ID: 927906493

View in Genome Browser
Species Human (GRCh38)
Location 2:26862446-26862468
Sequence ATGATCTACTTGGGTCTATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 67}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927906493 Original CRISPR ATGATCTACTTGGGTCTATA GGG Intronic
910941358 1:92538747-92538769 ATGTTCGAGTTGGGTCTGTAAGG + Intronic
913656640 1:120966663-120966685 ATGGTCTAGTTAGGTCTCTAGGG + Intergenic
914521192 1:148417911-148417933 ATGGTCTAGTTAGGTCTCTAGGG + Intergenic
915037857 1:152943684-152943706 ATGATCTTCTTGGGGAAATAAGG - Intergenic
1063468981 10:6269196-6269218 ATAATCTGCTTGGGCATATAGGG - Intergenic
1064195853 10:13243589-13243611 ATGACTTCCTTGGGTCTATAGGG + Intergenic
1068743401 10:60501000-60501022 TTGATTAACTTGGGACTATAAGG - Intronic
1068974194 10:62990504-62990526 GTGATCTGCTTGATTCTATAGGG - Intergenic
1069167663 10:65183187-65183209 CTGATCTACTTCTGTCTCTATGG + Intergenic
1079923950 11:26468761-26468783 ATGACTAACTTGGCTCTATATGG + Intronic
1085401664 11:76239434-76239456 ATGATGTATTTGGGTATGTATGG + Intergenic
1086351599 11:85947432-85947454 CTGATCTACTTGAGGCTGTAGGG + Intergenic
1087385795 11:97466891-97466913 ATGATTTAGTAGAGTCTATAAGG + Intergenic
1088260875 11:107942893-107942915 ATAATGAACTTGGGTCTACAGGG - Intronic
1095906460 12:47383152-47383174 ATGATCTACTTGGTGCTGGATGG - Intergenic
1098552187 12:71775032-71775054 ATGATCTACTTGTATCCTTATGG - Intronic
1099330333 12:81276806-81276828 ATGAACTAGTTTGGTTTATAGGG + Intronic
1104323085 12:127770611-127770633 ATCATCTACTTGGGTCCAAATGG + Intergenic
1104548694 12:129735858-129735880 ATGATCTTTATAGGTCTATAAGG - Intronic
1110527179 13:76551970-76551992 ATTATTAACTTGAGTCTATAAGG + Intergenic
1111660530 13:91204513-91204535 ATGTTCAACTTGTGTCTATGTGG - Intergenic
1116410950 14:44622903-44622925 TTTACCTACTTGGGTCTACAGGG - Intergenic
1121436397 14:93923340-93923362 ATGAGCTCCTTGGGTCCCTAAGG + Intronic
1132993392 16:2809455-2809477 TTGAGCTTCTTGGGTCTAGATGG + Intergenic
1133613475 16:7454492-7454514 ATGATCAAGTTGAGTTTATAAGG + Intronic
1135888404 16:26334801-26334823 ATGATATACTTAGGTCTATTTGG + Intergenic
1143268749 17:5659962-5659984 TTGATCTACTTAGGTTTAAAGGG - Intergenic
1147799692 17:43075168-43075190 ATATTCTACTTGAGTCTAAATGG + Intronic
1159808893 18:72992399-72992421 ATAATTTACTTGTCTCTATAGGG - Intergenic
1165766565 19:38355034-38355056 ATGATGTACTTGGTTTTAAAGGG + Intronic
1168589803 19:57623904-57623926 ATGCTCACCTTGGGTCTAAAGGG + Intergenic
927231823 2:20831462-20831484 ATGGTTTACATGGGTCTAGAAGG + Intergenic
927906493 2:26862446-26862468 ATGATCTACTTGGGTCTATAGGG + Intronic
929501186 2:42493188-42493210 ATGATCTACTGGGGCCTGGAGGG - Exonic
931554762 2:63490244-63490266 ATGATGTACTTCAGTCTAAATGG - Intronic
933223878 2:79723158-79723180 ATGAACTACGCAGGTCTATAGGG - Intronic
939271563 2:139946206-139946228 ATGATTTAATTGGGCCTATCGGG + Intergenic
942438579 2:176007076-176007098 ATGTTCTACTTTGGCCCATATGG - Intergenic
945668534 2:212773196-212773218 TTGATTTACTTGTGTTTATATGG - Intergenic
946520869 2:220463545-220463567 AAGATCTACTTGAGTCTTGAGGG + Intergenic
1182176804 22:28298535-28298557 AGGATTTACTTGAGTCTAGAAGG - Intronic
949737330 3:7188612-7188634 AGGATCTACTTGAGTGTATAAGG + Intronic
950104682 3:10380562-10380584 ATGAGCTGCTTGGGTCTCAATGG + Intronic
957043511 3:75355813-75355835 CTGATCTACTTGGGCCTGTGTGG - Intergenic
958136550 3:89501872-89501894 ATGAACTACTTTGGGCAATATGG - Intergenic
964578776 3:158206560-158206582 ATGATGTGATTGGGTCTACATGG + Intronic
966267040 3:178058858-178058880 ATAATGTACTGGGGTCTATTCGG - Intergenic
967420502 3:189266987-189267009 ATGGTCTAGTTGTCTCTATAGGG + Intronic
970594231 4:17585251-17585273 ATGACCCACTTGGGTCCACATGG + Intronic
984130683 4:175871877-175871899 ATGATCTCCTTGGGAATATCTGG - Intronic
984481830 4:180313972-180313994 TTCATCTACTTGGGTCATTACGG + Intergenic
984616493 4:181904316-181904338 ATGATCTGCTTGGTTCTAAAAGG - Intergenic
985020897 4:185689239-185689261 ATGATCCACTTAAGTCTACAGGG + Intronic
988185996 5:27862881-27862903 TTGATCTGCTGGGGTCTAGATGG - Intergenic
988791520 5:34612682-34612704 ATGATCTATTTCACTCTATATGG - Intergenic
989247988 5:39275450-39275472 ATGAACTCCATGGGTCTATTGGG + Intergenic
992433711 5:76734676-76734698 ATGATCTACTTTGCTCTTGAGGG - Exonic
993321348 5:86471556-86471578 CTGATGTAGTTGGGTCTATTGGG - Intergenic
994337578 5:98586161-98586183 ATGTTTTACTTAGGTCTCTATGG - Intergenic
995170167 5:109100319-109100341 ATCATCTATTTGGATCTATTAGG - Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
1007389307 6:41541115-41541137 GTCATCTACTTGGGGCAATATGG + Intergenic
1022635067 7:32124269-32124291 ATAAACTACTTTGGTCAATATGG - Intronic
1022767359 7:33428567-33428589 ATGATTGACTTGGCTTTATAGGG + Intronic
1026395045 7:69943578-69943600 ATTATCTCCTAGGGTCTATCAGG + Intronic
1034461749 7:151201377-151201399 ATGATCTGCTTTGGTCTACAGGG + Intronic
1037382190 8:18297822-18297844 ATGATCTTTTTTGGTTTATATGG + Intergenic
1037483473 8:19326376-19326398 AAGATCCACTTGGGACAATATGG + Intronic
1038357559 8:26843545-26843567 ATGATCAACATGGCTCTATGAGG + Intronic
1045591076 8:103598855-103598877 ATGATCTGCTTCTGTCTATAAGG + Intronic
1052438975 9:28468287-28468309 ATGATCTACTTCGCTCTTTCTGG - Intronic
1053508166 9:38663722-38663744 ATGATCTGAATGGGCCTATATGG + Intergenic
1057670745 9:97086001-97086023 CTGAGCTTCTTGGGTCTATAAGG + Intergenic
1057930592 9:99189727-99189749 ATGATCTACTTGCTTCTTTGGGG + Intergenic
1059618364 9:115975865-115975887 AAGATCTGCTTGGGTCTGTCTGG - Intergenic
1189081603 X:37978800-37978822 ATGTTTTATTTGGGTCTTTAAGG + Intronic