ID: 927895555

View in Genome Browser
Species Human (GRCh38)
Location 2:26779466-26779488
Sequence GAGGGGTATTTCCAGTGGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927895555 Original CRISPR GAGGGGTATTTCCAGTGGAT GGG (reversed) Exonic
902168355 1:14590938-14590960 GAGGGGTAGCTCCAATGCATAGG - Intergenic
902189202 1:14749621-14749643 GAGGAGTATTCCCAGTAGGTTGG + Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
910841021 1:91561308-91561330 GAGGGGTGTTTCTACTTGATGGG - Intergenic
912067260 1:105758823-105758845 GTGGGTCATTTGCAGTGGATTGG - Intergenic
913316254 1:117555551-117555573 GAGAGGAGTTTTCAGTGGATAGG + Intergenic
916081557 1:161236426-161236448 GAGGGCTATTTCCATTGGGGAGG + Intronic
916733517 1:167587144-167587166 GAGGGACATTTCCAGGGCATGGG - Intergenic
918272776 1:182919446-182919468 GGGAGGTATTTCAAGAGGATAGG - Intronic
919377064 1:196808353-196808375 GATTGTTATTTCCAGTGAATAGG + Intergenic
1065383503 10:25112855-25112877 GAGTGGTATTCCATGTGGATTGG - Intergenic
1068318706 10:55381857-55381879 GAGGGGTATTGGGATTGGATGGG - Intronic
1073894118 10:108134409-108134431 AAGGGATAATTCCACTGGATAGG - Intergenic
1074676988 10:115862453-115862475 GAGGGGAAGTTCAAGTGGACAGG - Intronic
1083459885 11:62804117-62804139 GAGGGTTCTTTCCTGTGGATAGG - Intronic
1084580518 11:70020272-70020294 GTGGGGGATTTCCTGTGGATAGG - Intergenic
1088182037 11:107123285-107123307 GAGGGATATTTTCACTGGATTGG - Intergenic
1090484291 11:127098776-127098798 AAGGTGTATTTCCAGAGGTTAGG + Intergenic
1098869129 12:75797147-75797169 GATTGGTATTTCCAGGGGGTAGG + Intergenic
1102013045 12:109630820-109630842 GAGGGGAATATACAGAGGATAGG + Intergenic
1103932663 12:124458794-124458816 GACTAGTATTTCCGGTGGATGGG + Intronic
1105584788 13:21733909-21733931 GAGGGGTATTCCCCAGGGATAGG + Intergenic
1107230559 13:38104614-38104636 GAGGGTTGTTACCAGTGGACTGG + Intergenic
1109830451 13:67780068-67780090 GAGGGATATATCCAGTTTATTGG + Intergenic
1112318180 13:98383403-98383425 GAGGGGTTCTTCCAGTGCACCGG + Intronic
1116674361 14:47886791-47886813 GAGTGGTCTTTCCTGTGTATGGG + Intergenic
1121027080 14:90624479-90624501 GAGGTGCATGTCCAGTGGTTGGG - Intronic
1125412329 15:39418289-39418311 GAGGGGTACATGCGGTGGATGGG + Intergenic
1126168051 15:45670452-45670474 GAGTGGCATTTCCATTGCATCGG - Intronic
1127507259 15:59609493-59609515 GGGGGGTATTTCCAGGCTATAGG - Intronic
1129942423 15:79510004-79510026 GAGGGGCAGATCCAGAGGATAGG - Intergenic
1130239948 15:82178749-82178771 GAGGGGCATGTCCAGAGAATTGG - Intronic
1135205518 16:20480648-20480670 GATGGGTATTTCCAGTTTATGGG + Exonic
1135213389 16:20543165-20543187 GATGGGTATTTCCAGTTTATGGG - Exonic
1139222480 16:65197953-65197975 GAAGGGAATTTTCAGTAGATGGG - Intergenic
1141030586 16:80584414-80584436 GAGGGGTAGTTCCAGGTCATAGG - Intergenic
1141412030 16:83841759-83841781 GAAGGGTCTATCCAGTTGATCGG + Intergenic
1148575739 17:48709717-48709739 CAAGGGTTTTTCCAGTGGCTGGG - Intergenic
1150346865 17:64411302-64411324 GATGGGTATATGCAGTGGATAGG + Intronic
1150346878 17:64411370-64411392 GTTGGGTATATGCAGTGGATAGG + Intronic
1150346924 17:64411606-64411628 GATGGGCATGTGCAGTGGATGGG + Intronic
1150887004 17:69098783-69098805 GATGGTTATTTCCAGGGGATGGG + Intronic
1151802754 17:76387435-76387457 AAGGTGTGTTTGCAGTGGATGGG + Exonic
1152792762 17:82290993-82291015 GAGGGGTCTTTTCAGTAGTTGGG + Intergenic
1154316658 18:13309692-13309714 GTGGAGTATTTCCTGTGGCTCGG + Intronic
1154388690 18:13918218-13918240 GATGGGTATGTTCAGTAGATTGG - Intergenic
1155496635 18:26449180-26449202 GTGGGCTATTTCCACAGGATTGG + Intergenic
1156352023 18:36309978-36310000 GAGGGGTGATTACAGTGCATTGG - Intronic
1158080260 18:53581892-53581914 GAGGGGAAAGTGCAGTGGATAGG + Intergenic
1159274108 18:66193490-66193512 GAGTGTTGTTTCCAGTGGACTGG - Intergenic
1160142371 18:76337130-76337152 AACGGGTATTTCCTGTGTATAGG + Intergenic
1162100575 19:8336126-8336148 GAGGGGACTTTCCTGTGGAGTGG + Intronic
1164695724 19:30242063-30242085 GAGGGGTAATTCCTGTGGGAGGG + Intronic
1166910610 19:46153282-46153304 GATGGGCATTTCCCGTGTATGGG + Intronic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
927959424 2:27231591-27231613 TAGGGGTATTGCCAGGGGAGGGG - Intronic
932975934 2:76599691-76599713 GAGGGGTATGTCTACTGGAAAGG - Intergenic
939788581 2:146545383-146545405 GAGGAGGATATCAAGTGGATAGG - Intergenic
946027990 2:216683672-216683694 GAGAGGTTTTTGCAGAGGATGGG + Intronic
1169598895 20:7233985-7234007 GAAGGATATTTCCACTGTATAGG + Intergenic
1170599273 20:17828612-17828634 GAGGGGTGTTACCAGGTGATAGG + Intergenic
1171906000 20:30900001-30900023 GAGGAGTGTTTCCAGCGGAGCGG + Intergenic
1173152203 20:40577179-40577201 CAAGGGTGTTTCCAGTGGATGGG + Intergenic
1173162528 20:40663386-40663408 GTGGAGGATCTCCAGTGGATTGG + Intergenic
1179877010 21:44273698-44273720 AAGGGGTATTTCCAGTGCCAGGG + Intergenic
1183054123 22:35291405-35291427 CAGGGGTTTTTACAGTGGAAAGG + Intronic
1183256790 22:36767453-36767475 GAGGGCTATCTCCAGTGGAAGGG + Intronic
1185226758 22:49657810-49657832 GAGGGATATAACCTGTGGATGGG - Intergenic
949359597 3:3217545-3217567 GAGAGGTATTTGCAGTGGAGAGG - Intergenic
950504379 3:13385204-13385226 GAGTGGTGTCTCCAGTTGATGGG - Intronic
950796859 3:15517168-15517190 GAGGAGAGTTTCCAGAGGATAGG + Intronic
952919727 3:38276219-38276241 GGTGGGGAGTTCCAGTGGATGGG + Intronic
956169803 3:66424123-66424145 GTGGGGTCTTCCCAGTGGCTGGG - Intronic
956217387 3:66862679-66862701 GAGGGGTATATCAAGTGGGTAGG - Intergenic
956798889 3:72739286-72739308 GAGGGGGATTGTCGGTGGATGGG - Intergenic
958077687 3:88704257-88704279 GATGGGTATTTACTGTGGAATGG + Intergenic
959928962 3:111957767-111957789 GATGGTTATTTCCTGTGGCTAGG + Intronic
964961041 3:162427289-162427311 CAGGTGTACTGCCAGTGGATTGG - Intergenic
966755935 3:183371397-183371419 GAGGGGGGTTTCCAGTTCATAGG + Intronic
978826158 4:113026576-113026598 TAGAGGTATTTTCAGTGGACAGG + Intronic
985147072 4:186904358-186904380 TAGGGGAATTTCCAGTGATTTGG + Intergenic
988726356 5:33930245-33930267 GATGGGGATTTCCAGTGAAAAGG + Intergenic
991135271 5:63175805-63175827 CAAGGGTATTTCCAGTGCAGAGG + Intergenic
995629323 5:114116225-114116247 GAGGGTCATTGCCAGAGGATGGG + Intergenic
999173950 5:149618481-149618503 GAGGGGTTTCTCCAGTGTCTTGG + Intronic
1000120755 5:158195591-158195613 GAGGGGTATTATCTGGGGATTGG + Intergenic
1002157463 5:177294408-177294430 CAGAGGTCTTTCCAGTGGTTGGG - Exonic
1006555648 6:34863925-34863947 GATGGGTATTGTAAGTGGATGGG + Intronic
1007544727 6:42684900-42684922 GAGAGGTGTTTCCAGTGGCAGGG - Intronic
1009511159 6:64551495-64551517 GAGGGGTCTCTTCAGTTGATTGG - Intronic
1011494865 6:87927644-87927666 GAAGTGTACTTCCAGTGGAATGG - Intergenic
1013303591 6:108827234-108827256 GTGGTGGATTTCCAGTGGTTGGG + Intergenic
1016553002 6:145302817-145302839 TAGGGGCAATTCCAGTGGTTGGG + Intergenic
1021011411 7:15472735-15472757 TAGTGGTATTGCCAGTGTATAGG - Intronic
1021106508 7:16645280-16645302 GAGGGGTAGTTACAGAGGCTCGG - Intronic
1021372131 7:19862148-19862170 TACAGGTAGTTCCAGTGGATTGG + Intergenic
1022385702 7:29897002-29897024 GAAGGGTATTGCCAGGGGCTGGG - Intronic
1022574988 7:31488847-31488869 GTGGGGTATACCGAGTGGATGGG - Intergenic
1023110273 7:36803214-36803236 GAGGCTTATTTTTAGTGGATAGG - Intergenic
1032015877 7:128380233-128380255 GAGGAGTCTTACCAGTGGCTGGG + Intergenic
1032945837 7:136851556-136851578 AAGGGCTATTTCAAGTGGAGTGG + Intergenic
1035912596 8:3584009-3584031 GAGGTGTTTTTATAGTGGATGGG - Intronic
1036521654 8:9497265-9497287 GAGAAGTATTTCCAGTGGGTTGG + Intergenic
1044093635 8:88033996-88034018 GATGGGTATTGCCTGTTGATAGG - Exonic
1045892534 8:107174282-107174304 CAGGGTCATTTCCAGTGGGTTGG - Intergenic
1058307316 9:103460006-103460028 GAGGAGTATTTCCTGCCGATGGG + Intergenic
1058475173 9:105325764-105325786 GAGGAGTAATTCTAATGGATAGG + Intronic
1058916268 9:109568754-109568776 GAGGGCTGTTGCCAGTGGACTGG + Intergenic
1059423303 9:114205938-114205960 GAGGGGGCTTTCCAGGGGACTGG + Intronic
1060364689 9:122999082-122999104 GTAGGGTATTTTCACTGGATAGG + Intronic
1060511871 9:124240392-124240414 GAGAGGTGTTTCCTGTGGACTGG - Intergenic
1062115576 9:134806387-134806409 CAGGGGTATTTCCTTGGGATTGG + Intronic
1062727040 9:138080273-138080295 GAGGGGCAATGCCACTGGATTGG + Intronic
1189906928 X:45770757-45770779 CAGGGGTATTTTGAGGGGATGGG - Intergenic
1190776961 X:53560384-53560406 TAGGGATATTTCCTGGGGATGGG + Exonic
1195242404 X:102965535-102965557 AAAGGGTATTCCCAGTGTATAGG + Intergenic
1198334387 X:135652535-135652557 GAGGGGTATTACAAGGTGATTGG - Intergenic
1199331230 X:146562105-146562127 AAGGGATATTTCCTGTGGCTTGG + Intergenic