ID: 927896602

View in Genome Browser
Species Human (GRCh38)
Location 2:26786473-26786495
Sequence TTCCGAAAGCGGGAAGGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927896596_927896602 1 Left 927896596 2:26786449-26786471 CCTGCGAGGGGCTGGAGCAGGCG 0: 1
1: 0
2: 0
3: 33
4: 325
Right 927896602 2:26786473-26786495 TTCCGAAAGCGGGAAGGGACCGG 0: 1
1: 0
2: 1
3: 9
4: 94
927896593_927896602 6 Left 927896593 2:26786444-26786466 CCAGCCCTGCGAGGGGCTGGAGC 0: 1
1: 0
2: 1
3: 28
4: 392
Right 927896602 2:26786473-26786495 TTCCGAAAGCGGGAAGGGACCGG 0: 1
1: 0
2: 1
3: 9
4: 94
927896587_927896602 27 Left 927896587 2:26786423-26786445 CCGCTCCGGGCACGGGCGGTGCC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 927896602 2:26786473-26786495 TTCCGAAAGCGGGAAGGGACCGG 0: 1
1: 0
2: 1
3: 9
4: 94
927896588_927896602 22 Left 927896588 2:26786428-26786450 CCGGGCACGGGCGGTGCCAGCCC 0: 1
1: 0
2: 0
3: 21
4: 185
Right 927896602 2:26786473-26786495 TTCCGAAAGCGGGAAGGGACCGG 0: 1
1: 0
2: 1
3: 9
4: 94
927896595_927896602 2 Left 927896595 2:26786448-26786470 CCCTGCGAGGGGCTGGAGCAGGC 0: 1
1: 0
2: 4
3: 23
4: 237
Right 927896602 2:26786473-26786495 TTCCGAAAGCGGGAAGGGACCGG 0: 1
1: 0
2: 1
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927896602 Original CRISPR TTCCGAAAGCGGGAAGGGAC CGG Intronic
902650966 1:17837330-17837352 CTCCAAAAGAGGGAAGGGAAAGG + Intergenic
906168725 1:43706760-43706782 TGCCTAAGGCAGGAAGGGACTGG - Intronic
906290686 1:44617594-44617616 TCCCGAGAGCGGGCAGGGGCGGG - Intronic
910924174 1:92381393-92381415 TTCTGAAAGAGGGAAGGGTTTGG - Intronic
911379698 1:97097236-97097258 TTCCGAAAGGGCAAAGGGAGTGG - Intronic
912216754 1:107622764-107622786 TTCTGACAGCGGGAAGTGACTGG - Intronic
915518307 1:156426660-156426682 GGCCGAAAGCTGGAAGAGACAGG + Intronic
917945178 1:179962141-179962163 TTCCAAAAGTGGGAAAGGGCCGG - Intronic
919331195 1:196174274-196174296 TTCCGATAGAGGGAATGGAACGG + Intergenic
919763947 1:201114691-201114713 TCCCGAAAGTGGGACGGGGCCGG + Exonic
1063724490 10:8621851-8621873 TTTGGAAAGAGGGATGGGACTGG - Intergenic
1067536921 10:47117741-47117763 TTCCCAAAAAGGGAAGAGACAGG - Intergenic
1069831353 10:71284202-71284224 ATCCGAAATCTGGCAGGGACTGG + Intronic
1076501645 10:130941931-130941953 TTCCAGAAGTGGGAAGGGCCAGG - Intergenic
1078527423 11:12111182-12111204 TTACTAAAGAGGGAGGGGACAGG - Intronic
1080404642 11:31967726-31967748 TTCCCAGAGGGGGAAGGGAGTGG - Intronic
1081371423 11:42309113-42309135 TTCAGAAACTGTGAAGGGACTGG + Intergenic
1084153591 11:67302360-67302382 TTACAAAAGCGGGCAGGGAGTGG - Exonic
1084192954 11:67507087-67507109 TGCCGAAAGTGGAAAGGGAGTGG - Intronic
1086967021 11:93039523-93039545 TTCCAAAAGAGGGGAGGGATGGG + Intergenic
1089916783 11:122164808-122164830 TACTGAAAGTGGGGAGGGACTGG - Intergenic
1090500537 11:127256637-127256659 TTCAGAAAACAGGAAGGGAGAGG + Intergenic
1202815249 11_KI270721v1_random:44071-44093 TGCGGCAAGCGGGAAGGGAGCGG - Intergenic
1092374118 12:7941157-7941179 TTCTGAAAGTGGTAAGGGCCTGG - Intergenic
1095700304 12:45184729-45184751 TTCTGAAATAGGGAAGTGACAGG + Intergenic
1114224730 14:20727055-20727077 TTTAGAAAGGGGGCAGGGACTGG + Intergenic
1117458849 14:55925059-55925081 TGCCGATAGAGGGAAGGGACAGG - Intergenic
1118644095 14:67820145-67820167 TGCCCGAAGCGGGAAGGGGCTGG - Intronic
1118965407 14:70578836-70578858 TTCCAAAAGTGGGGAGGGAGGGG - Intergenic
1121279194 14:92687406-92687428 TTGGTAAAGCGGGAGGGGACCGG - Intronic
1121969059 14:98339714-98339736 TTCCCAAAGCTGGAAAAGACAGG + Intergenic
1122680362 14:103456256-103456278 TTCCAATGACGGGAAGGGACAGG - Intronic
1123460653 15:20467145-20467167 CTCCGAAGACGGGAAGGGACGGG + Intergenic
1123657408 15:22533271-22533293 CTCCGAAGACGGGAAGGGACGGG - Intergenic
1124271283 15:28282922-28282944 CTCCGAAGATGGGAAGGGACGGG + Intronic
1124311320 15:28628480-28628502 CTCCGAAGACGGGAAGGGACGGG - Intergenic
1124689899 15:31813009-31813031 TTCCGAAAGTGGCCAGGGAAGGG - Intronic
1125410593 15:39401968-39401990 TTCCAAAAGCCAGAAGGGAGTGG + Intergenic
1127065287 15:55230965-55230987 CTCCAAAAGGGGGAAGGGAGTGG - Intronic
1129787616 15:78320068-78320090 TTTCGAGATGGGGAAGGGACAGG + Intergenic
1129791226 15:78341704-78341726 GGCCGAAGGCGGGAAGGGAGAGG - Intronic
1130097105 15:80863969-80863991 TCCCAAAAGAGGGAAGGGAAAGG - Intronic
1134687543 16:16169406-16169428 TTCCGCTAGTGGGGAGGGACTGG + Intronic
1135469786 16:22719879-22719901 TTCCTAAAGCCCGAAGTGACTGG - Intergenic
1136855784 16:33656131-33656153 TTGCCAAGGCGGGAAGGGAAGGG - Intergenic
1137056236 16:35747891-35747913 GGAAGAAAGCGGGAAGGGACTGG - Intergenic
1141058406 16:80840482-80840504 TTCCCATAGCGGGAAGGGGGAGG - Intergenic
1141522138 16:84587719-84587741 GTCCAAAAGCGGGAACTGACAGG + Intronic
1203117369 16_KI270728v1_random:1504610-1504632 TTGCCAAGGCGGGAAGGGAAGGG - Intergenic
1144785343 17:17828182-17828204 TTCAGAAAGCAGGCAGGGAAAGG - Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1149538592 17:57451859-57451881 TTCAGAAAGAGGGAAGGGACAGG + Intronic
1149856193 17:60085071-60085093 TTCAGAAAGCAGGGAGGGCCTGG + Intergenic
1151938783 17:77280441-77280463 TCCCGAAAGAGGGAAGGGCGTGG - Intergenic
1154056541 18:11018101-11018123 TACCCAAAGCTGGAAGGGGCAGG - Intronic
1156497382 18:37534882-37534904 TTCTGAAAGCGAGCAGGGGCTGG + Intronic
1158403488 18:57141271-57141293 TTCCGGAAGGGGGAAGGCAGGGG - Intergenic
1158744028 18:60176838-60176860 TGCAGAAAGCGGGATGGGAAGGG + Intergenic
1160564408 18:79778222-79778244 TTCTCAAATCAGGAAGGGACAGG - Intergenic
1161242042 19:3228066-3228088 TTCCGAAAGAGGGCAGGCCCTGG + Intronic
1161454687 19:4364040-4364062 ATCCGGCAGGGGGAAGGGACAGG + Intronic
1161680255 19:5676601-5676623 TTGGGAAGGCGGGAAGGGGCTGG - Intronic
1162044792 19:7991349-7991371 TTCTGAGAGCTGGAAGGGGCTGG - Intronic
1163898205 19:20078156-20078178 TTCCGAGAGAGGGGAGGGACTGG + Intronic
1164272685 19:23686987-23687009 TCCCGAGAGGGGGAAGGGGCTGG - Intronic
1165948465 19:39459115-39459137 GTCCCTAAGCGGGAAGGGGCGGG + Intronic
1166332844 19:42088702-42088724 TTCCTGAAGAGAGAAGGGACTGG - Intronic
1167668000 19:50833790-50833812 TTCCTCAAGGGGGAGGGGACAGG + Intronic
1168232484 19:55042069-55042091 TTCAGAAAGCAGGGAGGGAGGGG - Intronic
927896602 2:26786473-26786495 TTCCGAAAGCGGGAAGGGACCGG + Intronic
928215772 2:29360247-29360269 TTCCCAGAGAGGGAAGGGCCAGG - Intronic
933342835 2:81044378-81044400 TTCAGAAATTGGGAAGGGCCTGG + Intergenic
933895914 2:86809440-86809462 GTCAGAAAGTGCGAAGGGACTGG + Intergenic
935726423 2:106027896-106027918 CTCCAAAAGTGGGAAGGGTCAGG + Intergenic
941794468 2:169584545-169584567 GTACGAAAGCGGGAAGGGCCTGG + Intronic
941857799 2:170248215-170248237 TTCCGGAAGGGTGAAGGGATAGG + Intronic
1169593644 20:7173691-7173713 TTCTGAAAGAGTGAAGGGAAAGG - Intergenic
1172077499 20:32310584-32310606 TACCCAAAGCGGAAAGGGAGAGG - Exonic
1175443156 20:59004611-59004633 TTCCCTGAGTGGGAAGGGACGGG + Intronic
1179605345 21:42512659-42512681 TTCCGCAAGCGGGATGGCCCAGG - Intronic
1180631394 22:17232605-17232627 TTCGTGAAGCGGGAAGGGAAAGG - Intergenic
1181725858 22:24810495-24810517 TTCCCAGAGCGAGCAGGGACTGG + Intronic
953189916 3:40675955-40675977 TTCCAAAAGAGGGAAGGGATGGG + Intergenic
961563040 3:127744367-127744389 TTCAGAAAGCGGTAAGTGGCTGG + Intronic
964091562 3:152883215-152883237 CTCCAAAAGTGGGAAGGGAGTGG - Intergenic
968904830 4:3446361-3446383 GTCCGCAAGCGGGTGGGGACAGG - Intronic
969594461 4:8141092-8141114 TCCAGGTAGCGGGAAGGGACTGG + Intronic
972778341 4:42264305-42264327 TTAAGAAAGGGGGAAGGGGCTGG - Intergenic
977642773 4:99375973-99375995 ATCTGAAAGAGGCAAGGGACAGG - Intergenic
984827445 4:183939283-183939305 CACCGGAAGCTGGAAGGGACAGG - Intronic
997389453 5:133502021-133502043 TTCCAGAAGCTGGAAGGGGCAGG + Intronic
1008495177 6:52125637-52125659 TTCTGAAAGTGGGAAGGCACTGG + Intergenic
1013169174 6:107620626-107620648 TTCCAAAAGTGGGCAGGAACAGG - Intronic
1014725651 6:124968587-124968609 TCCAGACAGCTGGAAGGGACAGG - Intronic
1018477274 6:164156025-164156047 CTCCAAAAGCTGGAAGGGATGGG + Intergenic
1019769580 7:2875281-2875303 TTCCAGAAGCAGGAAGAGACAGG - Intergenic
1036136722 8:6168550-6168572 TGCAGAAAGCGGTAAGGGAAGGG + Intergenic
1037393290 8:18416942-18416964 TTCCAAAATCGGGGAGGGAGAGG + Intergenic
1048823711 8:138402643-138402665 GTCCAAAAGTAGGAAGGGACAGG + Intronic
1049154266 8:141057210-141057232 ATGCAAAAGCGGGAAGTGACAGG - Intergenic
1051278924 9:15422521-15422543 GTCCGAAAGCCGCAAGGAACGGG + Intergenic
1056109607 9:83381761-83381783 TTCCAAAATAGGGAAGGGAATGG - Intronic
1056751206 9:89352628-89352650 TTCCAAGAGCTGGCAGGGACTGG - Intronic
1059603360 9:115805934-115805956 TTCCAGAAGGGGGAAGGGAAGGG + Intergenic
1194044446 X:88984322-88984344 TTCCCAAATCAGGAAGGGAAGGG + Intergenic