ID: 927899084

View in Genome Browser
Species Human (GRCh38)
Location 2:26806088-26806110
Sequence GGTGTGAGAGGATCACCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927899084_927899090 26 Left 927899084 2:26806088-26806110 CCTAATGGTGATCCTCTCACACC No data
Right 927899090 2:26806137-26806159 GGAAGTTTTACTTTCAGAATTGG No data
927899084_927899089 5 Left 927899084 2:26806088-26806110 CCTAATGGTGATCCTCTCACACC No data
Right 927899089 2:26806116-26806138 TTGGTTTCTGCTACTAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927899084 Original CRISPR GGTGTGAGAGGATCACCATT AGG (reversed) Intergenic
No off target data available for this crispr