ID: 927905154

View in Genome Browser
Species Human (GRCh38)
Location 2:26849819-26849841
Sequence CCGTGTGGGAGGCGCTCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927905148_927905154 -9 Left 927905148 2:26849805-26849827 CCACGCCGGGAATCCCGTGTGGG 0: 1
1: 0
2: 0
3: 2
4: 42
Right 927905154 2:26849819-26849841 CCGTGTGGGAGGCGCTCCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 156
927905137_927905154 30 Left 927905137 2:26849766-26849788 CCGGGCACGTGCTGGCTTTGGGG 0: 1
1: 0
2: 3
3: 16
4: 224
Right 927905154 2:26849819-26849841 CCGTGTGGGAGGCGCTCCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 156
927905146_927905154 -4 Left 927905146 2:26849800-26849822 CCTGGCCACGCCGGGAATCCCGT 0: 1
1: 0
2: 1
3: 6
4: 58
Right 927905154 2:26849819-26849841 CCGTGTGGGAGGCGCTCCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927905154 Original CRISPR CCGTGTGGGAGGCGCTCCCC CGG Intronic
900098236 1:949097-949119 GGGTGTGGGAGGGGCCCCCCAGG - Intronic
900292582 1:1929797-1929819 CCGAGAGGCAGGAGCTCCCCAGG - Intronic
900313281 1:2044924-2044946 ACGTGCGGGACGAGCTCCCCGGG + Intergenic
900368005 1:2319337-2319359 GCGTGTGAGCGGCGCTCACCTGG - Intergenic
900418912 1:2547167-2547189 CGGCTGGGGAGGCGCTCCCCAGG - Intergenic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
900957029 1:5892470-5892492 CCATGTGGGAGGCCCTGCACAGG - Intronic
901089754 1:6633397-6633419 CAGTGTGGGAGATGCTCCTCAGG + Exonic
903478248 1:23635069-23635091 CCATCTGGGAGGCCTTCCCCAGG - Intronic
904355541 1:29936709-29936731 CCAGGTGGGAGGCAGTCCCCAGG - Intergenic
904557122 1:31372699-31372721 CTGTGTGGGAGGCTCTTTCCAGG - Intronic
918326581 1:183416968-183416990 GCGTGTGGGAGGCCCTGACCTGG - Intronic
921850528 1:219928472-219928494 CGGGGTGGGCTGCGCTCCCCTGG - Exonic
922555422 1:226528660-226528682 GAGTGTGGGAGACGCCCCCCAGG - Intergenic
923369380 1:233295422-233295444 GCGTGTGGGCCGCGCTCACCGGG - Exonic
1062996187 10:1869462-1869484 CAGGGAAGGAGGCGCTCCCCAGG - Intergenic
1064301794 10:14129568-14129590 CTGGGTGGGAGGCCCGCCCCTGG + Intronic
1065206235 10:23360314-23360336 CCCTGTGGGGGGTGATCCCCAGG + Intergenic
1069269918 10:66513816-66513838 ACGTCAGGGAGGCTCTCCCCAGG - Intronic
1069957595 10:72061449-72061471 GCCTGTGGGTGGCTCTCCCCTGG + Exonic
1070572534 10:77650918-77650940 CTGTGTTGGAGGGGCTTCCCAGG - Intergenic
1076242022 10:128915746-128915768 CGCTGTGGGACGCTCTCCCCTGG + Intergenic
1076722914 10:132400515-132400537 CCTTGGAGGAGGCGCTCCCCTGG + Intronic
1077068587 11:656642-656664 CAGCGTGGGGGCCGCTCCCCGGG - Intronic
1077299689 11:1841246-1841268 AGGTGTGGGAGGTGCTTCCCCGG - Intronic
1077299700 11:1841275-1841297 AGGTGTGGGAGGTGGTCCCCAGG - Intronic
1080233754 11:30046010-30046032 TAGGCTGGGAGGCGCTCCCCTGG - Intergenic
1083623445 11:64060007-64060029 CCGTGTGGGAGGGGGGCCCCTGG - Intronic
1084510520 11:69600796-69600818 CCATGTGGGTGCCGCTCCGCAGG - Intergenic
1084557436 11:69883432-69883454 CCCTGTGAGCTGCGCTCCCCTGG + Intergenic
1085466079 11:76724175-76724197 CCATGTAGGAGGCTCTTCCCAGG - Intergenic
1097088785 12:56488617-56488639 GGGGGCGGGAGGCGCTCCCCGGG + Intergenic
1099635252 12:85204498-85204520 CCATGTGGGAGGCTGTACCCTGG + Intronic
1102152719 12:110699711-110699733 CCGTGTGCCAGGCGCTGCGCCGG + Intronic
1102812678 12:115837977-115837999 ACATGTGGGGGGCGCTGCCCAGG - Intergenic
1103602844 12:122065047-122065069 CCTTGTGGGATGCGCCCACCCGG + Intergenic
1103722921 12:122984155-122984177 CCGTGGGGGAGCTGCCCCCCTGG + Exonic
1104375870 12:128265775-128265797 CAGAGTGGGAGGCTCTCTCCTGG - Intergenic
1104889252 12:132132505-132132527 CCCTGGGGGAGCAGCTCCCCTGG - Intergenic
1104919514 12:132283300-132283322 CCGTGAGGAAGGCGCGACCCGGG - Intronic
1104977479 12:132558713-132558735 CCGTGTGGGAGCTGCTCCCGCGG + Intronic
1105011888 12:132761751-132761773 CCGAGTGGGCGGCGCTGGCCTGG - Exonic
1114400159 14:22402702-22402724 ACCTGAGGGAGGCGTTCCCCTGG - Intergenic
1114669036 14:24399115-24399137 CCGTGCGGGGGGCGCGCCGCGGG + Intronic
1117072407 14:52068876-52068898 CCGTGTGGGAAGAGCTCGTCTGG + Exonic
1122788970 14:104176451-104176473 CCGTGTGGGCTGTGCTCGCCTGG + Exonic
1123192283 14:106582941-106582963 CTGTCTGGGAGGAGCTCCCAGGG - Intergenic
1202906211 14_GL000194v1_random:73651-73673 CGGGGTGGGAGGGGGTCCCCAGG + Intergenic
1124629040 15:31326818-31326840 CCGTGTGGGCGGCCCGGCCCCGG - Intergenic
1124640101 15:31391818-31391840 CCCGGCGGGAGGCGCTTCCCGGG + Intronic
1125494928 15:40183861-40183883 CCGTGTAGGAGGTGCTCTCAAGG + Exonic
1126738155 15:51751924-51751946 CCGGGCGGGAGGCGCCCGCCGGG + Intronic
1128725071 15:69982247-69982269 CCATGGAGGAGGTGCTCCCCAGG + Intergenic
1132385939 15:101399830-101399852 CCGTGGGTGAGGGGCTCCCGGGG - Intronic
1132551497 16:555628-555650 CCCTGTGGGAGCTGCTCCCGGGG - Intergenic
1132843567 16:1990073-1990095 CCGGGCGGGACGCGCGCCCCTGG - Exonic
1132942196 16:2513864-2513886 CCGTGGGGGAGACGCGTCCCCGG - Exonic
1135047875 16:19169004-19169026 CCGGGTGGCTGGCGCGCCCCGGG - Intronic
1135621011 16:23955541-23955563 AAGTGTGGGAGGCTGTCCCCTGG + Intronic
1135729497 16:24882445-24882467 CCGTGGGTGAGGTGCTCTCCAGG - Intronic
1135931608 16:26742846-26742868 CCGTGTGAAAGGCACTCCCCAGG + Intergenic
1136232517 16:28894959-28894981 CCCTGTGGCAGGGGCTCCGCAGG - Intronic
1138205969 16:55125351-55125373 CAGTTTGGGAAGGGCTCCCCAGG + Intergenic
1139488207 16:67271244-67271266 CCCTGTGGGAAGTGCTCCCTGGG + Exonic
1141731484 16:85825741-85825763 CCAGGTGGAAGGCGCTCGCCTGG + Intergenic
1141878822 16:86844781-86844803 CCGGGTGGCAGGCGCCCTCCAGG + Intergenic
1142034947 16:87856952-87856974 CTGTGCTGGGGGCGCTCCCCAGG - Intronic
1142103737 16:88290990-88291012 CCATGTGGCAGGAGCTGCCCTGG - Intergenic
1142382161 16:89739085-89739107 CCGGCTGGGGGGAGCTCCCCTGG + Intronic
1142757076 17:2022914-2022936 CACTGTGGGGGCCGCTCCCCGGG - Intronic
1147159219 17:38560831-38560853 CTGTGTGGCAGGCGCTGCACAGG - Intronic
1147550900 17:41440735-41440757 CCGTGTGGGGTCCACTCCCCTGG - Exonic
1148736748 17:49869395-49869417 CCCTGTGGGAGGCGGTACCATGG + Intergenic
1152377571 17:79926655-79926677 CAATGTGGGAGGCCCTCACCCGG - Intergenic
1152700139 17:81814571-81814593 GCGTGTGTGTGGCGCACCCCGGG - Intergenic
1160567055 18:79792773-79792795 CAGTGCGGGAGGAGCTCCCACGG - Intergenic
1162180719 19:8867057-8867079 CCTAGTGGGAGAAGCTCCCCTGG + Intronic
1162311999 19:9913449-9913471 CCGCGCGGGGGGCGCTCCCGGGG - Intronic
1163728194 19:18934302-18934324 CCTGGTGGGAGGCGAGCCCCAGG + Exonic
1163862104 19:19747966-19747988 CCTGGAGGGAGGGGCTCCCCAGG - Intergenic
1164146874 19:22517926-22517948 CCGCGTGAGAGGCGCGGCCCTGG + Intronic
1166117300 19:40663661-40663683 GCCTGTGGGAGGTCCTCCCCGGG + Intergenic
1167558438 19:50210391-50210413 CCGGGCGGAAGGCGCCCCCCAGG + Exonic
1168400203 19:56081171-56081193 CTGTGTGGGAGGCGGGTCCCAGG + Intergenic
925408772 2:3626858-3626880 CTGTGTGGTAGGCGGTGCCCGGG + Intronic
926300486 2:11598589-11598611 CTGTGTAGGAGTCGCTCCTCAGG + Intronic
927905154 2:26849819-26849841 CCGTGTGGGAGGCGCTCCCCCGG + Intronic
934500411 2:94856927-94856949 CGGGGTGGGAGGGGGTCCCCAGG - Intergenic
948293142 2:236842193-236842215 CTGTGTGGTTGGCGATCCCCTGG + Intergenic
948459195 2:238121013-238121035 CCCTGTGGGAGGTGCCCCCTCGG + Intronic
948753516 2:240145655-240145677 ACGTGGCGGAGGCGCACCCCAGG + Intergenic
948824244 2:240566687-240566709 CGCGGTGGGAGGCGCTCCCTTGG + Intronic
1168926203 20:1581537-1581559 CCATGTGGAAGGAGCTCCCAAGG - Intronic
1168930069 20:1614592-1614614 CCATGTGGGAGGAGCTCCCAAGG - Intronic
1168934466 20:1651471-1651493 CCATATGGGAGGAGCTCCCAGGG - Intronic
1168952233 20:1810371-1810393 CCGTGCTGGAGGGGCACCCCAGG - Intergenic
1176625565 21:9088408-9088430 CGGGGTGGGAGGGGGTCCCCAGG + Intergenic
1176868051 21:14064545-14064567 CGGGGTGGGAGGGGGTCCCCAGG + Intergenic
1180064694 21:45406229-45406251 CCCTTTGGGCGGGGCTCCCCTGG - Intronic
1180722448 22:17919670-17919692 CAGCGGGGGAGGTGCTCCCCTGG + Intronic
1181333205 22:22110805-22110827 CCCTGTGGAAGGAGCTGCCCGGG + Intergenic
1184115203 22:42418066-42418088 CAGTGTGGGAGGGACTTCCCTGG - Intronic
1185172751 22:49303294-49303316 GCCTCTGGGAGGCCCTCCCCAGG - Intergenic
953851982 3:46471544-46471566 CCCTGAGGGAGGCTCTCCACTGG - Intronic
956414579 3:69013270-69013292 CCGGGGCGGAGCCGCTCCCCGGG - Intronic
961456466 3:127027102-127027124 ACGTGTGCTGGGCGCTCCCCAGG + Intronic
961661358 3:128470268-128470290 CCGTGTACCAGGCACTCCCCTGG + Intergenic
966892594 3:184418024-184418046 ACCAGGGGGAGGCGCTCCCCTGG + Intronic
966941417 3:184750331-184750353 CAGTGTGGGAAAGGCTCCCCTGG - Intergenic
968353212 3:198080277-198080299 CGGGGTGGGAGGGGGTCCCCAGG - Intergenic
968509496 4:989171-989193 CGGTGAGGGAGGCCCTGCCCAGG - Exonic
968546518 4:1201527-1201549 CAGTGTGGCAGGCACTCCCGGGG - Intronic
968629911 4:1645006-1645028 CCATGTGGGAGGGGCTCACAGGG + Intronic
968741167 4:2332436-2332458 GCGTGAGGGAGAGGCTCCCCAGG - Intronic
968900719 4:3430591-3430613 CAGGCTGGGAGGCGCTCTCCCGG - Exonic
969477437 4:7429620-7429642 CCCTGTGGGAGGGGCCCGCCGGG - Intronic
969504328 4:7574806-7574828 CCGTGTGGCATGCTGTCCCCAGG + Intronic
969698304 4:8748328-8748350 CTGTGTGGGAGGCTCTCACAAGG + Intergenic
975828701 4:78346794-78346816 CACTGGGGGAGGAGCTCCCCAGG - Intronic
982240491 4:153295272-153295294 CCCTGTGGGACGAGCTCACCAGG + Intronic
985512908 5:322109-322131 CCGTGCGGGCCGCGCTCCCTGGG + Intronic
987867299 5:23561622-23561644 CCATTTGGGAGACGCTCCCTTGG - Intergenic
994110276 5:95995231-95995253 CAGTGTGGGATGAGCTCCACTGG - Intergenic
998231423 5:140363633-140363655 CACTGTGGGAGGGGCTCACCCGG + Intronic
998469475 5:142372261-142372283 CTGTGTGTGAGGCTCTGCCCTGG + Intergenic
1001926276 5:175639577-175639599 ACGTGCAGGAGGCGCTCCTCTGG + Intergenic
1001984554 5:176061909-176061931 CAGGGTGGGAGGGGGTCCCCAGG + Exonic
1002232960 5:177782288-177782310 CAGGGTGGGAGGGGGTCCCCAGG - Exonic
1002263031 5:178007531-178007553 CAGGGTGGGAGGGGGTCCCCAGG + Intronic
1006903427 6:37517306-37517328 CCGTGTGGGAATGGCGCCCCTGG + Intergenic
1015934606 6:138396190-138396212 CAGTGTAGGAGGCGCTTCACAGG + Intergenic
1018914353 6:168123714-168123736 CAGTGTGGGAGGTGCTTCTCTGG + Intergenic
1024937137 7:54721783-54721805 CCCTGTGACAGGCGCTCCACAGG + Intergenic
1027267573 7:76502742-76502764 CCGAGGGGGAGGCGGTGCCCTGG - Intronic
1028135525 7:87219907-87219929 ACGTGTGGGAGTCTCTCCCGGGG - Intronic
1035254040 7:157614807-157614829 CCGTGTCCGAGGCCCTCCCTGGG - Intronic
1035687565 8:1536841-1536863 CCCTGTAGGAGGCGCTGGCCAGG + Intronic
1036701421 8:11016134-11016156 CCGTGGGGGTGCAGCTCCCCTGG + Intronic
1036709168 8:11067350-11067372 CCGGGTGGGGGGCTCTGCCCAGG - Intronic
1037444124 8:18947472-18947494 CAGTGTGAAAGACGCTCCCCTGG + Intronic
1037954347 8:23042522-23042544 TTGAGTGTGAGGCGCTCCCCTGG - Intronic
1049587962 8:143440657-143440679 CCGGGTGGGAGGCCCAGCCCCGG - Intronic
1049846903 8:144807266-144807288 CCGTGTGGGGGTGCCTCCCCTGG + Exonic
1053308835 9:37002604-37002626 CCGTCGGGGATGCGCTCCACGGG - Intronic
1054357202 9:64072128-64072150 CAGGGTGGGAGGGGGTCCCCAGG + Intergenic
1055654694 9:78440604-78440626 CCCTGTGGCAGGCCCTCTCCTGG + Intergenic
1059268850 9:113060259-113060281 CCGGGAGGAAGGCGCCCCCCGGG + Intergenic
1059269986 9:113065708-113065730 CCGGGAGGAAGGCGCCCCCCGGG + Intergenic
1059271120 9:113071156-113071178 CCGGGAGGAAGGCGCCCCCCGGG + Intergenic
1059272253 9:113076602-113076624 CCGGGAGGAAGGCGCCCCCCGGG + Intergenic
1059273388 9:113082044-113082066 CCGGGAGGAAGGCGCCCCCCGGG + Intergenic
1059274524 9:113087490-113087512 CCGGGAGGAAGGCGCCCCCCGGG + Intergenic
1060508313 9:124214737-124214759 CCCTGGGGGAGGGCCTCCCCTGG + Intergenic
1061389683 9:130310575-130310597 GTGTGTGGGAGGGGCTACCCAGG + Intronic
1061550337 9:131331023-131331045 CCGTGTGGCCTGCTCTCCCCAGG - Intergenic
1062076755 9:134593938-134593960 CTGTGTGGGAAGCGCTGGCCTGG + Intergenic
1062082746 9:134633033-134633055 CCCTGTGGGAGGCCCTGCACAGG + Intergenic
1062597218 9:137304802-137304824 CTGTCTGGGAGGCCCTGCCCTGG + Intergenic
1203748734 Un_GL000218v1:58869-58891 CGGGGTGGGAGGGGGTCCCCAGG + Intergenic
1196234316 X:113261454-113261476 CCCTCTGGGAGCCCCTCCCCAGG + Intergenic
1198794748 X:140383370-140383392 CCATATGGGAGGAGCTCCCAGGG - Intergenic
1201162091 Y:11173838-11173860 CGGGGTGGGAGGGGGTCCCCAGG + Intergenic