ID: 927900336

View in Genome Browser
Species Human (GRCh38)
Location 2:26814222-26814244
Sequence GGCTGACGCAGGAGAACGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927900329_927900336 0 Left 927900329 2:26814199-26814221 CCTGTAAACCCACCTACTCGGGA No data
Right 927900336 2:26814222-26814244 GGCTGACGCAGGAGAACGGCTGG No data
927900332_927900336 -9 Left 927900332 2:26814208-26814230 CCACCTACTCGGGAGGCTGACGC No data
Right 927900336 2:26814222-26814244 GGCTGACGCAGGAGAACGGCTGG No data
927900326_927900336 19 Left 927900326 2:26814180-26814202 CCGGGCGCGGTGGCGGGCACCTG 0: 204
1: 7043
2: 26895
3: 62220
4: 127309
Right 927900336 2:26814222-26814244 GGCTGACGCAGGAGAACGGCTGG No data
927900331_927900336 -8 Left 927900331 2:26814207-26814229 CCCACCTACTCGGGAGGCTGACG No data
Right 927900336 2:26814222-26814244 GGCTGACGCAGGAGAACGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927900336 Original CRISPR GGCTGACGCAGGAGAACGGC TGG Intergenic
No off target data available for this crispr