ID: 927922544

View in Genome Browser
Species Human (GRCh38)
Location 2:26984507-26984529
Sequence CTCAGACAGCAGTGGCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927922544 Original CRISPR CTCAGACAGCAGTGGCACCA GGG Intronic
901336674 1:8455112-8455134 CTCAGACAGCAGAGCCAGGAGGG + Intronic
901780734 1:11593048-11593070 CTCAGACAGGTGAGGCACCCAGG - Intergenic
902849225 1:19140716-19140738 CTCTCACAGCAGTGGAAACAAGG + Intronic
904323231 1:29710111-29710133 CTCAGACAGCAGGAGGGCCATGG - Intergenic
904498719 1:30902124-30902146 CTCAGCCAGCTGGGGCAACAGGG + Intronic
904524547 1:31122924-31122946 CACACACAGCACTGGCTCCAGGG - Intergenic
905167793 1:36093236-36093258 CACAGACACCATTGCCACCATGG + Exonic
906201100 1:43960931-43960953 CTCACACAGCTGTGGCACCATGG - Exonic
906274839 1:44507900-44507922 CACAGCCAGCAGTGGCTCAAAGG - Intronic
907832306 1:58076763-58076785 CTCAAAAGGCAGTGACACCAAGG + Intronic
909719450 1:78750599-78750621 CTCAGATAGCAGCCGCCCCATGG + Intergenic
910778561 1:90901466-90901488 CCCAGAAAGAAGTGCCACCAAGG + Intergenic
911226891 1:95316650-95316672 CTCAGATAGAGGTGGCAGCAGGG - Intergenic
911943247 1:104073557-104073579 CAGAGGCGGCAGTGGCACCAGGG + Intergenic
914442368 1:147718657-147718679 TCCAGACAGCAGTAGCACCCTGG - Intergenic
915612720 1:157007430-157007452 CTCAGGCAGTACTGGCAGCAGGG + Intronic
918494193 1:185115161-185115183 CACAGACAGCGGCGCCACCAGGG - Intergenic
918725282 1:187913629-187913651 CTAAGACATCATTGGCATCAAGG + Intergenic
919802159 1:201360573-201360595 CTCAGGCTGCAGTGGCTACAGGG - Intronic
920966119 1:210702234-210702256 CTCAGATTGCAGGGCCACCAAGG - Intronic
922591806 1:226783094-226783116 CTCACACCACAGTTGCACCAGGG - Intergenic
922593954 1:226799334-226799356 CTCAGACAGAAGAGGCTCCCAGG - Intergenic
923762837 1:236862859-236862881 CTCAGACAGCTTTGGCCCCTAGG + Intronic
924441466 1:244088813-244088835 TTCATACAGCAGTGGCAACAGGG + Intergenic
1063421699 10:5917321-5917343 CCCATACAGCAGTGGAGCCAGGG - Intronic
1065861869 10:29878579-29878601 CCCAAACAGCACTGCCACCAAGG + Intergenic
1067427269 10:46219831-46219853 CTCAGACATCAGTGGCTCAGGGG - Intergenic
1067541591 10:47158939-47158961 CTCAGAAGAGAGTGGCACCATGG + Intergenic
1067582700 10:47455716-47455738 CTCAGACATCAGTGGCGCAGGGG - Intergenic
1068903547 10:62297635-62297657 CTCGGAAAGCAGGGGCCCCATGG + Intergenic
1070251648 10:74778627-74778649 CACAGACAATAGTGGCTCCAAGG - Intergenic
1070563967 10:77589862-77589884 CGCAGCCAGCAGTGGCAACCCGG - Intronic
1071214188 10:83379489-83379511 CTTAAAGAGCAGTTGCACCAGGG + Intergenic
1073560628 10:104493481-104493503 CTAGGACAGCAGTAGCAGCAGGG + Intergenic
1074135903 10:110626162-110626184 CTCAGGCAGCAGTGGTGTCAAGG - Intergenic
1074308094 10:112297668-112297690 CTTAGGCAGCTGTGGCAGCAGGG + Intronic
1074817396 10:117152839-117152861 TTCTGACAGACGTGGCACCAAGG + Intergenic
1075122967 10:119677841-119677863 CTTTGAAAGCAGTGGCATCATGG + Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075567651 10:123516177-123516199 CTCAGAGAGCAAAGCCACCAAGG - Intergenic
1077192574 11:1261587-1261609 CTCAGACAGCAGTGGCCTCCTGG - Exonic
1077383323 11:2257497-2257519 CTCAGGCAGCAGTGGCCCGGTGG + Intergenic
1077409606 11:2397414-2397436 CTCAGACACCACTGGCACTGAGG - Exonic
1078002987 11:7512993-7513015 CTCAGATGGCAGCGACACCAGGG - Intergenic
1078517286 11:12033640-12033662 TTGAGACAGCGGTGGCAGCATGG - Intergenic
1078760990 11:14251722-14251744 AGCAGACAGCACTGGCACCTGGG - Intronic
1079368116 11:19827089-19827111 CTCAGGCAGCAGAGGCACCTGGG + Intronic
1079420654 11:20284440-20284462 CCAAGACAGCAGTGACACAATGG + Intergenic
1081869986 11:46379062-46379084 CGCAGTCAGCACTGGCAGCAAGG + Exonic
1083900317 11:65640436-65640458 CCCAGACACCAGTGGCCCCTGGG + Intronic
1084319701 11:68366432-68366454 CTCAGACAGCAGTGAGAGCAAGG - Intronic
1085085370 11:73663059-73663081 CTCAGACAACAGAGACTCCAAGG - Intergenic
1085296379 11:75434026-75434048 CACAGACAGCAGAGGTCCCAAGG + Intergenic
1085695561 11:78701728-78701750 CACAGACAACAATGGCAACATGG - Exonic
1090386216 11:126358851-126358873 CTGGGCCAGCAGTGGCACCCAGG - Intronic
1091206251 11:133823298-133823320 CTCACAAAGCAGAGGCCCCAGGG + Intergenic
1095088702 12:38085066-38085088 CTCAGTCTGCAGAGGGACCAGGG - Intergenic
1096408479 12:51360635-51360657 CTCAGGCAGAGGTGGCATCAGGG - Intronic
1102455282 12:113067025-113067047 CACAGACAGCAGTGGCAGGCCGG + Intronic
1102911042 12:116714370-116714392 CTCAGTCGGCACTGGCCCCAAGG - Exonic
1103053127 12:117798161-117798183 CTAAGAAAGCAAAGGCACCAGGG + Intronic
1103611362 12:122126178-122126200 CCAAGACAGCTGTGCCACCAGGG + Intronic
1105628394 13:22136682-22136704 CTCACACAGCAGTCACAGCAAGG + Intergenic
1107787577 13:43970913-43970935 CGCAGTCAGCACTGGCAGCAAGG + Intergenic
1109445475 13:62433212-62433234 CATAGATAGCAGTGGTACCAAGG - Intergenic
1113886040 13:113658775-113658797 CCCAGAGGGCAGTGGCACCGAGG + Intergenic
1113957558 13:114107470-114107492 CTCAGACAGGACAGGCACCTGGG - Intronic
1114209575 14:20603545-20603567 CCCAGGCAGCAGTAGCACCCCGG - Intronic
1114693905 14:24609114-24609136 CTCTGAGATCAGTTGCACCATGG + Intronic
1116761593 14:49021969-49021991 CCAAGACAGCAATGGCAGCATGG + Intergenic
1119832772 14:77718126-77718148 CTCAGATAGCAGCCGCCCCAAGG - Exonic
1121195438 14:92067787-92067809 CTGACACAGCACTGGCAACAGGG + Intronic
1121435205 14:93914730-93914752 ATCTGACAGCAGTGGGGCCATGG + Intergenic
1121439094 14:93937524-93937546 CTCAGAGAGCTGTGCCACCTGGG - Intronic
1121535166 14:94686157-94686179 CTGGGACAGCAGTGCCTCCAGGG + Intergenic
1122534905 14:102455316-102455338 ATCAGACAGCAGTGGGTGCAAGG + Intronic
1122827899 14:104380253-104380275 CTCACACAGCAGGGGCATGATGG + Intergenic
1123007929 14:105333364-105333386 CTAACACAGCAGTGGCGCCATGG - Intronic
1124042000 15:26114179-26114201 CGCAGACAGCAGCGGCAACCCGG - Intergenic
1124412304 15:29446550-29446572 CTCGGTCCCCAGTGGCACCATGG + Intronic
1129312280 15:74721168-74721190 AACAGACAGCAGTGGCTCCATGG + Intronic
1129515919 15:76157501-76157523 CTCAGACAGCCATGTCACTATGG - Intronic
1130660645 15:85829259-85829281 CTCTGACATCAGTAGCACAAAGG + Intergenic
1132466593 16:80226-80248 CTCACACAGCCGTGGCATCTTGG + Intronic
1132685957 16:1162214-1162236 CTCAGACAGCAATGGCCTCTTGG - Intronic
1132826835 16:1909397-1909419 CAGAGACTGCAGTGGCAACATGG - Intergenic
1134053975 16:11157596-11157618 TTCAGATAGCAGTGACTCCAAGG - Intronic
1137053941 16:35734641-35734663 CTCAGGCTGCTGTGGCACCAGGG - Intergenic
1137057360 16:35752079-35752101 CTCAGGCTGCTATGGCACCAGGG - Intergenic
1137057616 16:35753067-35753089 CTCAGGCTGCTATGGCACCAGGG - Intergenic
1141030482 16:80583575-80583597 CAAACACAGCAGTGGCACAATGG + Intergenic
1142055771 16:87994985-87995007 CTCAGGCATCAGAGGCACCCAGG - Intronic
1142212756 16:88816267-88816289 CCCAGGCTGCAGTGGCTCCACGG - Intronic
1142402983 16:89870724-89870746 CTCAGGCAGCAGAGGCATCTGGG + Exonic
1142494509 17:299248-299270 CTCAGACAGCAGCGGCATTCGGG - Intronic
1143433918 17:6908700-6908722 CAGCAACAGCAGTGGCACCATGG + Intronic
1148331642 17:46817287-46817309 GTCAGAAAGAAGTGCCACCACGG - Intronic
1149916536 17:60614555-60614577 CTCAGCCAACATTGGCAACACGG + Intronic
1150533728 17:66013806-66013828 CAGTGGCAGCAGTGGCACCATGG + Intronic
1152412337 17:80133846-80133868 CTCGGCCAGCAGTGCCACCTGGG + Intergenic
1152499015 17:80695785-80695807 CTCAGGATGCAGAGGCACCAAGG + Intronic
1152894866 17:82905277-82905299 CTCAGACAGGAGAGGGAGCATGG - Intronic
1153667526 18:7379493-7379515 CTCAGAGACCAGGGGTACCAGGG - Intergenic
1157250243 18:46089137-46089159 CTCAGAGACCAGTGGCGGCATGG + Intronic
1157313069 18:46566612-46566634 ATCAGCCAGCTGGGGCACCAGGG + Intronic
1157743602 18:50115298-50115320 CTCAGACAGCAGTGAGCCCTTGG + Intronic
1159081479 18:63740463-63740485 CTCAGAGAGAAAAGGCACCATGG - Intergenic
1159517590 18:69477146-69477168 TTCAAACAGCATTGTCACCATGG - Intronic
1160159126 18:76458032-76458054 CTCACACATCAGGCGCACCATGG + Intronic
1160521630 18:79511446-79511468 CACAGACAGCAGTGACTCCACGG + Intronic
1161609137 19:5231350-5231372 CTCACACAGAGGTGGGACCAGGG - Exonic
1161611641 19:5246471-5246493 TGCAGACAGCAGTGGCTTCAGGG + Intronic
1162172646 19:8803543-8803565 CACAGACAGAAGGGGCAGCAAGG + Intergenic
1163042117 19:14610306-14610328 CTCAAACAGGATTGGCACCCTGG + Exonic
1163212641 19:15852460-15852482 CTCAGATAGGAGTAGCAACAAGG + Intergenic
1165529545 19:36386551-36386573 CTCAGACAGCCTTGCCCCCATGG - Intronic
1165633521 19:37321518-37321540 CTCAGAGACCAGTGCCAGCATGG + Intronic
1166306110 19:41937939-41937961 CGCAGACAGCATTGTCATCAGGG - Intergenic
1167704577 19:51071963-51071985 TTCACACAGGAGTGGGACCAAGG - Intergenic
1168176602 19:54631750-54631772 CTCAGAGAGCAGTGACCCCCTGG + Exonic
1168527756 19:57102395-57102417 CTCACACAGCTGTGTCTCCATGG - Intergenic
1168614167 19:57824431-57824453 CTCAGAGACCAGTGCCATCAGGG + Intronic
925019487 2:557492-557514 CTCGGAAAGCAATGGCATCAGGG + Intergenic
927408677 2:22800631-22800653 CACAGACAGCAGTGGGAGGAAGG + Intergenic
927922544 2:26984507-26984529 CTCAGACAGCAGTGGCACCAGGG + Intronic
929169587 2:38918256-38918278 CTAAGACAGCAGTGGCAGCGAGG - Intronic
931297285 2:60939894-60939916 ATGAGACAGCACTGGCTCCATGG + Intergenic
933039390 2:77443365-77443387 AGCAAAAAGCAGTGGCACCAGGG + Intronic
933117413 2:78492292-78492314 TTCAGACACCAGTGACACCTTGG + Intergenic
933702485 2:85265393-85265415 CTCAGATCTCACTGGCACCAGGG - Intronic
934044500 2:88161310-88161332 CTCAGACAGTAATTGTACCAAGG + Intergenic
935205960 2:100896586-100896608 CTCAGACAGCACTGGCAGCCAGG - Intronic
937792297 2:125974902-125974924 CTCTGACAGCAATGGGTCCAAGG - Intergenic
942170120 2:173282025-173282047 CTCAGCCATCAGTGGCAACTTGG - Intergenic
942415706 2:175757094-175757116 CTCAGGCTCCTGTGGCACCATGG + Intergenic
942980666 2:182077610-182077632 CACACACTGCAGTGGCTCCATGG - Intronic
945790078 2:214293783-214293805 CTCTGGTAGCAGTGGCCCCAGGG + Intronic
946103704 2:217351361-217351383 CTCAGACTGCAATGGCAGTATGG + Intronic
946600038 2:221349598-221349620 ACCAGACACCAGTGGCCCCAGGG + Intergenic
948041934 2:234909124-234909146 TTCACACAGTAGTGGCACTATGG - Intergenic
948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG + Intergenic
1168771755 20:420540-420562 GTGAGACAGCAATGGCAGCAAGG - Intronic
1168811587 20:708199-708221 CTCAGAAAGTAGTGGTGCCAGGG - Intergenic
1168813172 20:719596-719618 CTGAGCTAGCAGAGGCACCAGGG - Intergenic
1168813395 20:720761-720783 CTGAGCTAGCAGAGGCACCAGGG - Intergenic
1173250991 20:41364188-41364210 CTCAGGCTGCAGTAGCACCTGGG + Intronic
1173958642 20:47054229-47054251 CTCAGCCAGGGGTGGCATCAGGG - Intronic
1175497832 20:59426924-59426946 GACACACAGCAGTGGCACCAAGG + Intergenic
1175887330 20:62299771-62299793 CACAGGCAGCAAAGGCACCATGG - Intergenic
1176187234 20:63787542-63787564 TGCAGGCAGCTGTGGCACCATGG - Intronic
1176288686 21:5033129-5033151 CCCAGCCAGCAGTGGCATCATGG - Intronic
1176625219 21:9086954-9086976 TCCGCACAGCAGTGGCACCAGGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179156546 21:38856534-38856556 CTCAGGCAGTAGGGGCCCCATGG - Intergenic
1179662925 21:42889590-42889612 CACAGGCAGCAGTGCCACCCTGG - Intronic
1179868498 21:44230346-44230368 CCCAGCCAGCAGTGGCATCATGG + Intronic
1179942463 21:44649000-44649022 CACAGACAGGAGGGGCACCCCGG - Intronic
1183794851 22:40108262-40108284 TGCTGACAGCAGTGCCACCAGGG - Intronic
1183839542 22:40486777-40486799 CTCAGACAGCCTGGGCAACACGG + Intronic
1184951196 22:47843695-47843717 CTCAGACAGCAGTGTGGCCGGGG - Intergenic
949113852 3:295947-295969 CTCAGGAAGAAGGGGCACCAAGG - Intronic
949570983 3:5292907-5292929 CTCAGAAACCAGAGGCACTAAGG + Intergenic
952148657 3:30562330-30562352 CTCAGTCATCAGCTGCACCATGG + Intergenic
953235226 3:41100633-41100655 CACAGAAAGCAGCGGCACCTCGG + Intergenic
953999290 3:47543122-47543144 CTCAGAGAGGGGTGGCATCAGGG + Intergenic
955266302 3:57448612-57448634 CTGAGCCAGCATTGGCAACATGG - Intronic
955533658 3:59900501-59900523 CTCAGTGTGAAGTGGCACCAGGG - Intronic
956186663 3:66569344-66569366 CTAAGGCAGAAGTGGCAACATGG + Intergenic
960494454 3:118358362-118358384 CCAGGACAGCAATGGCACCAAGG + Intergenic
960631110 3:119731605-119731627 CCAAGACAGCAGTGGCACACAGG + Intronic
962482104 3:135806755-135806777 CTCAGTCGGCAGGGGCTCCAGGG + Intergenic
966736707 3:183192552-183192574 CACAGACAGCAGGGACACCCTGG + Intronic
967961234 3:194925984-194926006 CTCAGACAGCTGAGGTATCAAGG - Intergenic
968038593 3:195569509-195569531 CTCTGCCAGCAGCGGCATCATGG + Intronic
968230415 3:197002365-197002387 CTCAGACAACTGTGGCAAGATGG + Exonic
970035871 4:11735265-11735287 CTAAGACCCCAGTGGCACAATGG - Intergenic
972569477 4:40297168-40297190 CTCATACAGCAGGGGTGCCAGGG - Intergenic
973684213 4:53353457-53353479 CCGAGACAGCAGTGGCAACCTGG - Intronic
973802887 4:54496356-54496378 CAAAGACAGCTGTGCCACCATGG + Intergenic
977749887 4:100596596-100596618 CTCATACCTCAGTGGCACCAGGG - Intronic
979387040 4:120079072-120079094 CACAGAAAGCAATGGCATCAAGG + Intergenic
980715042 4:136617027-136617049 CACATAAAGCAGTGGCAACAGGG - Intergenic
982741520 4:159061838-159061860 CTGAAACAGCAGGAGCACCATGG + Intergenic
984887681 4:184465197-184465219 CTCAGACAGCTGTGGCTACTTGG - Intronic
987720600 5:21627932-21627954 TTCATACACCAGTGGCACCTGGG - Intergenic
988628050 5:32898893-32898915 ATCATACCCCAGTGGCACCATGG - Intergenic
991033916 5:62108755-62108777 CTGAGCTGGCAGTGGCACCAGGG + Intergenic
991498116 5:67248122-67248144 CTCAGAGAGAAGTGTCACAAAGG + Intergenic
993996454 5:94729319-94729341 CTGTGGCAGGAGTGGCACCATGG + Intronic
994921248 5:106046835-106046857 CTCAGAAAACAGAAGCACCAAGG + Intergenic
995535207 5:113129155-113129177 CTCATACAGCAGCAGCCCCAAGG - Intronic
997187972 5:131901010-131901032 CTTCGACAGCAATGGCAGCATGG - Intronic
997375624 5:133395154-133395176 CCCAGCCAGCAGTGGCAACCTGG + Intronic
1005564765 6:27079875-27079897 CTCAGAAAGCAGAGTCTCCAGGG + Intergenic
1006371508 6:33647072-33647094 GTCAGAGTGCAGTGACACCATGG + Intronic
1008223858 6:48887715-48887737 GTCAGACAGCACTGGCACAGAGG - Intergenic
1009907691 6:69889846-69889868 CCCAGCCAGCAGTGGCAACCTGG + Intronic
1011526007 6:88265484-88265506 CTCTGACAGCACTTGCAGCAAGG + Intergenic
1012768256 6:103396950-103396972 TTCACACAGCAGAGGCACCCTGG - Intergenic
1013192660 6:107816856-107816878 CTGGGACTTCAGTGGCACCATGG + Intronic
1013540387 6:111102623-111102645 CTAAGACAGCAGAGGAAACAAGG - Intronic
1013960211 6:115889875-115889897 CCCAGCCAGCAGTGGCAACCCGG + Intergenic
1014144534 6:117981928-117981950 ATCAGGCAGCAGAGGCACCATGG - Intronic
1015708686 6:136115833-136115855 CTCAGACAGCAGTGGGACTGGGG + Intronic
1016941327 6:149484906-149484928 CTCTGACTCCAGTGGCACCTGGG - Exonic
1017872969 6:158502333-158502355 CTTCGACAGCAGTGGCAACGTGG + Exonic
1018198603 6:161376121-161376143 CTGAAGCAGCAGTGGCTCCAGGG - Intronic
1018309314 6:162491960-162491982 CAGAGACAGCAGAGGCACCGAGG - Intronic
1018837583 6:167496943-167496965 CCCACACAGCAGTGCCACCTGGG + Intergenic
1018926347 6:168209522-168209544 CTCCGAGAGCAGTGGGGCCAGGG - Intergenic
1018932890 6:168253420-168253442 ATAAGACAGCTCTGGCACCAAGG - Intergenic
1019166427 6:170100485-170100507 TTCAGACAGCAGGGGCAGCAAGG - Intergenic
1022263152 7:28726810-28726832 CTCTGACAGCACTGTCCCCAGGG - Intronic
1022518969 7:30993696-30993718 CTGAGTCAGCAGTGGCAACCTGG - Intergenic
1024645799 7:51369344-51369366 TTCAGACAGAAGTGGTACCACGG - Intergenic
1024672186 7:51606576-51606598 CACAGCCAGCACGGGCACCAGGG - Intergenic
1025036657 7:55597461-55597483 TTCAGACAGAAGTGGTACCACGG - Intergenic
1026172794 7:67969146-67969168 CGCAGTCAGCAGTGGCAACCCGG + Intergenic
1028646030 7:93097637-93097659 CTCAGACAGCACTGCCTTCATGG - Intergenic
1030351921 7:108499364-108499386 CACAGACAGCTGTGGCAACTTGG - Intronic
1030408449 7:109144008-109144030 CTCTTCCAGCAGTGGCAACATGG - Intergenic
1030902595 7:115142841-115142863 CTCAGACAACAGTGACACTGAGG + Intergenic
1031754450 7:125620221-125620243 CTAAGAGCACAGTGGCACCATGG + Intergenic
1032500234 7:132394479-132394501 CTCAGACAACAGGGACACCTAGG - Intronic
1032679374 7:134166578-134166600 CTCATAAAGCAATGGCAGCATGG + Intronic
1033433829 7:141314268-141314290 CTCACACATCATTGGTACCATGG + Intronic
1035352928 7:158259082-158259104 ATCAGGCAGCAGAGGCATCAGGG - Intronic
1035467387 7:159088692-159088714 ATCACACAGCGGTGGCAGCACGG + Intronic
1035518686 8:258511-258533 CTCCTACAGGAGTGGCACAAAGG + Intergenic
1035706620 8:1680385-1680407 CTCAGACTGCCGAGGCTCCAAGG - Intronic
1036194040 8:6698624-6698646 CTCATAGAGCAGTGCCTCCAGGG + Intergenic
1037523905 8:19706407-19706429 CTAAGAGAGCAGTGGAGCCACGG + Intronic
1041804086 8:61831284-61831306 CTCAGACAGCACAAGCACAACGG - Intergenic
1044441799 8:92231860-92231882 CCCAGCCAGCAGTGGCAACCCGG + Intergenic
1048091788 8:131249266-131249288 CTCAGCCTCCAGTGGCACCATGG + Intergenic
1048789333 8:138085126-138085148 CTGAGCCAGCAGTGGCAACCCGG + Intergenic
1049434678 8:142581064-142581086 CTCAGACTCCAGGGCCACCAGGG - Intergenic
1053291386 9:36881814-36881836 ACCAGCCAGCAGCGGCACCAGGG - Intronic
1053656441 9:40222234-40222256 TCCGCACAGCAGTGGCACCAGGG + Intergenic
1054356852 9:64070675-64070697 TCCGCACAGCAGTGGCACCAGGG + Intergenic
1054528176 9:66154051-66154073 TCCGCACAGCAGTGGCACCAGGG - Intergenic
1054676171 9:67858208-67858230 TCCGCACAGCAGTGGCACCAGGG + Intergenic
1055510216 9:76988758-76988780 CTGAGATCGCAGTGGCAGCAGGG - Intergenic
1056994467 9:91443418-91443440 CACAAACAGCATGGGCACCATGG - Intergenic
1057311666 9:93946978-93947000 ATCTGACATCAGTGGCAGCATGG - Intergenic
1060918957 9:127407027-127407049 CTGAGACAGCTCTGCCACCAGGG - Intronic
1061707451 9:132463807-132463829 CACAGATAGCAGGGACACCAGGG - Intronic
1062271368 9:135711263-135711285 GTCAGACAGCCCTGGCTCCATGG + Intronic
1203748393 Un_GL000218v1:57414-57436 TCCGCACAGCAGTGGCACCAGGG + Intergenic
1203561334 Un_KI270744v1:60607-60629 TCCGCACAGCAGTGGCACCAGGG - Intergenic
1186446639 X:9635520-9635542 CTCAGTCTGCAGTGGCAGCCAGG + Intronic
1187732867 X:22273548-22273570 CACAGACGGTAGTGACACCATGG - Exonic
1192546925 X:72022007-72022029 CCCAGAGAGCAGAGGCACCATGG - Intergenic
1197925897 X:131646918-131646940 CTCAGACAGCAGCAGGAACAGGG - Intergenic
1198565117 X:137896319-137896341 CACAGGCAGCAGGGGCAGCAAGG + Intergenic
1200885358 Y:8262390-8262412 CCTGGACAGCAGTGGCACCATGG - Intergenic
1201161740 Y:11172384-11172406 TCCGCACAGCAGTGGCACCAGGG + Intergenic
1201896893 Y:19001208-19001230 GTCAGCCAGCAGAGCCACCAAGG + Intergenic