intronic
942189050 2:173453249-173453271 CTGCCCCAGCTCCCCAGCCCTGG - Intergenic
942397754 2:175569501-175569523 CCCTCACAGGTCACCAGGCCAGG - Intergenic
943861390 2:192868446-192868468 CTCACACAAGTCCCCAGGTCAGG + Intergenic
946035999 2:216742720-216742742 CTCTCTCAGCTCCCAAGGGAAGG - Intergenic
946057160 2:216912366-216912388 CTCTCAGAGCCTCCCAGGACTGG - Intergenic
947459028 2:230286443-230286465 CTCTCTCACCTCCCCAATCCTGG - Intronic
947707689 2:232289807-232289829 CTCCCACAGCTACACAGCCCTGG - Intronic
947712902 2:232326049-232326071 CTAGCACAGCTCCCCAGGAGAGG + Intronic
947717576 2:232349612-232349634 CTTTCTCAGGACCCCAGGCCAGG + Intergenic
947804813 2:232958876-232958898 CACCCACTCCTCCCCAGGCCTGG + Intronic
948989739 2:241547665-241547687 CTCTCTCTGTTGCCCAGGCCGGG + Intergenic
1170508711 20:17055174-17055196 CACTCACAGCTTCCCTGGGCAGG + Intergenic
1171457586 20:25280699-25280721 CTCACCCAACTCCCCAGCCCAGG - Intronic
1172295916 20:33811282-33811304 CTCCCACAGGCCCCCACGCCCGG - Exonic
1173031494 20:39365233-39365255 CTCACTCTGTTCCCCAGGCCTGG - Intergenic
1173531515 20:43773115-43773137 CTCCCACAGTCCCCCAGGGCAGG - Intergenic
1173840317 20:46152767-46152789 GTCTCACTGCCACCCAGGCCTGG + Intergenic
1174395677 20:50245571-50245593 CATTCACAGCTCTCCACGCCAGG + Intergenic
1175202907 20:57290326-57290348 CTCTCACAGTTCCAGAAGCCTGG + Intergenic
1175249376 20:57599855-57599877 TTCTCACAACTCCCCATGCAGGG + Intergenic
1175761123 20:61562610-61562632 CTCTCCCTGCTCTGCAGGCCTGG - Intronic
1175764831 20:61585022-61585044 CTCTGAGAGCTCGCCAGGCCTGG + Intronic
1175863498 20:62162730-62162752 CACTCCCTGCTCCCCATGCCAGG + Exonic
1175989208 20:62779139-62779161 CTGTCGCAGCTGCCCTGGCCAGG - Intergenic
1176069560 20:63218945-63218967 CCCTCCCAGGTCCTCAGGCCTGG - Intergenic
1176176686 20:63730343-63730365 CTCGTACACCTCCCCAGGCCAGG - Intronic
1176222393 20:63975827-63975849 CTCTTTCCTCTCCCCAGGCCGGG - Exonic
1176268394 20:64222607-64222629 CTCTCACAGTCCCCTAGGACAGG - Intronic
1176413096 21:6459295-6459317 CTCTCACAGGTCCCCCGGCTGGG + Intergenic
1177659162 21:24060512-24060534 GACTCACAGCTCCCCACGGCTGG + Intergenic
1178911034 21:36673901-36673923 CTCTCACAGCTCTGAAGGCCAGG - Intergenic
1179005846 21:37513318-37513340 CACTCAGACCTCCCCAGGACTGG - Intronic
1179221884 21:39415467-39415489 CTCTGACCACTCCCCAGCCCTGG + Intronic
1179651125 21:42809530-42809552 CTTTCACAGCTCTCCAGGGTGGG + Intergenic
1179688591 21:43067617-43067639 CTCTCACAGGTCCCCCGGCTGGG + Intronic
1179731848 21:43372584-43372606 CTCTCTCATCTCCCGAGGTCTGG - Intergenic
1179925463 21:44531736-44531758 CTGTCCCAGCACCCCAGGCCGGG - Intronic
1180004640 21:45014660-45014682 CTCTCTCGGCTCCCCTGGCCCGG - Intergenic
1180998198 22:19975869-19975891 CTCCCACAGGTGCCCAGGCCTGG - Intronic
1181314321 22:21961858-21961880 GCCTCACAAGTCCCCAGGCCTGG - Intronic
1182277047 22:29196193-29196215 CCCTCACAGCTTCCCGGGGCTGG + Intergenic
1182520185 22:30880702-30880724 ATCTCACTGCTCCCCAGGCCAGG - Intronic
1182915303 22:34023979-34024001 GTCTCACAGCTCGAGAGGCCTGG + Intergenic
1183302027 22:37063200-37063222 CTCTCCCCGCCCCCCAGGCCAGG - Exonic
1183308300 22:37095800-37095822 CCCTGACAGCACCCCAGGCCTGG + Intronic
1183658932 22:39207106-39207128 CCCTCCCAGCCCCCCAGGACAGG - Intergenic
1184086763 22:42270305-42270327 CTCTCCCTGCCCCTCAGGCCCGG + Intronic
1184094219 22:42307924-42307946 ATCTCCCAGCTCCACAGCCCTGG + Intronic
1184161392 22:42699529-42699551 CTCAGTCAGCTCCCCGGGCCAGG - Intronic
1184500633 22:44869463-44869485 CTGGCACAGCTAACCAGGCCTGG + Intergenic
1185266594 22:49907215-49907237 CCCTCAGAGCCTCCCAGGCCTGG + Intronic
1185403433 22:50630837-50630859 CTCTGACAGCTCGCCTGGCAGGG - Intergenic
950522855 3:13506791-13506813 CTCCAAAAGCACCCCAGGCCTGG - Intergenic
950721196 3:14883886-14883908 CTCTCGGAGTTCACCAGGCCAGG + Intronic
951363361 3:21751021-21751043 CGCTCACTGCTCTCCACGCCGGG - Exonic
952569588 3:34698531-34698553 CTCCCACATCTCCTCAGGCAGGG - Intergenic
953111748 3:39947740-39947762 CTCTCTCTGTTGCCCAGGCCAGG - Intronic
953883992 3:46705368-46705390 CTCTCACATCTCCCCAGTGAGGG - Intronic
953910982 3:46892916-46892938 CTCTGAAACCTCCCCAGGGCGGG - Intronic
953955310 3:47227449-47227471 CTCTCACAGCTTCCCATGACAGG + Intergenic
954581957 3:51707696-51707718 CCCCCTCAGCTCCCCAGGGCAGG - Intronic
954625784 3:52021245-52021267 CTCTACCAGCTCCAAAGGCCAGG - Intergenic
954626759 3:52026078-52026100 CTGTCACGGCTCCCCAGTGCTGG + Intergenic
954714666 3:52521100-52521122 CACCCAGAGCTCCCCAGCCCTGG - Intronic
954752730 3:52822887-52822909 CCCTCCCTGATCCCCAGGCCAGG + Intronic
954877749 3:53814068-53814090 CCCTCACAGCCCACCACGCCTGG - Exonic
955407178 3:58632921-58632943 GACTCACAGCTCCCAAGTCCTGG - Intergenic
955552737 3:60101397-60101419 TTCTTTCAGCTCCCCAGGACTGG + Intronic
957159256 3:76587402-76587424 GACTCACAGTTCCACAGGCCTGG + Intronic
958026650 3:88058423-88058445 CTCCTCCAGCTCCCCAGGCCCGG + Intronic
958191237 3:90187796-90187818 CTCCCCCAGCTCCCCACCCCAGG + Intergenic
959101659 3:102017235-102017257 CTCTCCCAGATCTCCAGCCCTGG + Intergenic
961438842 3:126938777-126938799 CTCCCACAGGTCCCCATGCAGGG + Intronic
961792506 3:129386265-129386287 CTCACTCTGTTCCCCAGGCCAGG + Intergenic
962849981 3:139301192-139301214 CTCTCACAGGGCACCAGGGCAGG + Intronic
963129154 3:141841937-141841959 CTCTCTCAGCCGCCCAGGCTGGG - Intergenic
966835169 3:184044144-184044166 CTCTCCCAGCTCCCTAGCCCTGG + Intergenic
967266876 3:187699060-187699082 CTCTCAGAGCTTCTCAGGGCAGG - Intronic
968481070 4:833350-833372 GGCCCACAGCTCCACAGGCCTGG + Intergenic
968689758 4:1984430-1984452 GGCTCACAGCACCTCAGGCCAGG - Intronic
968900724 4:3430605-3430627 CTCCCACTGCTCGCCAGGCTGGG - Exonic
968960177 4:3739435-3739457 CTCTCCCAGCTCTGGAGGCCGGG - Intergenic
968996363 4:3948154-3948176 CTCCCACGGCACCACAGGCCTGG - Intergenic
969413578 4:7044506-7044528 CTCTCACCGCTCCCCACACAGGG - Intronic
969432936 4:7166569-7166591 CTCTCACAGTTCTGGAGGCCAGG - Intergenic
969525835 4:7703609-7703631 CCCTCCCTGCTCCCCAGGCTGGG - Intronic
969664068 4:8547005-8547027 CTCTCACAGCTCAGTAAGCCAGG - Intergenic
969817603 4:9698065-9698087 CTCCCACGGCACCACAGGCCTGG + Intergenic
970444996 4:16116086-16116108 CACTGACTGCTCCCCATGCCTGG + Intergenic
970651121 4:18179093-18179115 CTCCCCCAGCCCCCCAGCCCCGG - Intergenic
971821726 4:31565891-31565913 CACTCACAGCTTGCCAGGCAGGG + Intergenic
971998116 4:33993732-33993754 GACTCACAGCTCCACATGCCTGG + Intergenic
973121374 4:46523934-46523956 CTCTCACAGGGCCCCATTCCAGG + Intergenic
973747180 4:53975240-53975262 GACTCACAGTTCCCCAGGGCTGG - Intronic
974032072 4:56784992-56785014 ATCTCACAGCTCCGGAGGCTAGG - Intergenic
974787042 4:66631935-66631957 CTTTCACAGCTCTCCAGCCCAGG - Intergenic
977557100 4:98497459-98497481 CTCTCACAGTTCGCCAGGCTGGG - Intronic
978529722 4:109701769-109701791 ATCTCACAGCTCCACAGCTCAGG + Intronic
979016339 4:115439069-115439091 CTGTCACAGTTCCCCTGGACAGG - Intergenic
981527388 4:145720245-145720267 GACTCACAGCTCCCCAGCCAAGG + Intronic
981719373 4:147786121-147786143 ATTTCACAGCTCCTCAGCCCAGG - Intronic
983015456 4:162607345-162607367 CTTCCACAGATCCCCAGGGCAGG - Intergenic
984196084 4:176659849-176659871 CTCTCACAGTTCCAGAGGACAGG + Intergenic
984496130 4:180499244-180499266 CTGTCACAGCTTCCCACCCCTGG + Intergenic
984565795 4:181328646-181328668 GACTCACAGCTCCACAGGGCTGG - Intergenic
984606784 4:181795227-181795249 GTCTCACAGTTCTCCAGGCTGGG + Intergenic
984845701 4:184106427-184106449 CTCTCCCAGCTCCCCACACTTGG + Intronic
984990180 4:185372756-185372778 TTCTCACAGTTCCAGAGGCCAGG - Intronic
985554202 5:548269-548291 CCCTCACAGGTCCCCTGTCCAGG - Intergenic
985665967 5:1181678-1181700 CTCACGCAGGTCCCCGGGCCAGG + Intergenic
985692136 5:1319378-1319400 CTTGCCCAGCTCTCCAGGCCTGG - Intronic
985768063 5:1791414-1791436 CTCTCACAGCTCTGGAGGCCAGG - Intergenic
985802177 5:2011870-2011892 CTGTCAGAGCTGCCCAGGACTGG + Intergenic
985881743 5:2643450-2643472 CACTCACTGCCCACCAGGCCGGG - Intergenic
986503943 5:8430023-8430045 CTCTGACAGTCCCCCAGGCTTGG + Intergenic
986735761 5:10666213-10666235 CTCTCAGAGGGCCCCAGACCAGG - Intergenic
988361973 5:30247907-30247929 TTCTCACAGTTCCAAAGGCCAGG - Intergenic
988989276 5:36653707-36653729 CTCTCAAAGCTCACAAGTCCAGG - Intronic
990459295 5:56016131-56016153 CACTCACAGTTCCACAAGCCTGG - Intergenic
991523326 5:67526271-67526293 CTCACTCTGCTACCCAGGCCAGG - Intergenic
991960015 5:72035053-72035075 TGCAGACAGCTCCCCAGGCCTGG + Intergenic
995058599 5:107789424-107789446 TTCTCACAGTTCTCGAGGCCGGG - Intergenic
995141886 5:108744414-108744436 CCCTCAGAGATCCCTAGGCCTGG + Intergenic
997200524 5:132007353-132007375 CTCACACAGGTCCCTTGGCCTGG + Intronic
997720479 5:136074635-136074657 TTCTCACAGTTCCGCAGGCAAGG - Intergenic
1001720360 5:173852019-173852041 CTCCCACAGCTCTGGAGGCCAGG - Intergenic
1002106358 5:176881204-176881226 CTCTCACAGCTTCTCCAGCCTGG - Exonic
1002359708 5:178660973-178660995 ATCTCACACCTCCCCAAACCGGG - Intergenic
1003109373 6:3240758-3240780 TTCTCACAGCTCCCCAGTGTTGG - Intronic
1005576685 6:27196315-27196337 TTCTCTCAGCTCTCCAGTCCTGG + Intergenic
1005631570 6:27713026-27713048 CTCTGACAGCTCCACAGCACCGG - Intergenic
1005984697 6:30864088-30864110 CTTTCCCAGCTCCCCAGTCAAGG + Intergenic
1006034743 6:31202537-31202559 CCCCCACAGCTGCCCAGCCCTGG - Exonic
1006113321 6:31761900-31761922 CCCACACAGCTGCCCAGGCTGGG + Exonic
1006152021 6:31994770-31994792 CTCTCTCTGCTGGCCAGGCCAGG + Intronic
1006158323 6:32027508-32027530 CTCTCTCTGCTGGCCAGGCCAGG + Intronic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1007712989 6:43836388-43836410 CTCCTGCAGTTCCCCAGGCCTGG - Intergenic
1008570093 6:52808256-52808278 ATCTCACAGCTCTGCAGGCTGGG - Intergenic
1008966987 6:57322629-57322651 GACTCACAGTTCCCCAGGGCTGG - Intronic
1010489012 6:76452329-76452351 ACCTCACGGCTCCCCACGCCAGG - Intergenic
1011106585 6:83788047-83788069 CTCTCACAGCTCTGGAGGCTGGG - Intergenic
1013095750 6:106943556-106943578 CTCTCACTGCTTCCCATGCCAGG + Intergenic
1013268453 6:108523143-108523165 CTCTCACTGGTCCCCATTCCTGG - Exonic
1015638701 6:135306740-135306762 GTCTCACCAATCCCCAGGCCTGG - Intronic
1016863902 6:148747506-148747528 CGCTTCCAGCTGCCCAGGCCCGG - Exonic
1016997479 6:149970588-149970610 CCCTCACAGCTCCCTCGTCCTGG - Intronic
1017648198 6:156557895-156557917 CTCACGCAGCTCATCAGGCCAGG + Intergenic
1017748784 6:157470959-157470981 CTCCACCAGCTCTCCAGGCCAGG - Intronic
1017770389 6:157639725-157639747 CCCTCACCCCTCCCCAGGCACGG - Intronic
1018187333 6:161277470-161277492 CTCTTACAGTTCACGAGGCCAGG - Intergenic
1018810364 6:167294248-167294270 CTCTCACAGCCATCCAGCCCCGG + Intronic
1019024247 6:168943852-168943874 GCATCACAGCTGCCCAGGCCTGG + Intergenic
1019171615 6:170136281-170136303 CACTCAGACGTCCCCAGGCCCGG - Intergenic
1019292072 7:255768-255790 GTCTCACGGCCCCCAAGGCCGGG - Intronic
1019637230 7:2082369-2082391 CTTGCTGAGCTCCCCAGGCCTGG - Intronic
1019703693 7:2487582-2487604 CCCACACCACTCCCCAGGCCTGG - Intergenic
1020014732 7:4824360-4824382 CTTTCAAAGGACCCCAGGCCGGG - Intronic
1022092324 7:27115699-27115721 CTCCCACGGCTCCTCAGGTCTGG - Intronic
1022812105 7:33880049-33880071 CTCTCTCACCTCCCTGGGCCTGG + Intergenic
1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG + Intronic
1023354073 7:39349824-39349846 CACTCACAGGGCCCCAGGACTGG - Intronic
1023538657 7:41240844-41240866 CTCTCCAATTTCCCCAGGCCTGG - Intergenic
1023813392 7:43929671-43929693 CTCTCACAGGGCCCCAGGCTTGG + Intronic
1024281962 7:47725623-47725645 CCTTCCCAGCTCCGCAGGCCAGG - Intronic
1024710160 7:52006369-52006391 GTCTCACAGCTCTCCAGGACTGG + Intergenic
1025004235 7:55342749-55342771 CACACCCAGTTCCCCAGGCCTGG + Intergenic
1025199076 7:56950691-56950713 CACTCGCAGCCCCCCAGGGCTGG - Intergenic
1025672871 7:63626242-63626264 CACTCGCAGCCCCCCAGGGCTGG + Intergenic
1026541170 7:71281102-71281124 CTCTGACAGCTCCTCAAACCTGG - Intronic
1026827466 7:73593535-73593557 ATGTCACAGCTGCCAAGGCCTGG + Exonic
1030498783 7:110333370-110333392 CTCTCACAGTTCTAGAGGCCAGG + Intergenic
1030658920 7:112198349-112198371 TTCTCACAGTTCCGCAGGCTAGG - Intronic
1032301238 7:130689277-130689299 TTCTCACAGTTCCAGAGGCCGGG - Intergenic
1032742063 7:134749037-134749059 TTCTCACAGCTCCCGAAGTCGGG - Intronic
1032744262 7:134770370-134770392 CTCTCACAGTTCTGGAGGCCAGG + Intronic
1033495853 7:141894920-141894942 TTCTCACAGCTCTCAAGGCTGGG + Intergenic
1034093115 7:148382203-148382225 TGCTCACAGCCCCACAGGCCTGG + Intronic
1034119745 7:148616691-148616713 CTCTCACAGTTCCGCATGGCTGG + Intergenic
1034988006 7:155529428-155529450 CTCTCACAGCTCTGGAGACCAGG + Intronic
1035203477 7:157280518-157280540 CCCTCAAGGCTGCCCAGGCCAGG + Intergenic
1035737466 8:1898809-1898831 CTCTCACAGGGCCCCAGCACTGG + Intronic
1035782490 8:2239535-2239557 CTCTACCAGATCCCCAGGTCAGG + Intergenic
1037834418 8:22207670-22207692 CTATCCCTGCCCCCCAGGCCTGG - Intronic
1037987467 8:23299002-23299024 GTCTCTCAGAGCCCCAGGCCTGG - Intronic
1038647442 8:29373272-29373294 CTCTCCCGGCTCTCCAGGCGAGG + Intergenic
1039082182 8:33744350-33744372 CTCTCACAGTTCCACATGGCTGG + Intergenic
1039884578 8:41647758-41647780 CTCTCCCAGCTCTCCCAGCCGGG + Intronic
1041731553 8:61068350-61068372 CTCACACAGCTCTCCCGCCCTGG - Intronic
1041803450 8:61824409-61824431 TACTCACAGTTCCCCAGGACTGG + Intergenic
1042165558 8:65942509-65942531 ATCCAACAGATCCCCAGGCCTGG + Intergenic
1044055831 8:87568862-87568884 GACTCACAGTTCCCTAGGCCTGG - Intronic
1044201283 8:89441045-89441067 GTCTCACAGTTCCTCAGGGCTGG - Intergenic
1044478561 8:92657202-92657224 TTCTCACAGCTCCAGAGGCTAGG - Intergenic
1045013855 8:97981816-97981838 CTGTCCCAGATCCCCAGCCCAGG + Intronic
1045849314 8:106674048-106674070 TTCTCACAGCTCCACTGGGCAGG - Intronic
1047031936 8:120891371-120891393 GTCTCACAGCATCCCTGGCCAGG - Intergenic
1047739504 8:127795134-127795156 CTCTCACACCCCCTCAGGGCTGG + Intergenic
1048776668 8:137954274-137954296 GGCTCACAGCTCCACAGGGCTGG + Intergenic
1048999630 8:139816453-139816475 CTCTCCCAGCCCCACAAGCCAGG - Intronic
1049004809 8:139847817-139847839 CTCACACCCATCCCCAGGCCGGG - Intronic
1049235052 8:141508177-141508199 CTCTCACAGGCCCCCCGTCCAGG - Intergenic
1049435101 8:142582931-142582953 CTTTCCCAGCTCCCCAGGGTTGG - Intergenic
1049539998 8:143204182-143204204 CTTTCACAGCTCCACATGGCCGG - Intergenic
1051360540 9:16278006-16278028 CTCTCCCAGCACTCCAGGTCTGG - Intergenic
1052997228 9:34557687-34557709 GTCTCACCTCTCCCCAGGCATGG - Exonic
1053571876 9:39318335-39318357 CTTCCACAGCTCTCCAGGGCAGG - Intergenic
1053663891 9:40304065-40304087 CTGTCACAGGCCCCCAGGCCTGG + Intronic
1053914431 9:42935321-42935343 CTGTCACAGGCCCCCAGGCCTGG + Intergenic
1054093430 9:60877046-60877068 CTTCCACAGCTCTCCAGGGCAGG - Intergenic
1054114913 9:61152966-61152988 CTTCCACAGCTCTCCAGGGCAGG - Intergenic
1054125269 9:61300676-61300698 CTTCCACAGCTCTCCAGGGCAGG + Intergenic
1054376017 9:64450299-64450321 CTGTCACAGGCCCCCAGGCCTGG + Intergenic
1054520722 9:66072220-66072242 CTGTCACAGGCCCCCAGGCCTGG - Intergenic
1054592843 9:67029568-67029590 CTTCCACAGCTCTCCAGGGCAGG + Intergenic
1055034722 9:71806120-71806142 CTCTCTCTGTTGCCCAGGCCAGG - Intronic
1055335231 9:75226918-75226940 GTTCCACAGCTCCCCAGGGCAGG + Intergenic
1057052513 9:91936293-91936315 GTCTCACAGCTCTGGAGGCCAGG + Intronic
1057183720 9:93043961-93043983 CTCTCACAGTTCTGGAGGCCAGG - Intergenic
1059241612 9:112810933-112810955 CTCGCCCAGCCCCCAAGGCCAGG - Intronic
1060113070 9:120920300-120920322 CACTCAGAGCTCCCCAGGGTAGG + Intronic
1060815515 9:126633095-126633117 CTCTCCCTACTCCCAAGGCCTGG + Intronic
1060907141 9:127316743-127316765 CTCTCACCCCTCTCCAGCCCAGG - Intronic
1061016199 9:127981979-127982001 CTCTGGCAGCTCCCTATGCCTGG - Intergenic
1061033442 9:128100523-128100545 CTGCCACAGCACCCGAGGCCGGG - Intronic
1061373664 9:130211927-130211949 CTCTCTGACCACCCCAGGCCGGG - Intronic
1061498844 9:130990941-130990963 CTCACATAGCTCCCCAAGCAGGG + Intergenic
1061545432 9:131301645-131301667 CTCCCACAGCTTCCCGGGCCAGG + Intronic
1062056838 9:134473160-134473182 CCCTCACAGCGCCACAGCCCTGG + Intergenic
1062103464 9:134740142-134740164 CTTTCACAGCATCCCCGGCCTGG + Intronic
1062126290 9:134864738-134864760 CACTCACAGCACGCCAGGCCCGG + Intergenic
1062169855 9:135129075-135129097 CTCTCAAAGGTCCCCAGGGGTGG - Intergenic
1062393766 9:136344334-136344356 CTCACAAAGCACCGCAGGCCGGG + Intronic
1062435746 9:136545931-136545953 CTCTCGCAGGCCCCCGGGCCCGG + Intergenic
1062460209 9:136659800-136659822 CTCTGACACCACCCCAGGCAGGG + Intronic
1062538801 9:137032434-137032456 CCCACCCAGCTACCCAGGCCTGG + Exonic
1186069909 X:5808429-5808451 GACTCACAGCTCCCCATGGCTGG + Intergenic
1187316724 X:18202611-18202633 TTCTCACAGCTCCAGAGGCTGGG - Intronic
1187829326 X:23364951-23364973 ATCTCACAGCTCTCCATTCCTGG + Intronic
1188761778 X:34041356-34041378 GACTCACAGCTCCACAGGACTGG - Intergenic
1189265747 X:39714907-39714929 CTCTCCAAGTTCCACAGGCCTGG - Intergenic
1190497125 X:51037519-51037541 CTCTCTCTGTTCCCCAGGCTGGG - Intergenic
1190508856 X:51156744-51156766 CTCTCTCTGTTCCCCAGGCTGGG + Intergenic
1190661034 X:52654396-52654418 CTCTCTCTGCTGCCCAGGCTGGG + Intronic
1190708394 X:53048876-53048898 CTCACCCCGCTCCCCGGGCCTGG - Intergenic
1191684774 X:63878906-63878928 CTCTCACACCTCCACATCCCTGG + Intergenic
1192157749 X:68759069-68759091 CCCAGACAGCTCCCCAGGCTGGG + Intergenic
1192195412 X:69024511-69024533 CTCGCATTGCTCCCTAGGCCAGG - Intergenic
1192199918 X:69060325-69060347 CTCTCACATTTCCCCCGGCTGGG - Intergenic
1193569962 X:83129112-83129134 CTCCCACCGCTCACCAGGCAGGG + Intergenic
1195327343 X:103768551-103768573 TTCTCTCACCTCCCCAGCCCTGG + Intergenic
1197392314 X:125883071-125883093 ATTTCACAGATCCCTAGGCCAGG - Intergenic
1197705579 X:129632299-129632321 TTCTCACAGTTCTGCAGGCCGGG - Intergenic
1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG + Intronic
1198720394 X:139612014-139612036 CTGTCACAGTTGCCAAGGCCAGG + Intronic
1199329624 X:146543573-146543595 CTTCCACAGATCCCCAGGGCAGG + Intergenic
1200638144 Y:5681919-5681941 GTTTCACAGATCCCCAAGCCAGG + Intronic
1201524774 Y:14919894-14919916 CACTCACAGCTCCCCATGGCTGG - Intergenic