ID: 927922503

View in Genome Browser
Species Human (GRCh38)
Location 2:26983943-26983965
Sequence CCCGTCCCTTCCCCTTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927922490_927922503 18 Left 927922490 2:26983902-26983924 CCTTTGACTCCAGGTGTCCCTGG 0: 1
1: 0
2: 1
3: 35
4: 289
Right 927922503 2:26983943-26983965 CCCGTCCCTTCCCCTTGTTGGGG 0: 1
1: 0
2: 0
3: 13
4: 166
927922495_927922503 0 Left 927922495 2:26983920-26983942 CCTGGGTAGCAGCTGCCCCTCAC 0: 1
1: 0
2: 2
3: 28
4: 258
Right 927922503 2:26983943-26983965 CCCGTCCCTTCCCCTTGTTGGGG 0: 1
1: 0
2: 0
3: 13
4: 166
927922494_927922503 1 Left 927922494 2:26983919-26983941 CCCTGGGTAGCAGCTGCCCCTCA 0: 1
1: 0
2: 1
3: 26
4: 215
Right 927922503 2:26983943-26983965 CCCGTCCCTTCCCCTTGTTGGGG 0: 1
1: 0
2: 0
3: 13
4: 166
927922493_927922503 9 Left 927922493 2:26983911-26983933 CCAGGTGTCCCTGGGTAGCAGCT 0: 1
1: 0
2: 2
3: 27
4: 242
Right 927922503 2:26983943-26983965 CCCGTCCCTTCCCCTTGTTGGGG 0: 1
1: 0
2: 0
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927922503 Original CRISPR CCCGTCCCTTCCCCTTGTTG GGG Intronic
901969041 1:12892959-12892981 CCCGTCCCTTGCCCTAACTGTGG - Exonic
901977011 1:12953132-12953154 CCCGTCCCCTGCCCTTCCTGTGG - Intronic
902008158 1:13248638-13248660 CCCGTCCCCTGCCCTTCCTGTGG + Intergenic
902016130 1:13308822-13308844 CCCGTCCCTTGCCCTACCTGTGG + Intronic
902023965 1:13369125-13369147 CCCGTCTCCTGCCCTTGCTGTGG - Exonic
902520669 1:17013950-17013972 CTCGTCCCTTCTCCTTAATGAGG + Intergenic
903500511 1:23797784-23797806 CCAGTACCTGCCCCTTGATGAGG - Exonic
906376934 1:45303716-45303738 CCCGCCCCTTTCCCTTCCTGTGG - Intronic
910537762 1:88318833-88318855 CTTGTCACTTACCCTTGTTGCGG - Intergenic
911136330 1:94445039-94445061 CCAGACCCATCCCCTTGTTTTGG + Intronic
912262223 1:108121640-108121662 CCAGTCCCCTCCCCTTCCTGAGG - Intergenic
913155352 1:116092025-116092047 CCTCTCCCTTCCCCTAGGTGTGG + Intergenic
914945285 1:152060136-152060158 TCTCTCCCTTTCCCTTGTTGAGG + Intergenic
915902051 1:159854561-159854583 CCCGCCCCTTCCCACTTTTGGGG + Exonic
920785609 1:209038314-209038336 CCTGTCCCTACCCCTTAATGTGG - Intergenic
922160651 1:223077417-223077439 CACGCCCCCTCCCCTTCTTGTGG + Intergenic
923665131 1:235992644-235992666 ACCGTCCTTTCCGCTTCTTGGGG + Intronic
1063386358 10:5618757-5618779 CCCGAGCCTTGCCCTTTTTGGGG - Intergenic
1066326063 10:34359742-34359764 CCCCTCCCCTCCCCTGTTTGTGG - Intronic
1067945817 10:50687311-50687333 CCCGTCCCTTCTGCTCGATGTGG + Intergenic
1069917953 10:71798724-71798746 TCTGTCCCTTCCCCTGGTTTGGG - Intronic
1070867333 10:79714184-79714206 CCCGTCCCTTCTGCTCGATGTGG + Intronic
1070881125 10:79852308-79852330 CCCGTCCCTTCTGCTCGATGTGG + Intergenic
1071634248 10:87236407-87236429 CCCGTCCCTTCTGCTCGATGTGG + Intronic
1071647698 10:87368624-87368646 CCCGTCCCTTCTGCTCGATGTGG + Intronic
1075558088 10:123447731-123447753 CTCCTCCCTCCTCCTTGTTGGGG - Intergenic
1076145424 10:128115444-128115466 CTCTTCCCTTCCCCTTGTTCTGG + Exonic
1076565553 10:131396428-131396450 GCCTTCTCTTCCCCTTGTAGAGG - Intergenic
1076730099 10:132434166-132434188 CCCGTCCCTGCCACTGGGTGAGG - Intergenic
1077391383 11:2302102-2302124 CCCCTCCCTTCCCCTCCCTGTGG - Exonic
1077601958 11:3580632-3580654 CCCGCCCCTTCCCCTGCTAGGGG + Intergenic
1081571077 11:44291285-44291307 CCCCTCCCCTGCCCTTGGTGAGG - Intronic
1081704462 11:45173019-45173041 CCCTTCCCTTCCCTTTGATTTGG + Intronic
1081995234 11:47359583-47359605 CCCATCCCAACGCCTTGTTGTGG - Intronic
1084071667 11:66740536-66740558 CTCATCCCTTCACCTTCTTGAGG - Intergenic
1084257867 11:67955178-67955200 CCCGCCCCTTCCCCTGCTAGGGG + Intergenic
1086969333 11:93064166-93064188 TCCCTCCCCTCCCCTTTTTGAGG - Intergenic
1087623705 11:100571508-100571530 CCCCTCCCATCCCCTTTCTGAGG + Intergenic
1089082638 11:115789713-115789735 CCTGTCCCTTCCCCATCCTGGGG - Intergenic
1090406261 11:126477347-126477369 CCCGTCCCTTTCCCTGTGTGTGG + Intronic
1092428103 12:8389975-8389997 CCCGGCCCTTCCCCTGCTAGGGG + Intergenic
1093711838 12:22336191-22336213 CCCTTCCCTTCCCCTTTTCCAGG - Intronic
1094265569 12:28555371-28555393 CCCACCCCTTCCCCTTGTATTGG - Intronic
1096674727 12:53220267-53220289 CCAGTCCCTTTCCCCTGCTGGGG - Intronic
1101219696 12:102625774-102625796 CCCCTCCCTTCCCTTTTTTGAGG + Intergenic
1102277935 12:111598041-111598063 CCCTTCCCTTCCCCAGGTGGGGG + Intronic
1102504375 12:113374457-113374479 CCCGCCCCCTCCCCTAGGTGCGG + Exonic
1103427962 12:120854986-120855008 CCCTTCCCTGCCCCTTGTGGAGG - Intronic
1108306543 13:49141412-49141434 CCCTTCCCTTTACCTTTTTGTGG + Intronic
1112199585 13:97261902-97261924 CCTGTCCTTCCCCCTTCTTGAGG + Intronic
1113863816 13:113508540-113508562 ACCGACCCTTCCCCTCCTTGTGG + Intronic
1115985886 14:39103232-39103254 CCCGTCCCCTCCTCTTGACGTGG - Exonic
1118994126 14:70821870-70821892 CCCGCCCGGTCCCCGTGTTGGGG - Intergenic
1119131071 14:72173751-72173773 CCCGTCCCCTCCTCTCCTTGGGG + Intronic
1119139737 14:72255335-72255357 CCAGTCAGTTCCCCTTCTTGAGG - Intronic
1119998345 14:79277688-79277710 ACCACCCCTTCCCCTTGCTGTGG + Intronic
1122626238 14:103086782-103086804 CCCAGCCATTCTCCTTGTTGGGG + Intergenic
1122629140 14:103099397-103099419 CCCCTCCATTCCCTGTGTTGGGG + Intergenic
1122761971 14:104035426-104035448 CCCGTCAGTCCCCCTTCTTGTGG + Intronic
1125695579 15:41634593-41634615 CCCTTTCCTTCCCCTTACTGAGG + Intronic
1128099820 15:64989681-64989703 CACGTCCCTTCCCCTCCTTCAGG + Exonic
1129193844 15:73952852-73952874 CCCGTCCCCTGCCCTGGCTGTGG + Intergenic
1131091385 15:89627251-89627273 CCTGGCCCTGCCCCTTGTTGGGG + Exonic
1133370134 16:5240395-5240417 CCCGCCCCTTCCCCTGCTGGGGG - Intergenic
1135348135 16:21706636-21706658 CCCTTCCATTCCACTTTTTGTGG + Intronic
1135508429 16:23059629-23059651 CCTGTGCCTTCCCTTTGTTTAGG - Intergenic
1138379610 16:56590764-56590786 CCCTTCCCTCCCCTTTGATGGGG + Intronic
1139329026 16:66173327-66173349 CCCAGCCCTTGCCCTTGTGGAGG + Intergenic
1141606283 16:85155441-85155463 CCTGCTCCTTCCCCTTCTTGGGG - Intergenic
1141702006 16:85646884-85646906 CCCCACCCCCCCCCTTGTTGTGG - Intronic
1142586503 17:978213-978235 CCAGCCCCTTTCCCTTTTTGAGG - Intronic
1146341155 17:32020911-32020933 CCCCTCCCCTCCCCTTAGTGAGG - Intronic
1146548635 17:33761395-33761417 CCCATCCCATCCCTGTGTTGAGG - Intronic
1146946978 17:36880126-36880148 CCCAGGCCTTCCCCTTGGTGAGG - Intergenic
1147922668 17:43927567-43927589 CCCCTCCCCTCCCCTTAGTGAGG + Intergenic
1149402615 17:56313443-56313465 CCTGTTCCTTCCCCTTACTGTGG - Intronic
1151539458 17:74757796-74757818 CCCCTTCCATCCTCTTGTTGGGG + Intronic
1151547493 17:74802060-74802082 CCTGTCCCTTCACCTTGCTGAGG + Intronic
1151550882 17:74821908-74821930 CCCGTCCCTTCCCCTCATCCAGG + Intronic
1151652508 17:75478807-75478829 GGCCTCCCTTCCCCTTGGTGTGG + Intronic
1152257382 17:79248096-79248118 CCCGCCCCTTCGCCCTGTTTGGG - Intronic
1157049753 18:44149008-44149030 CCCTTCTCTTCCCCTTGGTTGGG - Intergenic
1159350666 18:67268844-67268866 CACCTCCCTTCCCCTTCCTGAGG + Intergenic
1160774828 19:850652-850674 CCCTTCCCCTCCCCTTGTCCTGG + Intergenic
1162532842 19:11245763-11245785 CCCCTTCCTTCTCCTTGTTGGGG - Intronic
1162566905 19:11449460-11449482 CCCGCCGCCTCCCCTTGCTGGGG - Intronic
1163626272 19:18391752-18391774 ACCGTCCTGTCCCCTTGTTGGGG + Exonic
1164676983 19:30107507-30107529 CCCCTTCCTTCCCCTTGCTGGGG - Intergenic
1166669971 19:44703931-44703953 TCCGGCCATGCCCCTTGTTGGGG + Intronic
1166722033 19:45002155-45002177 CCCGCCCCTTCCCCTTCTTTCGG - Intronic
1166930468 19:46298543-46298565 CCCTTCCCTTCCTCTAGCTGGGG + Intronic
1167295413 19:48646434-48646456 GCCCCCCCTTCCCCTTGCTGCGG - Intergenic
1168126230 19:54285179-54285201 CTCACCCCTTCCCCGTGTTGGGG - Intergenic
927612673 2:24557546-24557568 CCCCTCCCTTCCCCCTTTTTTGG + Intronic
927922503 2:26983943-26983965 CCCGTCCCTTCCCCTTGTTGGGG + Intronic
931200314 2:60091443-60091465 CCTGCCCCTTCCCCTTGCAGAGG + Intergenic
931404209 2:61960767-61960789 CCCGTGCCTTTCCCTTCTGGAGG + Intronic
934759270 2:96844541-96844563 CCCTTCCCTTCCCTGTGCTGTGG + Intronic
935190846 2:100777684-100777706 CCCTTCCCTGGCCCCTGTTGCGG - Intergenic
937095753 2:119234243-119234265 CCCCACCCCTCCCCTTGTTATGG - Intronic
938977292 2:136492146-136492168 CCTCTCCCTTCCCATTGATGGGG - Intergenic
945004783 2:205392954-205392976 CCCATCCCAACCCCTTTTTGGGG - Intronic
946145007 2:217724059-217724081 TCCTTCCATTCCCCTTGCTGGGG - Intronic
1169378377 20:5085779-5085801 CCCGTCCCCTACCCTAGCTGGGG - Intronic
1173054084 20:39594582-39594604 GCCATCCCTTCCCCTTGGTGTGG - Intergenic
1174581722 20:51576941-51576963 CCCACCCCTTCCCCTTCTTCTGG + Intergenic
1175878162 20:62240206-62240228 CAGTTACCTTCCCCTTGTTGAGG + Intronic
1181936980 22:26446003-26446025 CTCTTCCCTTCCGCTTGTTGTGG - Intronic
1182475262 22:30573681-30573703 CCCTTTCCTTCCCCCTGGTGTGG + Intronic
1183467123 22:37985378-37985400 CAAGTCCCCACCCCTTGTTGGGG - Intronic
1184583975 22:45435358-45435380 TCCTGCCTTTCCCCTTGTTGTGG - Intergenic
949549003 3:5096808-5096830 CCCCACCCTTCTCATTGTTGGGG - Intergenic
949987424 3:9552226-9552248 CCCGTCCCTGGCGCTTGTTCTGG + Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950424828 3:12919456-12919478 CCCTCCCCTTCCCCTGGTGGCGG - Intronic
953016316 3:39080199-39080221 CCCCTCCCTCCCCCTAGGTGTGG + Intronic
953821922 3:46214358-46214380 CCCATCCCTTCCGCTTGTGCAGG + Intronic
954637423 3:52078836-52078858 CCCCTTCCTTCCCCTTGTAGAGG - Intronic
954659426 3:52219047-52219069 CCTGTCCCTGCCCCTGATTGTGG + Intergenic
955231446 3:57102431-57102453 CCCTGGCCTGCCCCTTGTTGTGG + Intronic
957072796 3:75579666-75579688 CCCGCCCCTTCCCCTGCTGGGGG + Intergenic
961509623 3:127392890-127392912 TCTGCCCCTTCCCCATGTTGGGG - Intergenic
961873099 3:130002494-130002516 CCCGCCCCTTCCCCTGCTGGGGG + Intergenic
962422401 3:135240077-135240099 CCTGACCCTTCCCTGTGTTGGGG + Intronic
963530937 3:146472561-146472583 CTCGTCCCTTCCACTTTGTGAGG - Intronic
967399881 3:189049140-189049162 TCCCACCCTTCCCCTAGTTGTGG - Intronic
969016408 4:4106976-4106998 CCCGCCCCTTCCCCTGCTGGGGG + Intergenic
969737547 4:9001348-9001370 CCCGCCCCTTCCCCTGCTGGGGG - Intergenic
971055933 4:22912423-22912445 CCCCTCCCTTTCCATTTTTGAGG + Intergenic
974926305 4:68302964-68302986 CCTGTCCCTCCACCTTGTTTAGG - Intergenic
979758894 4:124374739-124374761 CTCACCCCTTCCCCATGTTGGGG + Intergenic
991352515 5:65733590-65733612 CCCGTCCCCTGCCCTTCCTGTGG + Intronic
993238483 5:85346927-85346949 CCCTTCCCTTCACCTCATTGTGG - Intergenic
993916648 5:93751917-93751939 CCCTTCACTTCCCTTTGATGTGG - Intronic
996281029 5:121729156-121729178 CCCTTCCATTTCCCTGGTTGGGG - Intergenic
999649559 5:153752001-153752023 CCCGCCCCTTCCCATTTCTGTGG + Intronic
1001568056 5:172713261-172713283 CCGGCCCCTTCCCCTTGCTGGGG - Intergenic
1001926286 5:175639604-175639626 CTGCTCCCTGCCCCTTGTTGGGG - Intergenic
1007455586 6:41974720-41974742 CCCGCCCCATCCCCCTTTTGGGG - Intronic
1007783830 6:44269131-44269153 GATGTTCCTTCCCCTTGTTGGGG - Intergenic
1008622296 6:53282440-53282462 CCCTTCCCCTCCCCTGGGTGTGG + Intronic
1010282712 6:74039250-74039272 CCCATAACTTCCACTTGTTGTGG + Intergenic
1010731053 6:79391709-79391731 TCTGTCCCTTCACATTGTTGTGG - Intergenic
1013760276 6:113510276-113510298 CCGGTCCCTTCCTCCTGTTCTGG + Intergenic
1014843679 6:126249998-126250020 TCCCTCCCTTCCACTTGTAGGGG - Intergenic
1017204530 6:151790450-151790472 CCTGTCTCTTCCACCTGTTGTGG + Intronic
1018674449 6:166206827-166206849 CCCATCACTCCCACTTGTTGTGG + Intergenic
1019266341 7:119402-119424 CCCCTTCCTTCCCCTTGTCCAGG - Intergenic
1019534497 7:1521726-1521748 CCCGTAATTTCCCCATGTTGTGG - Intergenic
1021759213 7:23886973-23886995 CCCCTCCCTTCTCCTTGTATAGG + Intergenic
1022574451 7:31483941-31483963 CCCCCCTCTTCCCCTTGCTGTGG - Intergenic
1028492193 7:91424709-91424731 GCTGTCCCTCCACCTTGTTGTGG - Intergenic
1029151862 7:98485884-98485906 CCATTCCCTTCCCCTAGTTAGGG - Intergenic
1029694186 7:102202236-102202258 CCCATCTCTTCTCCTTGCTGAGG + Intronic
1030258626 7:107539967-107539989 CCCTTGCCTTCCCTTTGCTGTGG - Intronic
1032086824 7:128888825-128888847 CCCTTCCATTCCCCCTGCTGGGG - Intronic
1035262723 7:157671940-157671962 CCCCACCCGTCCCCTTCTTGGGG - Intronic
1036830090 8:12014536-12014558 CCCGCCCCTTCCCCTGCTAGGGG + Intronic
1036899174 8:12658829-12658851 CCCGCCCCTTCCCCTGCTGGGGG + Intergenic
1037498690 8:19464770-19464792 CCACCACCTTCCCCTTGTTGTGG + Intronic
1037759255 8:21731002-21731024 TCCTTCCCTTCCTCGTGTTGCGG + Intronic
1040055819 8:43056284-43056306 CCCCTCCCTTCCCCCTCTCGAGG - Exonic
1047187500 8:122647166-122647188 CCCTTCCCTTCCCTTTGCAGGGG - Intergenic
1049019276 8:139942873-139942895 TCCCTCCCTTTCCCTTGCTGTGG - Intronic
1049230491 8:141479045-141479067 CCCTTGCCTTCCCCTCCTTGTGG + Intergenic
1053233773 9:36434231-36434253 CCCCTCCCTTCCCCTTTCTCAGG - Intronic
1053594270 9:39544002-39544024 ACCCTCCCTCCCCATTGTTGTGG - Intergenic
1053852051 9:42299047-42299069 ACCCTCCCTCCCCATTGTTGTGG - Intergenic
1054571983 9:66820956-66820978 ACCCTCCCTCCCCATTGTTGTGG + Intergenic
1054845422 9:69791403-69791425 CCCATCCTTTCTCCATGTTGAGG - Intergenic
1058479195 9:105373548-105373570 CCCCTCCCTCTCCCTTGTTCAGG - Intronic
1059503279 9:114775153-114775175 CCCCACCCCTCCCCTTGGTGGGG + Intergenic
1061393423 9:130330352-130330374 CCCCTCCATTCCCCTTGTCCAGG + Intronic
1062725050 9:138068136-138068158 CCTGTCCCTGGCCTTTGTTGTGG - Intronic
1188468839 X:30514132-30514154 AGCATCCCTTCCCCTTATTGAGG - Intergenic
1188487602 X:30700479-30700501 CCCCACCCTTCCCCATGTTATGG + Intronic
1188780649 X:34279899-34279921 CCTGTCCCTTCCCTGTGTTTTGG + Intergenic
1190814748 X:53920037-53920059 ACCGTGCCTGGCCCTTGTTGAGG + Intergenic
1195295427 X:103471927-103471949 CCAGTCCCTAACCCTTGGTGGGG + Intergenic
1196367996 X:114944599-114944621 CCTTTCTCTTGCCCTTGTTGGGG - Intergenic