ID: 927902041

View in Genome Browser
Species Human (GRCh38)
Location 2:26827448-26827470
Sequence GCGGCAGGTGGCAGACTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927902041_927902048 5 Left 927902041 2:26827448-26827470 CCTCTAAGTCTGCCACCTGCCGC 0: 1
1: 0
2: 1
3: 10
4: 92
Right 927902048 2:26827476-26827498 TGAGACCAGCTCCTCCACCGTGG 0: 1
1: 0
2: 1
3: 19
4: 401
927902041_927902054 29 Left 927902041 2:26827448-26827470 CCTCTAAGTCTGCCACCTGCCGC 0: 1
1: 0
2: 1
3: 10
4: 92
Right 927902054 2:26827500-26827522 GGTCGCCTTGCCACCAACCATGG 0: 1
1: 0
2: 0
3: 2
4: 57
927902041_927902049 8 Left 927902041 2:26827448-26827470 CCTCTAAGTCTGCCACCTGCCGC 0: 1
1: 0
2: 1
3: 10
4: 92
Right 927902049 2:26827479-26827501 GACCAGCTCCTCCACCGTGGTGG 0: 1
1: 0
2: 1
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927902041 Original CRISPR GCGGCAGGTGGCAGACTTAG AGG (reversed) Intergenic
900976551 1:6020378-6020400 GCAGAAGGTGGCAGTCTGAGAGG - Intronic
901511984 1:9722076-9722098 GCGGCAGGAGGCCTACCTAGAGG + Exonic
902205502 1:14865466-14865488 GCAGCAGATGGCAGACATGGGGG - Intronic
902870768 1:19312372-19312394 GGGGCAGGTGGCAAACTTCACGG + Exonic
903704525 1:25275325-25275347 GCAGCGGGTGGCAGACTCACTGG + Intronic
904566778 1:31433051-31433073 GCAGCAGGTGGCAGCCTGTGAGG + Exonic
908417814 1:63930541-63930563 GCATCAGGTGGTAGACTTACTGG + Intronic
910757730 1:90709695-90709717 GCGGCAGTGGGCAGACTTCCCGG + Intergenic
919144301 1:193613870-193613892 GTGGAAGGTGGCAGAGATAGTGG + Intergenic
923233309 1:232008899-232008921 GAGGCAGATGGATGACTTAGAGG + Intronic
1062862703 10:822799-822821 GCGCCAGGTGGCTGCCTTGGTGG - Intronic
1062967378 10:1618092-1618114 GCAGCAGATGGCACACTCAGAGG - Intronic
1063371299 10:5524665-5524687 GCGGCAGGTGGGAGACGGGGAGG + Exonic
1067967725 10:50932366-50932388 GCAGCAGGTGGCAGACTAGTGGG - Intergenic
1070916683 10:80159620-80159642 GTGGCAGGTGGGAGATTTTGGGG - Intronic
1073315991 10:102581274-102581296 GGGGCAGTAGGCAGACTGAGTGG + Intronic
1075964023 10:126594869-126594891 GAGGCAGGTGTGAGACTTATTGG + Intronic
1076215075 10:128686923-128686945 GGTGCAGGAGGCAGACTTGGAGG + Intergenic
1076216556 10:128698201-128698223 TCAGCAGGTGGGAGACTTGGTGG - Intergenic
1077231314 11:1459300-1459322 GCGGCAGGTGGCGGCCACAGCGG - Intronic
1077909700 11:6563414-6563436 GCTGCAGGTGGCTGACTTTGAGG + Exonic
1083628814 11:64085545-64085567 GCGGCAGGGGACGTACTTAGTGG - Intronic
1083681111 11:64352288-64352310 GCGGCAGGAGGCCGAGCTAGAGG + Exonic
1084580631 11:70020747-70020769 GACCCAGGGGGCAGACTTAGAGG + Intergenic
1089198156 11:116707419-116707441 GCGGGAGGTGGCAGCCCGAGTGG - Intergenic
1090407219 11:126483933-126483955 GCTGCAGGTGGGAGAGTCAGGGG - Intronic
1093214549 12:16347776-16347798 GTGGCAGATGGAAGACTTGGGGG + Exonic
1095904812 12:47366920-47366942 GTGGGTGGTGGCAGACTAAGAGG - Intergenic
1096214725 12:49792774-49792796 GCGGGAGGTGCCAGGCATAGAGG - Exonic
1107129034 13:36875272-36875294 AAGGCAGATGGCAGACTTCGGGG - Intronic
1108313133 13:49215182-49215204 GCTGCAGGTGGCAGTCTTTGGGG + Intergenic
1120808659 14:88780182-88780204 GAGGCAGGTGGATCACTTAGAGG - Intronic
1121962337 14:98273153-98273175 GCAGCAGGTGCAAGATTTAGTGG + Intergenic
1122475495 14:102005567-102005589 GCGGCACGTGGCAGACTCCTAGG + Intronic
1122694628 14:103546692-103546714 GCTGCCTGTGGCAGAGTTAGGGG + Intergenic
1126332770 15:47551327-47551349 GGGGCAGGTTGCAGAGTTGGGGG + Intronic
1130353803 15:83112396-83112418 GAGGGAGGTGGCAGAGTCAGTGG + Intronic
1132953537 16:2578477-2578499 GAGGCAGGTGGCAGGCTGAGAGG + Intronic
1132960815 16:2621690-2621712 GAGGCAGGTGGCAGGCTGAGAGG - Intergenic
1133138064 16:3725895-3725917 GCTGGGGGTGGTAGACTTAGGGG + Exonic
1138112724 16:54337462-54337484 GTGGCAGGGGACAGACTTTGGGG - Intergenic
1138582298 16:57949485-57949507 GAGGCAGGAGGTAGACTCAGCGG - Intronic
1143531919 17:7510158-7510180 GAGGCAGGGGCCAGACTTGGGGG + Intronic
1160826096 19:1081259-1081281 GAGGCAGGGGGCAGACCTGGAGG + Intronic
1161740646 19:6019001-6019023 GCGGCAGGAGGCAGACTTTGTGG - Intronic
1163919398 19:20274742-20274764 GGAGCAGGTGGCAGCCTTGGAGG - Intergenic
1164573684 19:29392657-29392679 GAGGCAGGTGGCAGGCTAAGAGG - Intergenic
1166414978 19:42588818-42588840 GCGGCCAGTGGCTGAGTTAGTGG + Exonic
1167153677 19:47725119-47725141 GAGGCATGTGGCAGGCTTGGGGG + Intronic
926087216 2:10028063-10028085 GGGCCATGTGGCAGACCTAGGGG + Intergenic
927889747 2:26740933-26740955 GCGGCAGGTGGCAGAACGATTGG - Intergenic
927902041 2:26827448-26827470 GCGGCAGGTGGCAGACTTAGAGG - Intergenic
929256632 2:39818039-39818061 GAAGCATGTGGCAGACTTATTGG - Intergenic
935081251 2:99797157-99797179 GCCACAGGTGTCAGACTTATTGG + Intronic
937032551 2:118752802-118752824 GCGGCAGGGGTCAGGCTAAGAGG + Intergenic
937770919 2:125720515-125720537 GAGGCAGGAGGCAGAGATAGAGG + Intergenic
938052131 2:128183715-128183737 GCTGCTGGTGACAGACTCAGGGG + Exonic
938552621 2:132395147-132395169 GCAGCAGGTGGTACAGTTAGAGG - Intergenic
942619208 2:177829777-177829799 GTGGCAGGTGGGATTCTTAGAGG - Intronic
947553146 2:231062539-231062561 TCGGCAGTTTGCAGCCTTAGTGG + Exonic
948404021 2:237704056-237704078 ACGGCAGATGGCAGACATTGGGG - Intronic
949017526 2:241721873-241721895 GCTACAGGTGGCAGGCTTGGAGG + Intronic
949048907 2:241886521-241886543 GGGGCAGGTGGCAGACCTCGGGG + Intergenic
1173712880 20:45175990-45176012 GGGGCAGGAGCCAGGCTTAGTGG - Exonic
1175168533 20:57063332-57063354 GTGGCAGCTGGCAGACCAAGGGG + Intergenic
1175903973 20:62370912-62370934 GAGGCAGGTGGCAGCCCTGGGGG - Intergenic
1179778099 21:43680864-43680886 GCTGTAGGTGGCAGAATTATGGG + Intronic
1181484234 22:23220376-23220398 GCAGGAGGTGGCAGACACAGAGG - Intronic
1185180138 22:49355252-49355274 GGGGTTGGTGGCAGAATTAGAGG - Intergenic
1185280775 22:49968994-49969016 AGGGCAGGTGGCAGGATTAGGGG - Intergenic
954192591 3:48974572-48974594 GCAGATGGTGGAAGACTTAGTGG + Intronic
954581517 3:51705720-51705742 GCAGCCGGTGGCAGAGTTGGAGG + Intergenic
959894820 3:111593965-111593987 GCGGCAGGTGGCATACTGGTTGG + Exonic
960945111 3:122961087-122961109 GCAGCAGGTACCAGACTGAGGGG - Intronic
961045038 3:123702242-123702264 CCAGCAGGTGGCAGCCTTATGGG - Intronic
962432465 3:135332493-135332515 GAGGCAGATAGCTGACTTAGAGG - Intergenic
966944150 3:184765890-184765912 GTGGCTGGTGGCAGGCTCAGAGG + Intergenic
968524411 4:1048682-1048704 GCGGCAGGTGAGAGGCTGAGGGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
971426383 4:26520080-26520102 GCAGAGGGTGGCAGACGTAGGGG - Intergenic
981568858 4:146130997-146131019 GCGGCAGGTGGCAGAATGGCAGG + Intergenic
982994409 4:162322917-162322939 GCAGCAGGTGGAAGAGTGAGTGG + Intergenic
993394179 5:87362021-87362043 GTGGCATGTGACACACTTAGTGG + Intronic
997505220 5:134411782-134411804 GCGGCAGGCGGCCGACTTCGCGG - Exonic
1003550471 6:7098379-7098401 GTGGAAGGAGGCAGGCTTAGTGG - Intergenic
1005447691 6:25941717-25941739 GCCTAGGGTGGCAGACTTAGAGG + Intergenic
1011474478 6:87737454-87737476 GGGGCAGGTGGGAGAGTGAGGGG - Intergenic
1016604999 6:145910526-145910548 GCGGCAGATTGCACACTTAATGG + Exonic
1018385592 6:163300170-163300192 ATGGCAGGCGCCAGACTTAGTGG + Intronic
1019173866 6:170149960-170149982 GCAGCAGGTAGCAGGCTTGGCGG - Intergenic
1024024848 7:45401275-45401297 AAGGCAGGAGGGAGACTTAGGGG + Intergenic
1029253666 7:99254433-99254455 GCAGCAGGTGGCAGACATAAAGG - Intergenic
1033822024 7:145146623-145146645 GCTGCAGGTGTCAGACCCAGAGG - Intergenic
1038024520 8:23576805-23576827 GAGGCAGGTGGCAAACTAAGAGG - Intergenic
1045649151 8:104326656-104326678 GTGGCAGGTTGCAGACATGGAGG - Intergenic
1048187957 8:132261570-132261592 GAGGCAGGTGGCAGAATGTGTGG + Intronic
1055824202 9:80304335-80304357 TTGGCAGGTGGCAGACATGGAGG + Intergenic
1059570643 9:115430824-115430846 GTGGCAGGTGGGAGACATTGGGG - Intergenic
1061761414 9:132854503-132854525 TCGGCAGGAGGCAGAATTAGGGG - Intronic
1186464020 X:9770448-9770470 GCCTCAGGTGGTAGACTTACAGG - Intronic
1189645298 X:43121836-43121858 GCAGCAGATGACAGACTTTGAGG - Intergenic
1195197739 X:102516360-102516382 GCTGCAGGTCGGAGGCTTAGAGG - Intronic
1197870627 X:131059341-131059363 GGGGCAGGTGGCAGCCTGAAGGG - Intronic
1200616891 Y:5389622-5389644 GCGGGAGGTGACTGACTTATGGG + Intronic