ID: 927894846

View in Genome Browser
Species Human (GRCh38)
Location 2:26775136-26775158
Sequence GAGGGTTGAAGGGCTGCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 398}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927894846_927894860 15 Left 927894846 2:26775136-26775158 CCCCCAGCAGCCCTTCAACCCTC 0: 1
1: 0
2: 1
3: 38
4: 398
Right 927894860 2:26775174-26775196 CAGCGCTCTGTGACATGACAGGG 0: 1
1: 0
2: 0
3: 9
4: 110
927894846_927894859 14 Left 927894846 2:26775136-26775158 CCCCCAGCAGCCCTTCAACCCTC 0: 1
1: 0
2: 1
3: 38
4: 398
Right 927894859 2:26775173-26775195 CCAGCGCTCTGTGACATGACAGG 0: 1
1: 0
2: 0
3: 8
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927894846 Original CRISPR GAGGGTTGAAGGGCTGCTGG GGG (reversed) Exonic
900150436 1:1176626-1176648 GAAGGCTGGAGGGCTGCTAGTGG + Intronic
900348747 1:2224864-2224886 GAGGGTGGAAGGCCAGCAGGCGG + Intergenic
900660113 1:3777955-3777977 GGGGCTGGCAGGGCTGCTGGTGG - Intergenic
900786408 1:4653283-4653305 GGGGGTGAAAGGGCTGCTTGGGG + Intergenic
900993192 1:6107195-6107217 GAGGGATGGAGGGATGATGGAGG + Intronic
900993198 1:6107214-6107236 GAGGGATGGAGGGATGATGGAGG + Intronic
900993246 1:6107412-6107434 GAGGGATGGAGGGATGATGGAGG + Intronic
900993347 1:6107854-6107876 GAGGGATGGAGGGATGATGGAGG + Intronic
900993390 1:6108000-6108022 GAGGGATGAAGGGACGGTGGAGG + Intronic
901032398 1:6314891-6314913 GTGGGTTGAAGGGCTCGTGGAGG - Intronic
901632486 1:10654763-10654785 GAGGCCTGAGGGGCTGTTGGAGG - Intronic
901751370 1:11412176-11412198 GAGGGTGGAAAGGATGGTGGGGG - Intergenic
902410720 1:16210122-16210144 GAGAGGTGAGGGGCTGCAGGAGG - Intronic
902570986 1:17346873-17346895 GAGGGATGAATTCCTGCTGGGGG - Intronic
902738731 1:18419312-18419334 GAGTGATTAAGGGCAGCTGGAGG + Intergenic
902745849 1:18473834-18473856 GAGGTCTGAAGGGGTCCTGGGGG + Intergenic
902761175 1:18581623-18581645 GAGGGCTGCAGGGCTGCGGAAGG - Intergenic
902798462 1:18814783-18814805 GAGGGCTGATGGGGGGCTGGTGG - Intergenic
903187200 1:21635372-21635394 GAGGAATGAAGGGCAGATGGGGG - Intronic
903275373 1:22218149-22218171 GAGGGGAGTTGGGCTGCTGGGGG + Intergenic
903811572 1:26037679-26037701 GAGGGGTGGGGGGTTGCTGGTGG - Intronic
904114963 1:28155034-28155056 GAGGGTGGAGTGGCAGCTGGAGG - Intronic
904214405 1:28907900-28907922 CAGGGTTGGAGGACTGCTTGAGG - Intronic
904408788 1:30312338-30312360 GATGGGGGCAGGGCTGCTGGGGG + Intergenic
904451947 1:30619019-30619041 CAGGGATGAAGGGCTGTGGGTGG - Intergenic
904787827 1:32995856-32995878 GAGGGTGCAAGGGCAGATGGAGG + Intergenic
904818177 1:33221000-33221022 GAGGGTGGCAGGGCTCCTTGGGG + Intergenic
905664929 1:39757651-39757673 GAGGGTTGGAAGGATGATGGTGG - Exonic
906211155 1:44012948-44012970 GAGGGTGTGAGGCCTGCTGGGGG + Intronic
906274518 1:44506245-44506267 GAGGGTGGCAGGGTTGCTGGTGG + Intronic
908255254 1:62298011-62298033 GAGGGTGGAATGGCTGATGCAGG + Intronic
909180569 1:72419261-72419283 GAGGGTTGTAGGGTGGGTGGCGG + Intergenic
909285649 1:73813883-73813905 GATGGATGAAGGGCAGCAGGAGG - Intergenic
912420479 1:109539292-109539314 CAGGTTTGAAGGGCAGCTGAAGG - Intergenic
912834434 1:112983334-112983356 GAGGGAGGAAGGACTGCTGACGG + Intergenic
913186300 1:116373357-116373379 GAGGGTGGGAGGGCGGCCGGCGG - Intronic
914355088 1:146877928-146877950 GAAGGGTGAAGGGGTTCTGGGGG - Intergenic
915417631 1:155754329-155754351 GAGGGTATCAGAGCTGCTGGGGG - Intronic
915724467 1:158007800-158007822 GAGGGCACAGGGGCTGCTGGTGG - Intronic
915977753 1:160401514-160401536 GAGTTTTGAAGGGTTGGTGGAGG + Intronic
916511989 1:165480657-165480679 GAGGGGTGAAGGGCTAGGGGAGG - Intergenic
918404333 1:184196421-184196443 GAGGGCTGCAGGCCTGATGGAGG + Intergenic
918655955 1:187027090-187027112 GAGGGTGGATGGGATGGTGGAGG - Intergenic
920045002 1:203127445-203127467 GAGGGGTGAGGGGTCGCTGGAGG + Exonic
920213824 1:204348299-204348321 GAGGGCTGAAGGGTGGCTGATGG - Intronic
920671194 1:208004706-208004728 GAGGGTGCAGTGGCTGCTGGGGG + Intergenic
920861078 1:209707355-209707377 GGGACTTGAGGGGCTGCTGGAGG + Intronic
921337655 1:214104480-214104502 CAAGGTTGAAGGATTGCTGGAGG + Intergenic
922224324 1:223632144-223632166 GAGGCTCGAAGGGATGCTGTGGG + Intronic
922774586 1:228208840-228208862 CAGGGTGGAGGGGCTGCTGAGGG + Intronic
1063056514 10:2510487-2510509 GTGGTTTGAACGGTTGCTGGTGG - Intergenic
1063218911 10:3948367-3948389 GAGGGTGGAAGGGAGGCTGAGGG + Intergenic
1063573329 10:7237569-7237591 GAGGGGTGAAGGGCTAGGGGTGG + Intronic
1063865916 10:10365357-10365379 AAGGTTTGAAGGGCTGCAGCTGG + Intergenic
1065160947 10:22920979-22921001 GGGGGTTGAGGGGCTGGGGGAGG - Intergenic
1066471127 10:35699304-35699326 GAGGGGTTGAGGGCTGTTGGAGG - Intergenic
1066752034 10:38667837-38667859 GAGGGGTGGAGGGCTGGGGGAGG + Intergenic
1067090719 10:43264747-43264769 GAGGGGCGCTGGGCTGCTGGGGG - Intronic
1067170856 10:43904649-43904671 GATGGTGGTGGGGCTGCTGGGGG - Intergenic
1068921551 10:62489772-62489794 GAGGCAGGAAGGGCTGCAGGTGG + Intronic
1069658251 10:70106193-70106215 GAGGGTGGCAGTGCTGCTGCTGG - Intronic
1070267910 10:74922371-74922393 TTGGGATGAAGGGCTCCTGGAGG - Intronic
1071844879 10:89511580-89511602 GAGGGTGGAGGGGCTGGGGGAGG + Intronic
1073205867 10:101769043-101769065 GAGGGAGGGAGGGCTGCTGTGGG - Intergenic
1074108347 10:110405062-110405084 GAGGTGTGAAGGCCTCCTGGTGG - Intergenic
1074551314 10:114444992-114445014 ATGTGTTGAAAGGCTGCTGGAGG - Intronic
1076096772 10:127738957-127738979 GAAGTTTGAAGGGAGGCTGGAGG + Exonic
1076358305 10:129868751-129868773 GAGGGCTGCAGGCCTGGTGGAGG + Intronic
1076538601 10:131199064-131199086 GAGGGTGGAAGGGCTCAGGGAGG - Intronic
1077045888 11:544955-544977 GAGGGTGGATGGGCAGGTGGGGG + Intronic
1077225349 11:1437006-1437028 GTGGGGTTAAGGGCTGCTGAGGG + Intronic
1077476768 11:2794160-2794182 GAGTGGTGAGGGGCTGCTGTGGG + Intronic
1077483797 11:2829767-2829789 TAGGGTTGAAGGGCTGCCTCTGG + Intronic
1078654502 11:13225875-13225897 GAGGTTTGGAGGACTGTTGGAGG - Intergenic
1078833352 11:14998158-14998180 GAGGGGTGAAGGGCTAGGGGAGG + Intronic
1078838684 11:15057181-15057203 GAAGGTTGAAGGGGAGCAGGGGG - Intronic
1081344288 11:41963475-41963497 GAGGGTTGAATGTCTGCTACTGG + Intergenic
1081953000 11:47061997-47062019 GAGGGTTGAGGAGCTTCAGGTGG - Intronic
1083328475 11:61885732-61885754 GAGTGTGGCAGGGCTGCTGAGGG + Intronic
1083755561 11:64789974-64789996 GATGGGTGCAGGGCTGATGGTGG - Intronic
1084117312 11:67049810-67049832 CAGGGTGGAAGGGCGGCTTGAGG + Exonic
1084310809 11:68315073-68315095 ACGGGTTGCAGGGCTGATGGGGG + Intronic
1084369046 11:68726140-68726162 CAGGGTAGAAGGTCTGCTGCAGG + Intronic
1084453743 11:69255240-69255262 GAGGGATGAAGGGAGGGTGGAGG + Intergenic
1084479464 11:69410383-69410405 GGGGGTGGGAGGGCTGATGGCGG - Intergenic
1084512798 11:69616577-69616599 GATGGTTGGAGGGCAGCTGGGGG - Intergenic
1084603311 11:70159194-70159216 GAGAGTGGAAGTGATGCTGGAGG - Intronic
1085080932 11:73633688-73633710 AGGGGAGGAAGGGCTGCTGGGGG - Intergenic
1085566438 11:77518633-77518655 GTGGAAGGAAGGGCTGCTGGTGG - Intronic
1088073893 11:105823453-105823475 GAGGCTTGAAGAACTGCTGATGG + Intronic
1088917421 11:114238190-114238212 GAGGGCTGATGGGCCACTGGAGG - Intronic
1089954400 11:122556709-122556731 GCGGGTTGAAGGGCTCCTCGAGG - Intergenic
1090252659 11:125262591-125262613 AAGGGTGGGAGGGCTGCTTGGGG - Intronic
1090950820 11:131471765-131471787 GAGGGTGGAAGAGCTGCTCCTGG + Intronic
1091487146 12:900513-900535 GAGGGTGGAGGGTCTGCTGGGGG - Exonic
1096436088 12:51591770-51591792 GAGGGCTGAGGGGCTGCTGTAGG - Intronic
1096656551 12:53096206-53096228 GAGGGTTGTGGGGCAGCTGATGG - Intergenic
1096681087 12:53255685-53255707 CAGGGTGGAAGGGCTTCTGCAGG + Intergenic
1096923879 12:55120321-55120343 GGGGGGTGAAGGGCTACGGGAGG + Intergenic
1097158274 12:57028304-57028326 GTGGGTGGAGGGGCTGCGGGGGG - Intronic
1098685090 12:73409860-73409882 GGGGGGTGAAGGGCTGGGGGAGG - Intergenic
1099171735 12:79372784-79372806 GAGGGATGAGGGGCTGTTGTGGG - Intronic
1101073487 12:101101567-101101589 GAGGGTTGAGGGATTGATGGTGG - Intronic
1102305841 12:111804010-111804032 GGGGCTTGAGGGTCTGCTGGTGG + Intronic
1102543512 12:113638517-113638539 CCGGCTAGAAGGGCTGCTGGGGG + Intergenic
1104044798 12:125154179-125154201 CAGTGCTGAAGGACTGCTGGTGG + Intergenic
1104104533 12:125646463-125646485 GAAACTTGAAGGGCCGCTGGGGG + Intronic
1104679315 12:130738389-130738411 GAGGGTGGAGGGGCTGGGGGAGG - Intergenic
1104761502 12:131299772-131299794 GTGGGCTGAGGGGCTGCGGGTGG + Intergenic
1104807136 12:131596827-131596849 GAGGGGTGAAGGGCTGGGGCAGG - Intergenic
1104812833 12:131628840-131628862 CCGGGCTGAAGGGCGGCTGGGGG - Intergenic
1104818274 12:131661020-131661042 GTGGGCTGAGGGGCTGCGGGTGG - Intergenic
1104970293 12:132527866-132527888 GAGGGCTGCAGGGCAGCTGTCGG + Intronic
1104984150 12:132587223-132587245 GAGGGTGGCAGTGCGGCTGGAGG + Intergenic
1104984185 12:132587379-132587401 GAGGGTGGCAGTGCAGCTGGAGG + Intergenic
1105330444 13:19410927-19410949 GTCAGTTGAAGTGCTGCTGGTGG + Intergenic
1105886734 13:24649099-24649121 GGGGGTGGCAGGGCTGCTGGAGG - Intergenic
1106881356 13:34134585-34134607 GAGTGTTGAAGGGCTGCATTTGG + Intergenic
1107482002 13:40792923-40792945 GTCAGTTGAAGTGCTGCTGGTGG + Intronic
1107766992 13:43746428-43746450 GAGCTTTGAAGGGCAGATGGAGG + Intronic
1108355521 13:49625768-49625790 CAAGGTTGAGGGGCTCCTGGGGG - Intergenic
1108516907 13:51212014-51212036 TAGGGTTGAAGCTCAGCTGGGGG + Intergenic
1114533802 14:23410837-23410859 GAAGCTTGAAGAGCTGCGGGTGG - Intergenic
1114595347 14:23907379-23907401 CAAGGTTGAGAGGCTGCTGGTGG + Intergenic
1114791200 14:25660311-25660333 GAGGATTCAAGGGATTCTGGGGG + Intergenic
1114901192 14:27061164-27061186 GAGGGGTGGAGGGCTGGGGGAGG - Intergenic
1115444802 14:33477703-33477725 GAGGCTTGAAGGGCTGTAAGGGG - Intronic
1115566503 14:34629735-34629757 TAGGGAGGAAGGGCTGCGGGAGG + Intronic
1117152454 14:52903303-52903325 GAAGGTGGGAGGGCTGCTTGAGG + Intronic
1117771594 14:59139333-59139355 TTGGGCAGAAGGGCTGCTGGGGG - Intergenic
1118444833 14:65841371-65841393 GAGGGTAGCAGGGCTAATGGTGG + Intergenic
1120732461 14:88018909-88018931 GGGGGTTGGAGGGCTAGTGGAGG + Intergenic
1121255272 14:92526015-92526037 GGGGGTGGAGGGGCTGCTGCAGG + Intronic
1121320479 14:92988947-92988969 GAGGGTTGGAGGGGTGGCGGTGG + Intronic
1121829023 14:97033797-97033819 GCGGGGAGAAGGGCCGCTGGTGG + Intergenic
1121927291 14:97939497-97939519 GAGGGTAGAAGGGCTGTAGTGGG - Intronic
1122150634 14:99724352-99724374 GAGGCTTGGATGGATGCTGGAGG - Intronic
1122309915 14:100787938-100787960 GGGGCTTGCAGGGCTGCGGGAGG - Intergenic
1122542443 14:102505838-102505860 GAGGGCTGAAGGTCTGCAGGAGG - Exonic
1122578200 14:102755134-102755156 GAGAGATGCAGGGCTGCCGGGGG - Intergenic
1122687290 14:103515428-103515450 GAGGGGAGAATGGCTGCTAGGGG + Intergenic
1122924119 14:104891998-104892020 GAGGGTTGTGGTGCCGCTGGAGG + Intronic
1123427883 15:20187671-20187693 GAGTGTTGAAAGGGTGCTGATGG - Intergenic
1124699969 15:31904276-31904298 GAGGGCTGAAGGGCTGTATGTGG + Intergenic
1125300886 15:38252628-38252650 GGGGGTTGAGGGGCAGCCGGCGG + Exonic
1125676967 15:41507318-41507340 GAGAGTTGATGGGCAGGTGGAGG - Intronic
1126583914 15:50264781-50264803 GAGGGTTGAAGGGGAGCAGAAGG - Intronic
1126987161 15:54325552-54325574 GAGGGGTGAGGGGCTGGGGGAGG - Intronic
1128697604 15:69780362-69780384 GGGGGGTGAAGGGTTGCTGGTGG - Intergenic
1128874238 15:71189172-71189194 GAGGGTAGGAGAACTGCTGGAGG + Intronic
1129189099 15:73927284-73927306 GCGGGTAGGAGGGCTGCTGGCGG - Exonic
1129204062 15:74024941-74024963 GAGGTCTGAAGGGGTGGTGGTGG + Intronic
1129661393 15:77554858-77554880 GAGGGAGGAGGGGCTGCTGCTGG + Intergenic
1130649907 15:85756581-85756603 GAGGGAAGAAGAGCAGCTGGGGG + Intergenic
1130744610 15:86637679-86637701 GAGGGTGGCAGGGGTGGTGGTGG + Intronic
1134112966 16:11527296-11527318 GAGGGTAGAAGGGGAGGTGGGGG + Intergenic
1134197547 16:12170542-12170564 GAGGGTAGATGGGCTGTTCGTGG + Intronic
1134364199 16:13561634-13561656 GAGGGTGGAAGGGCCCCTGGAGG + Intergenic
1134520620 16:14917848-14917870 GAGGGCAGAAGGGATACTGGGGG - Intronic
1134550954 16:15138126-15138148 GAGGGCAGAAGGGATACTGGGGG + Intronic
1134708292 16:16316499-16316521 GAGGGCAGAAGGGATACTGGGGG - Intergenic
1134715507 16:16356532-16356554 GAGGGCAGAAGGGATACTGGGGG - Intergenic
1134951310 16:18352146-18352168 GAGGGCAGAAGGGATACTGGGGG + Intergenic
1134959250 16:18395627-18395649 GAGGGCAGAAGGGATACTGGGGG + Intergenic
1135859674 16:26044361-26044383 GAGGGGAGAAGGGCTGGTAGTGG + Intronic
1136047359 16:27625003-27625025 GAGGGTGGCAGGGCAGCAGGAGG + Intronic
1136856412 16:33662090-33662112 GAGTGTTGAAAGGGTGCTGATGG + Intergenic
1137701973 16:50503849-50503871 GATGGTTGAAGGGGTGCCGAGGG - Intergenic
1137774584 16:51044522-51044544 GAGAGTTGAAAGGGTGCAGGTGG + Intergenic
1138521842 16:57575610-57575632 GAGGGTGGCAGGCCTGCTGCTGG + Exonic
1139653597 16:68374729-68374751 GAGGGCTGCAGGTTTGCTGGGGG - Intronic
1139978928 16:70837601-70837623 GAAGGGTGAAGGGGTTCTGGGGG + Intronic
1141006862 16:80360515-80360537 GAGACATGAAGGGCTGCTGGGGG + Intergenic
1141332079 16:83120115-83120137 CAGGGTTCGGGGGCTGCTGGAGG - Intronic
1141708416 16:85682932-85682954 GTGGGTTGAGGCGGTGCTGGCGG - Intronic
1142171362 16:88624393-88624415 GAGCCTGGAAGGGCTGCTGGGGG + Intronic
1142252245 16:88997339-88997361 GATGGGTGAAGGGGTGCAGGAGG - Intergenic
1203117992 16_KI270728v1_random:1510567-1510589 GAGTGTTGAAAGGGTGCTGATGG + Intergenic
1142666938 17:1468640-1468662 GAGGGTTGATGGGCGTGTGGGGG - Intronic
1142903498 17:3027468-3027490 GACGGGGGAAGGGCTGCAGGGGG + Intronic
1143178675 17:4970887-4970909 GAGAGTTGAAAGGGAGCTGGGGG - Intronic
1143868891 17:9943764-9943786 GTGGGTTGAAGGGAGGCCGGAGG + Intronic
1144204985 17:12973798-12973820 GAGGGTTGAAGCACAGCTTGTGG + Intronic
1144378410 17:14668529-14668551 GAGGGATTAAGTGCTGTTGGTGG - Intergenic
1144831048 17:18131415-18131437 GAGGGTAGGAGGGCTGGTGTTGG - Intronic
1144891100 17:18494797-18494819 GAGGGGTGAAGGGTTGGTGCAGG - Exonic
1144898056 17:18557949-18557971 GAAGGGGGTAGGGCTGCTGGTGG - Intergenic
1144956687 17:19022175-19022197 GTGGGTTGCAGGGCTTCTGAAGG - Intronic
1145141123 17:20449521-20449543 GAGGGGTGAAGGGTTGGTGCAGG + Intronic
1146126840 17:30237257-30237279 GATGCTGGAAGGGCTGCAGGGGG + Intergenic
1146524227 17:33552324-33552346 GATGGTTGGATGGCTGCTGGAGG + Intronic
1147426475 17:40348111-40348133 GAGGAGTGATGGGGTGCTGGAGG + Intronic
1147568547 17:41552643-41552665 GAGGGATGACGAGGTGCTGGTGG - Intergenic
1148740514 17:49890033-49890055 AGGGGTTGGAGGGCTGATGGAGG + Intergenic
1149659843 17:58328549-58328571 GAGGCTTCAGGAGCTGCTGGGGG + Intronic
1151820977 17:76496721-76496743 GAGGGTTGAGGATCTGCTGTGGG - Intronic
1152375294 17:79915720-79915742 GAGGGTCGAGGGGCAGGTGGAGG + Intergenic
1152592231 17:81219249-81219271 GAGGGGTGATGAGCTCCTGGTGG - Intronic
1152797380 17:82314948-82314970 GGGGGTTGGGGGCCTGCTGGTGG + Exonic
1153225772 18:2898443-2898465 GAGGAAGGAAGGGGTGCTGGTGG + Intronic
1153994991 18:10432997-10433019 GAGTGTTGCAAGGCTGCTTGAGG - Intergenic
1157340242 18:46771744-46771766 GAAGGTTTGAGGGCTGCTAGGGG - Intergenic
1158496193 18:57957021-57957043 AAGGGCTGAAGGGATACTGGTGG + Intergenic
1158776003 18:60580624-60580646 GAGTTTTGAAGGGTTGCTGCTGG + Intergenic
1159110640 18:64052388-64052410 GAGGATTGAAATGCTTCTGGTGG - Intergenic
1160290020 18:77583720-77583742 GGGGGTTGGAGGGCTGGGGGAGG + Intergenic
1160436524 18:78856452-78856474 GAATGATGAAGGGCTGCAGGTGG - Intergenic
1161505291 19:4640359-4640381 GAGGGGGGAAGGGCTGGTGGAGG + Intronic
1161943243 19:7418979-7419001 CTGGGGTGAGGGGCTGCTGGGGG - Intronic
1162050505 19:8029614-8029636 GAAGATTGCAGGGCTGGTGGGGG - Intronic
1162214248 19:9119400-9119422 GAAGGGTGAAGGGCTGGAGGAGG - Intergenic
1162529453 19:11227548-11227570 GGGGCTTGAAGGGCTGTGGGTGG + Intronic
1162529466 19:11227590-11227612 GGGGCTTGAAGGGCTGTGGGTGG + Intronic
1162747880 19:12809312-12809334 GAGGGTCCAAGAGCTGCTGGGGG - Intronic
1163369231 19:16892796-16892818 GAGGGTTGGAGGGCCACTGTTGG + Intergenic
1163673696 19:18644715-18644737 GAGGCTTGTGGGGCTGCTGGGGG + Intronic
1163785765 19:19274172-19274194 GAGGGTAGAAGGGGTCCTAGCGG + Intergenic
1164656089 19:29923054-29923076 GAGGGCTGGAGTGCTGCTGGAGG - Intergenic
1164891461 19:31827111-31827133 CAAGGTGGAAGGGCTGCTTGCGG - Intergenic
1165149175 19:33750904-33750926 GAGGGTTGCAGGGCTGGGTGGGG - Intronic
1165313780 19:35042708-35042730 TAGGGTAGAAGGGAGGCTGGTGG - Intronic
1165364940 19:35359553-35359575 GAGGGTGGCGGGGCTGTTGGCGG + Exonic
1165366759 19:35372022-35372044 GAGGGTGGCGGGGCTGGTGGCGG + Exonic
1166328931 19:42067701-42067723 CAGGGTTGAGGGGCAGCAGGTGG + Intronic
1166369043 19:42291344-42291366 GAGGGTGAAACGGATGCTGGTGG - Exonic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167112329 19:47469729-47469751 TTGGGTTTCAGGGCTGCTGGTGG - Intronic
1167114279 19:47479985-47480007 GATGGTTTCAGGGCTGCGGGCGG - Intronic
1167244641 19:48365674-48365696 CGGGGTGGAAGGGCTGTTGGGGG - Intronic
1167689303 19:50975384-50975406 GAGGGAGGAGGGGCTGGTGGGGG + Intergenic
1168302039 19:55410629-55410651 GAGAGGTGAGGGGCTGCTGGTGG + Intergenic
1168316507 19:55486857-55486879 GGGGGTGGGAGGGATGCTGGAGG + Exonic
925176592 2:1788788-1788810 GGTGGCTGCAGGGCTGCTGGTGG + Intergenic
925309960 2:2875304-2875326 CAAGGTGGCAGGGCTGCTGGGGG - Intergenic
925494027 2:4426189-4426211 GAGGGATGAAGGGCAGCTCCAGG - Intergenic
925900445 2:8505538-8505560 TAGGACTGCAGGGCTGCTGGGGG - Intergenic
925997383 2:9304441-9304463 GGGGGTGGAAGGGCTGTAGGGGG + Intronic
926129163 2:10290197-10290219 GAGTGTGGAGTGGCTGCTGGGGG - Intergenic
927894846 2:26775136-26775158 GAGGGTTGAAGGGCTGCTGGGGG - Exonic
928281043 2:29946669-29946691 GAGGGATATGGGGCTGCTGGAGG - Intergenic
928437377 2:31263630-31263652 TAGGGCTGAAGGACTCCTGGAGG - Intronic
929908260 2:46065428-46065450 GAAGATGGAAGGGCTACTGGTGG - Intronic
932486271 2:72086108-72086130 CAGGGTTGAGGGGCTGGCGGGGG - Intergenic
932579571 2:72984690-72984712 GAGGTTTGCAGAGCTCCTGGGGG - Intronic
934087177 2:88519638-88519660 GAGTGTTCAAGGGCAGCAGGAGG - Intergenic
934953659 2:98597854-98597876 GAGAGTTGGAGGGGTGGTGGGGG + Intergenic
935578622 2:104736353-104736375 TAGGGTTGTAGGGCTGGTTGGGG + Intergenic
935594709 2:104869649-104869671 GAAGCCTGAAGGGCTGGTGGTGG - Intergenic
937273952 2:120672437-120672459 GAGGGGTGGTGGGGTGCTGGGGG - Intergenic
937619831 2:123972705-123972727 GAGAGGGGAAGGGCTGCAGGCGG + Intergenic
938077686 2:128348504-128348526 CAGGGAGGAAGGCCTGCTGGAGG - Intergenic
938406980 2:131038260-131038282 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938407013 2:131038382-131038404 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938407034 2:131038473-131038495 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942274382 2:174308765-174308787 GAGAGTTGAAGAGCTGATGCTGG - Intergenic
943208997 2:184938604-184938626 GGGGGTGGGAGGGCAGCTGGAGG - Exonic
945770435 2:214035440-214035462 GGGGGTTGAGGGGCTGCTGAGGG - Intronic
947484123 2:230531418-230531440 GGGGGTTGAGGGGCTGGGGGAGG + Intronic
947486849 2:230558115-230558137 GAGGGTTGTTGGGTTGTTGGGGG - Intergenic
947824119 2:233092751-233092773 GAGGGATAAAGGGATGCTGTTGG - Intronic
947824150 2:233092871-233092893 GATGGCTGTAGGGGTGCTGGGGG - Intronic
948512230 2:238476318-238476340 GAGGGTGGGAGGGCTCCTTGTGG + Intergenic
948638070 2:239353085-239353107 CAGGGTTGCAGGGGTGGTGGAGG - Intronic
1168826895 20:819973-819995 GAGGGCTGAAGGCTTGCTGTTGG + Intergenic
1169045902 20:2534448-2534470 GCAGGGTAAAGGGCTGCTGGGGG + Intergenic
1169268549 20:4182199-4182221 GCGGGTTGTGGAGCTGCTGGCGG + Exonic
1169732223 20:8798740-8798762 GAGAATTGGAGGGCTGATGGGGG - Intronic
1170009911 20:11711847-11711869 GTGGGTTGAAGTGATGCTGAGGG + Intergenic
1170734901 20:19006135-19006157 AAGGGTTGAAGGGCTGCTGTAGG + Intergenic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1172162010 20:32875348-32875370 GAGGTTTGAGGGGCTGGAGGAGG + Intronic
1172176848 20:32977643-32977665 GAAGGATGAAGGGTTGCTGGTGG + Intergenic
1172211984 20:33206411-33206433 GAAGTTTGAAGTCCTGCTGGGGG - Intergenic
1172602831 20:36195599-36195621 GAGGGTGGGAGGGCTGAGGGAGG - Intronic
1172619023 20:36307397-36307419 GAGGGATGAAGGGATGGAGGGGG - Intronic
1172973002 20:38887109-38887131 GATGGATGAATGGATGCTGGTGG + Intronic
1173202052 20:40961468-40961490 GAGGGCTGAGAGGCTGCTGAGGG - Intergenic
1173428136 20:42960360-42960382 CAGGGTGGAAGGGGAGCTGGAGG + Intronic
1173800211 20:45890569-45890591 GAGGGTTGGAGGTCGGCTGGGGG + Exonic
1174042211 20:47708121-47708143 GAGGGCAGAAGGGATCCTGGTGG - Intronic
1174854020 20:54025646-54025668 ATGGGGGGAAGGGCTGCTGGAGG + Intronic
1174965619 20:55211193-55211215 GAGGGTGGAAGGGAGGCTAGGGG + Intergenic
1175123653 20:56735879-56735901 CAGGGATGAAGGGATGGTGGGGG - Intergenic
1175781426 20:61684583-61684605 GGGGGCTGAAAGGCTCCTGGGGG + Intronic
1175825400 20:61933991-61934013 CAGGGTGGAAGGGGGGCTGGCGG + Intronic
1175934610 20:62509223-62509245 GAGGGGTGAAGGGGTGAGGGTGG - Intergenic
1175934671 20:62509403-62509425 GAGGGGTGAAGGGGTGAGGGTGG - Intergenic
1176027915 20:62995495-62995517 GGGGGTTGAGGAGCTGCAGGAGG - Intergenic
1176053410 20:63132692-63132714 GAGGGTTGAGTGGCTGCCTGAGG + Intergenic
1177348171 21:19900306-19900328 TAGGGTGGAGGGGCGGCTGGCGG - Intergenic
1177454390 21:21317079-21317101 GAAGGTAGAAGGGCAGCTGTGGG - Intronic
1178255076 21:31044843-31044865 CAGTGATTAAGGGCTGCTGGTGG - Intergenic
1178894286 21:36545929-36545951 GAGGGCTGAAGGGCTCTTGCAGG - Intronic
1179767114 21:43582269-43582291 GGGGGATGAAGGCCTGCTGAGGG + Intronic
1180564445 22:16650911-16650933 GTCAGTTGAAGTGCTGCTGGTGG - Intergenic
1180835281 22:18926571-18926593 CAGGGGTGCAGGGCTGGTGGGGG - Intronic
1180865306 22:19115289-19115311 GAGGGTTGAGGGGCTCCCAGAGG - Intronic
1180959864 22:19757654-19757676 GCGGGTGGTAGGGATGCTGGTGG - Intronic
1181372093 22:22426862-22426884 CTAGGTTGAAGGGCAGCTGGGGG - Intergenic
1182294360 22:29304531-29304553 GGGGAGGGAAGGGCTGCTGGAGG - Intergenic
1182447812 22:30399721-30399743 GAGGGAAGAGGGGCTGCGGGAGG + Intronic
1183346291 22:37310145-37310167 GAGGGCTCATGGGCTCCTGGGGG - Intronic
1183374444 22:37454812-37454834 GAGGGAGGAAGGGAGGCTGGGGG - Intergenic
1183481696 22:38068917-38068939 GGGGGCAGAAGGGCTGCTGGGGG - Intronic
1183954014 22:41368555-41368577 GAGGGGTGAAGGGAGGCCGGGGG - Intronic
1184264487 22:43339781-43339803 GAGGGTTGAAGCAATGCTTGTGG - Intronic
1184264511 22:43339873-43339895 GAGGGTTGGAGTGATGCTTGTGG - Intronic
1185285166 22:49996809-49996831 GGAGGTTGCAGAGCTGCTGGGGG + Exonic
1203285369 22_KI270734v1_random:151870-151892 CAGGGGTGCAGGGCTGGTGGGGG - Intergenic
949875638 3:8624440-8624462 GTGGGGTGCAGGGCTTCTGGTGG + Intronic
950459225 3:13111333-13111355 GGGTGGTGAGGGGCTGCTGGTGG + Intergenic
950497850 3:13344938-13344960 GAGGGGAGAAGAGGTGCTGGAGG - Intronic
950620969 3:14204964-14204986 GAGGGTGGTAAGGCTGCCGGGGG - Intergenic
951485666 3:23206574-23206596 TGGGGTTGAAGGGGTGCTGGTGG + Intronic
951781530 3:26368635-26368657 GAGGGTTTTAGGGATGCTGGAGG + Intergenic
953528270 3:43713606-43713628 GAGGGCTGAAAGACTGCAGGTGG - Intronic
953883103 3:46701556-46701578 GGGGGTTGCCGGGCAGCTGGTGG + Exonic
954405240 3:50341764-50341786 GAGGGTGGAGGGGATGCAGGAGG - Intronic
954682265 3:52352085-52352107 GAAGCTGGAAGGGCTGCAGGTGG + Exonic
955689703 3:61578978-61579000 GTGTGTTGAAGGGGCGCTGGAGG + Intronic
956625184 3:71259884-71259906 GAGGGTGGGGGTGCTGCTGGAGG + Intronic
956660149 3:71589414-71589436 GATGGCTCATGGGCTGCTGGAGG - Intergenic
957768615 3:84658777-84658799 GAGGGTGCAAAAGCTGCTGGTGG - Intergenic
958007711 3:87833716-87833738 GAGGGTGGGAGGACTGCTTGAGG - Intergenic
960146652 3:114210897-114210919 GAGGGGTGGAGGGCTGGGGGAGG + Intergenic
961222687 3:125212675-125212697 GAGGGCGGAAGGGCTGTGGGGGG - Intronic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
961535325 3:127567197-127567219 GAGGGTATAGGGGCTGCTTGTGG - Intergenic
965605632 3:170495532-170495554 GAGGCTTGAAGAGCTGATGTGGG - Intronic
966890199 3:184401701-184401723 GAGGGCTGTAGGGCTGGAGGGGG + Intronic
968741867 4:2335208-2335230 TTGGGTTGAAGGGCAGGTGGGGG - Intronic
968877982 4:3284159-3284181 GAGGGCTGAAGGGCGGGTGTGGG + Intergenic
969313814 4:6369828-6369850 GAGGGCTCAGGGGCTGCTGGGGG - Intronic
969871173 4:10106099-10106121 GAGGGTGGAAGGGGTGGCGGGGG + Intronic
971092387 4:23360714-23360736 GAAGGTTGAGGGGGTGCTGAGGG + Intergenic
972367250 4:38387718-38387740 GTGGGTGGAAGGGTGGCTGGAGG + Intergenic
972599211 4:40556924-40556946 GTGGGATGAAGAGCTGCAGGTGG + Intronic
974283848 4:59837982-59838004 GAGGATTGAAGCTCTGCAGGAGG + Intergenic
974467293 4:62273500-62273522 GAGGGCAGAAGAGCTGCTGGTGG - Intergenic
975491104 4:74989646-74989668 GAGGGTAGAAGGGCTGGAGGTGG - Intronic
976673348 4:87678082-87678104 GAGGGTTGAAGTTCTACTTGGGG - Intergenic
981289412 4:143056773-143056795 GGGGGGTGAGGGGATGCTGGGGG + Intergenic
982120501 4:152138743-152138765 CAGAGCTGGAGGGCTGCTGGAGG - Intergenic
983642871 4:169959680-169959702 GATGGTTGAAGGACAGTTGGGGG + Intergenic
985511825 5:317870-317892 GGGAGTTGAAGGGTTGTTGGGGG - Intronic
985938895 5:3118468-3118490 GAGGGTGGAGGGGGTGCTGGAGG - Intergenic
986433883 5:7709225-7709247 GAGGTCTGAAGAGATGCTGGGGG - Exonic
989643145 5:43602983-43603005 GAGAGTGGAAGGGCCCCTGGGGG + Intronic
991045423 5:62217989-62218011 GAGTGTTGAAAGGGTGCTGATGG - Intergenic
991511554 5:67382913-67382935 TAGGGTTGAGGGGGTGGTGGTGG - Intergenic
992483371 5:77172874-77172896 GAGGGGTGAATGGCTGGTGGAGG - Intergenic
993872418 5:93268131-93268153 AGGGGTGGAGGGGCTGCTGGGGG - Intergenic
994200399 5:96968151-96968173 CAGGGTTGAGGGGCTGCCAGTGG + Intronic
995541434 5:113190036-113190058 GAGGGGTGTTGGGCTGCAGGTGG - Intronic
996277514 5:121685191-121685213 GGGGGTTGCAGAGTTGCTGGAGG - Intergenic
997303600 5:132823598-132823620 GAGTGGAGAAGGGCTGGTGGAGG - Intronic
997377434 5:133407166-133407188 GAGGTTTGCAGGGCTGCAGAAGG + Intronic
997588089 5:135056083-135056105 GATGGTTGAAGGGCAAATGGAGG + Intronic
999066975 5:148697668-148697690 GAGGTTTGTAGGGGAGCTGGAGG - Intergenic
1000407341 5:160902312-160902334 GAGGGTTGAAGGACTGAGTGAGG + Intergenic
1000965298 5:167648683-167648705 GAGGGTGGAAGAGGTGCAGGGGG + Intronic
1001551259 5:172603746-172603768 GAGGGTGGCTGGGCTGATGGTGG + Intergenic
1002432540 5:179211857-179211879 GGGGATTGGATGGCTGCTGGGGG - Intronic
1002466752 5:179412222-179412244 GAGGGTGGAAGGTCGGTTGGGGG - Intergenic
1002466841 5:179412427-179412449 GAGGGTGGAAGGTCGGTTGGGGG - Intergenic
1002466902 5:179412565-179412587 GAGGGTGGAAGGTCGGTTGGGGG - Intergenic
1002681673 5:180969835-180969857 GCGGGTTGAAGGGCTCCTCAAGG + Intergenic
1002718780 5:181245781-181245803 GAGGGTGGCAGAGCTGCCGGAGG + Intronic
1003171836 6:3726432-3726454 GAGGGGTCATGAGCTGCTGGTGG - Intronic
1006093693 6:31642980-31643002 GAGGGTTGAGGGGTGGGTGGAGG + Exonic
1006516194 6:34546996-34547018 GAGGGGTGGGGGGCTGCGGGGGG - Intronic
1006521357 6:34572982-34573004 GAGGGTTGAAAGGATGCTTTGGG - Intergenic
1006601244 6:35227705-35227727 GAGGCTGGAAGGGCACCTGGAGG + Intronic
1007369722 6:41418378-41418400 GAGGGTGGCAGGGGTGATGGTGG - Intergenic
1007464060 6:42039620-42039642 GAGCATTGAAGGGCAGCTGGAGG + Intronic
1012148166 6:95712282-95712304 GAGTGTTGAAGGGCTGGGTGGGG - Intergenic
1012813099 6:103985877-103985899 GAGGGTGGAAGGACACCTGGAGG - Intergenic
1012980979 6:105830821-105830843 GAGGAGGGAAGGGCAGCTGGAGG + Intergenic
1013497204 6:110709355-110709377 GAGGGGTGGAGGGCTGGGGGAGG + Intronic
1014159954 6:118156523-118156545 GGGGGTTGAGGGGCTGGGGGAGG + Intronic
1018067317 6:160133261-160133283 GTGGGTGGAGGGGCTGCGGGTGG - Intronic
1018611323 6:165650353-165650375 GAGGGGAGAAGGGGTCCTGGGGG - Intronic
1019477188 7:1249639-1249661 GGGGGTGGGAGGGCTGCTGCTGG + Intergenic
1019664583 7:2245250-2245272 GAGGGTTGAGGGGCGTCTGGAGG - Intronic
1019726022 7:2603143-2603165 GAGGGCCTGAGGGCTGCTGGAGG - Intronic
1023282879 7:38590034-38590056 GAGTGTTGAAGTGTTACTGGGGG + Intronic
1023845130 7:44116194-44116216 AGGGGTGGAGGGGCTGCTGGGGG + Exonic
1024606324 7:51025236-51025258 GAGGGTGGAGGGGGTGGTGGGGG + Exonic
1025079292 7:55968019-55968041 GAGGGTGGGAGGACTGCTTGAGG - Intronic
1026131605 7:67625610-67625632 GAGGGTTCAAGGGCTGGGAGAGG - Intergenic
1026133090 7:67636586-67636608 GAGGCTTCCAGGGCTGCTGGAGG - Intergenic
1030619126 7:111770278-111770300 GAGGGTGGAAGTGCTGCATGAGG + Intronic
1030787322 7:113678288-113678310 GAGGGTTGATGGGCTGGGAGAGG + Intergenic
1030914002 7:115289801-115289823 AAGAGATGAAGGGCTGGTGGAGG - Intergenic
1032168086 7:129561609-129561631 TTGGATTGAAGGGCTGTTGGAGG - Intergenic
1032487591 7:132299679-132299701 GAAGGTGGAATGGATGCTGGAGG - Intronic
1033355711 7:140597787-140597809 GGGCGTGGAAGGGCTGCTGTGGG + Intronic
1034150899 7:148914685-148914707 GAGGGGTGAAGGGTGGCTGTGGG - Intergenic
1034277090 7:149828793-149828815 GAGGGTGGTAGGGCTGCAGGGGG - Intergenic
1034458931 7:151187434-151187456 GAGGGGTGAGGGGCATCTGGGGG - Intronic
1034707241 7:153156637-153156659 CAGAGCAGAAGGGCTGCTGGAGG + Intergenic
1034783511 7:153903904-153903926 GAGGGTTGAGGGACTTTTGGTGG + Intronic
1035652687 8:1280742-1280764 GAGGCTGGAAGGGCAGTTGGGGG + Intergenic
1037648236 8:20813225-20813247 GAAGGATGGAGAGCTGCTGGTGG - Intergenic
1037689333 8:21169606-21169628 GAGGGAGGAAGGGCTGTGGGTGG - Intergenic
1037815728 8:22110681-22110703 GAGGGTTGGTGGGCTGCCTGGGG - Intergenic
1040465529 8:47691476-47691498 GGTGGTTGAAGGGCTGCTCCAGG + Intronic
1040481739 8:47833113-47833135 GTGAGTTGAAGGAGTGCTGGTGG - Intronic
1040650207 8:49439651-49439673 GTGGTTTGAAGTGCTGCGGGTGG - Intergenic
1041681237 8:60594624-60594646 GGGGGTTGAAGGGCTGGGGGAGG - Intronic
1042817879 8:72898025-72898047 CAGGGTTCAAGGGCTGCTTTTGG - Intronic
1049492766 8:142913921-142913943 GAGGGTTGAGAGGCAGCTGGAGG - Intronic
1052049028 9:23824627-23824649 GAGGGCGGAAGGGGTGGTGGTGG - Intronic
1052269791 9:26615555-26615577 GGGGGTAGAGGGGTTGCTGGGGG + Intergenic
1053282771 9:36831768-36831790 GAGTGCGGAGGGGCTGCTGGAGG + Intergenic
1056167865 9:83956392-83956414 GAGGGTGGCAGAGCTGCTGCTGG - Exonic
1056927084 9:90844204-90844226 GCCGGTTGAAGGGCTTCTTGAGG - Exonic
1057492700 9:95534255-95534277 GAGGCCTGAAGGGGTGCTGTGGG + Intergenic
1059446851 9:114343401-114343423 GAGGGGTGAAGGGAGGATGGAGG + Intronic
1060046961 9:120349089-120349111 GAGGGGAGAGGGGCTGCTGGAGG - Intergenic
1060101238 9:120842849-120842871 GAGGCTGGAAGCGCCGCTGGAGG - Exonic
1062318032 9:135977907-135977929 GAGTGTCCCAGGGCTGCTGGGGG - Intergenic
1062318045 9:135977943-135977965 GAGTGTCCCAGGGCTGCTGGGGG - Intergenic
1203779906 EBV:95562-95584 GAGGGTGGGGGGGCTGTTGGAGG + Intergenic
1189756761 X:44279983-44280005 GGGGGTTGGGGGGCTGGTGGTGG - Intronic
1190036777 X:47032515-47032537 AAGGGTTGAAGGCGTGCAGGGGG + Intronic
1191102806 X:56750619-56750641 GAGGTTTGTGGTGCTGCTGGTGG - Intergenic
1196096185 X:111803007-111803029 GAGGGGTGGAGGGCTGGGGGAGG - Intronic
1196198552 X:112860188-112860210 GAGGGAGGGAGGGCTGATGGTGG - Intergenic
1196232590 X:113240898-113240920 GAGGGTGGAAAGGTTGCTTGGGG + Intergenic
1197095695 X:122592014-122592036 TAGGTTTGTAGGGCTGCTGGAGG - Intergenic
1198010972 X:132553974-132553996 GAGGGTGGGAGGGTGGCTGGAGG - Intergenic
1199869958 X:151889429-151889451 GAGAAGTGAAGGGCTGCTGCTGG + Intergenic