ID: 927911631

View in Genome Browser
Species Human (GRCh38)
Location 2:26903933-26903955
Sequence TCTCTGGACCCTCACGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927911631_927911634 0 Left 927911631 2:26903933-26903955 CCTCTTCCGTGAGGGTCCAGAGA 0: 1
1: 0
2: 0
3: 7
4: 107
Right 927911634 2:26903956-26903978 CTCCCTCTTGTCTGTGCCAGAGG 0: 1
1: 0
2: 0
3: 19
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927911631 Original CRISPR TCTCTGGACCCTCACGGAAG AGG (reversed) Intronic
904049899 1:27632819-27632841 TCCCTGGTCCCTCAGGGGAGTGG + Intronic
910135917 1:83969529-83969551 TCTCTAGACCATCACTAAAGGGG + Intronic
914416349 1:147486836-147486858 TCTCTGGAACATCACGGTAAAGG + Intergenic
915913203 1:159926976-159926998 TCCCTGGACCCTTAAAGAAGAGG - Intergenic
918450059 1:184649373-184649395 TCTCTGGACCCTGGGAGAAGAGG + Intergenic
921464267 1:215467212-215467234 TCTCTGGACCCACACACAACTGG + Intergenic
1063123645 10:3122391-3122413 TCTGTGGACCCTGAAGGGAGAGG + Intronic
1063773332 10:9229806-9229828 TCTCTGCACACTCAAGGCAGTGG - Intergenic
1065338585 10:24680659-24680681 TCTATGGGCCTTCACAGAAGCGG + Intronic
1067408939 10:46047928-46047950 TCCTTGGACCCTCTCTGAAGAGG - Intergenic
1067474990 10:46558958-46558980 ACTCTGAACCCTGACAGAAGAGG + Intergenic
1067581690 10:47450465-47450487 GCTCTGGACCTTCATGGAACGGG - Intergenic
1068083316 10:52346680-52346702 TCCCTAGGCCCTCACGGCAGTGG - Intergenic
1068769802 10:60808423-60808445 ACTCTGGATCCTGACGGAAAGGG - Intergenic
1071466700 10:85947144-85947166 TCTCTGCCCCCACACAGAAGGGG + Intronic
1076312873 10:129520961-129520983 GCTCTGCACCCTCACCGTAGGGG - Intronic
1076734061 10:132450934-132450956 TTTCTGCACCCTCAAGGAGGGGG - Intergenic
1078019224 11:7641379-7641401 TCTCTGGACTCCCACTGAAGGGG + Intronic
1080740182 11:35056658-35056680 TCTCTGGAGATTCACGCAAGTGG - Intergenic
1084021993 11:66423225-66423247 TCTCTGGACACTCACACAGGCGG - Exonic
1087496796 11:98901554-98901576 TCTCTGGCACCTCAAGGAAGAGG - Intergenic
1089679469 11:120111244-120111266 TCTGGGGACCCTCAGGGAAATGG + Intergenic
1092105016 12:5915044-5915066 TCTCTGGACGCTCAAGGCTGGGG + Intronic
1098078134 12:66755688-66755710 TCTCTGGCCACTCACAGATGTGG + Intronic
1098199420 12:68039034-68039056 TCTCTGGTTCCTCCTGGAAGAGG + Intergenic
1102191872 12:110994855-110994877 TCTCTGCACACACAAGGAAGAGG - Intergenic
1104593711 12:130104912-130104934 TCACTCGACCACCACGGAAGTGG - Intergenic
1113111819 13:106831472-106831494 TCTCTGGACCCTCCCTGGGGGGG + Intergenic
1113342523 13:109440895-109440917 TCTCTGGAGCCTCAGGATAGAGG + Intergenic
1113927339 13:113949044-113949066 TCTCTGGCCCCTCCCAGGAGTGG - Intergenic
1114066248 14:19061957-19061979 TCTCTGGACCCCCTCTGCAGAGG + Intergenic
1114096020 14:19338067-19338089 TCTCTGGACCCCCTCTGCAGAGG - Intergenic
1119853471 14:77882588-77882610 CCTCAGGGCCCTCAGGGAAGGGG - Intronic
1119968730 14:78945818-78945840 TTTCTGGACCCTGCCTGAAGAGG + Intronic
1120870147 14:89329565-89329587 TCTCTGGCCCCTGCCGGACGCGG + Intronic
1122154794 14:99743511-99743533 TCTCAGGCCGCACACGGAAGGGG - Intronic
1128269333 15:66294250-66294272 TCTCTGGGCCCGCACTGGAGCGG + Intronic
1130180220 15:81619453-81619475 ACTCTCCACCCTCAAGGAAGAGG - Intergenic
1134339556 16:13332745-13332767 TCTCAGGAGCCTCACGTGAGAGG + Intergenic
1135407151 16:22206624-22206646 CCTCTGGACCCTCGCGGCCGTGG + Exonic
1135851911 16:25971545-25971567 TCTCTCTTCCCTCACTGAAGGGG - Intronic
1136025040 16:27463583-27463605 TCTGTGAACCCTGAGGGAAGAGG + Exonic
1136403373 16:30030307-30030329 TCTCTGGACCCTCAGCGGTGGGG - Intronic
1140116951 16:72050395-72050417 TCTGTGGGTCCTCAGGGAAGTGG - Intronic
1146317963 17:31823531-31823553 TCTCTGGATCCACAAGGAAATGG + Intergenic
1146573726 17:33974150-33974172 TCTCTGGAAGCTCTGGGAAGTGG + Intronic
1147240315 17:39086453-39086475 TCTCAGGACCTCCAAGGAAGAGG + Intronic
1148871130 17:50659279-50659301 CCTCTGGTCCCTAAAGGAAGAGG + Exonic
1148892196 17:50816380-50816402 TCTCTGGAGCAGCACGGAATGGG + Intergenic
1153251374 18:3125691-3125713 GCTCTGAACCCTCATGGCAGAGG + Intronic
1154453132 18:14495976-14495998 TCATTGGACACTCACAGAAGGGG - Intergenic
1156359572 18:36372568-36372590 TCTCTGGATCCCCACTTAAGTGG + Intronic
1157855046 18:51097851-51097873 CTTCTGGACCCTCAGGGAAAGGG + Intergenic
1157982339 18:52395898-52395920 TCTCTGGCCTCTCACAGAATAGG + Intronic
1161185390 19:2915274-2915296 TCTCTAGACCCTCCTGGTAGAGG + Intronic
1166503865 19:43359577-43359599 ACTCTGGACCCTCAGGGTCGGGG - Intronic
1166506589 19:43375181-43375203 ACTCTGGACCCTCAGGGTCGGGG + Intergenic
925993021 2:9269057-9269079 TCTCTGGCCCCTCACAGAAAAGG - Intronic
927911631 2:26903933-26903955 TCTCTGGACCCTCACGGAAGAGG - Intronic
928216305 2:29364288-29364310 TCTCTGTCCCCTCCTGGAAGGGG + Intronic
934620213 2:95799030-95799052 TCTCCTGGCCCTCAAGGAAGAGG + Intergenic
934640675 2:96025527-96025549 TCTCCTGGCCCTCAAGGAAGAGG - Exonic
934854558 2:97720918-97720940 TCTCTGGACACCCAGGGCAGAGG + Intronic
947614397 2:231545875-231545897 CTTCTGGCCCCTCACAGAAGAGG + Intergenic
1173764720 20:45597002-45597024 TCTCTGGACCCTGACAGAGAGGG - Intergenic
1174035950 20:47668365-47668387 TCTCTGGCTCTTCACAGAAGCGG + Intronic
1174586682 20:51614227-51614249 GCTCTGCACACTCACAGAAGTGG + Intronic
1176442899 21:6792273-6792295 TCATTGGACACTCACAGAAGGGG + Intergenic
1176821055 21:13657287-13657309 TCATTGGACACTCACAGAAGGGG + Intergenic
1180484726 22:15784548-15784570 TCTCTGGACCCCCTCTGCAGAGG + Intergenic
949234096 3:1787508-1787530 TCCCTGGAACCACATGGAAGAGG + Intergenic
949465055 3:4335468-4335490 ACTCTCCACCATCACGGAAGTGG + Intronic
953622556 3:44545816-44545838 TCGCTGGTCCCTGAGGGAAGAGG + Intergenic
960200862 3:114834671-114834693 TCCCTGAAGCCTCAGGGAAGAGG + Intronic
961829466 3:129616047-129616069 TCTGTGCACGCTCACAGAAGTGG + Intergenic
962271056 3:133978452-133978474 TATGTGGACCATCAAGGAAGGGG + Intronic
963017815 3:140842399-140842421 TCTCTGGGCCCTCAGTGAATTGG - Intergenic
964990640 3:162807122-162807144 TCTTTGGACTGTCACAGAAGGGG - Intergenic
968648227 4:1750272-1750294 CCTCTGGACCCTCAAAGAAAGGG + Intergenic
969615424 4:8249650-8249672 CATCTGGACCCTCAAGGAATGGG + Intergenic
969788406 4:9475115-9475137 TCTGTGGACCCCCATGGCAGGGG + Intergenic
973990842 4:56405513-56405535 TCCCTGGACCCCCAGGGAAGGGG + Intronic
975702145 4:77076305-77076327 TCTCTGGGCCCCCACTGAGGGGG + Intergenic
979905499 4:126285230-126285252 TTACTGTACCCTCAAGGAAGTGG + Intergenic
986712972 5:10501341-10501363 TCCAGGGACCCTCACAGAAGAGG - Intergenic
988215423 5:28266069-28266091 TCTCTGGCCTCTCACAGAAAAGG + Intergenic
988337968 5:29930630-29930652 CCTCTGGAGACTCACAGAAGAGG - Intergenic
995290196 5:110443183-110443205 TCTCTGGACCTTCCCAGGAGCGG - Intronic
997311485 5:132887781-132887803 TCTCTGGTCCATCAAGGAAGAGG - Intronic
1004443357 6:15674766-15674788 TCTCTGGACCCTCTATGGAGAGG + Intergenic
1004490019 6:16105730-16105752 TCTCTGGAGACTGAAGGAAGCGG + Intergenic
1005997884 6:30942618-30942640 TCTCCAGACCCTCAAGGTAGGGG - Intronic
1009240470 6:61179975-61179997 TCTCTGAACCCTGAGGGAGGTGG + Intergenic
1013191344 6:107806615-107806637 GCACTGGACCATCACAGAAGTGG + Intronic
1014901052 6:126966092-126966114 TTTCTGGAACCTCAAGGATGAGG - Intergenic
1019192705 6:170262451-170262473 TCTCTGCACTCACACGGGAGAGG + Intergenic
1020343181 7:7134725-7134747 TTTCTGGAACTTCAAGGAAGGGG - Intergenic
1021045556 7:15918686-15918708 ACTCTGGAGCCACATGGAAGAGG + Intergenic
1024239026 7:47419784-47419806 TCTCTGGCCCCACCCAGAAGTGG + Intronic
1038975200 8:32687645-32687667 TCTCATGATCCTCATGGAAGAGG - Intronic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1042436677 8:68773996-68774018 TTTCTGGGCGCTCACTGAAGAGG - Intronic
1047161973 8:122390819-122390841 TCTCTGGACCTTCACAGAAAAGG - Intergenic
1047511698 8:125520674-125520696 ACTCTGGCCCCAAACGGAAGTGG - Intergenic
1048464554 8:134654754-134654776 TCACTGGACACACACGGAAGGGG + Intronic
1049264116 8:141657727-141657749 TCTCTGTCTCCTCAAGGAAGTGG + Intergenic
1056254065 9:84780359-84780381 TCTCTGGCCCTTCACAGAAAAGG + Intronic
1057638502 9:96795000-96795022 TCTGTGGACATTCACAGAAGTGG + Intergenic
1060199620 9:121645072-121645094 TGTCTGGGCCCTTACTGAAGGGG + Intronic
1062415640 9:136448246-136448268 ACTCTGGGGCCTCACAGAAGTGG - Intronic
1203526304 Un_GL000213v1:92258-92280 TCATTGGACACTCACAGAAGGGG - Intergenic
1193863709 X:86702835-86702857 TCACTGGACCTTCAAAGAAGTGG + Intronic
1195595523 X:106683882-106683904 TCTCTGGACCCTCCCAGGATTGG + Intergenic
1202350510 Y:23985402-23985424 TCTCTCCACCCTCACTGAAAGGG - Intergenic
1202520269 Y:25684719-25684741 TCTCTCCACCCTCACTGAAAGGG + Intergenic