ID: 927928424

View in Genome Browser
Species Human (GRCh38)
Location 2:27028458-27028480
Sequence ATGTGGGTTACATGGCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 232}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927928419_927928424 -7 Left 927928419 2:27028442-27028464 CCCAGAAGCTGTGAATATGTGGG 0: 1
1: 1
2: 3
3: 91
4: 668
Right 927928424 2:27028458-27028480 ATGTGGGTTACATGGCAAAAGGG 0: 1
1: 0
2: 4
3: 38
4: 232
927928415_927928424 13 Left 927928415 2:27028422-27028444 CCAATGTCCACATCACAATCCCC 0: 1
1: 2
2: 0
3: 22
4: 211
Right 927928424 2:27028458-27028480 ATGTGGGTTACATGGCAAAAGGG 0: 1
1: 0
2: 4
3: 38
4: 232
927928411_927928424 19 Left 927928411 2:27028416-27028438 CCTCCCCCAATGTCCACATCACA 0: 1
1: 1
2: 2
3: 30
4: 359
Right 927928424 2:27028458-27028480 ATGTGGGTTACATGGCAAAAGGG 0: 1
1: 0
2: 4
3: 38
4: 232
927928417_927928424 -6 Left 927928417 2:27028441-27028463 CCCCAGAAGCTGTGAATATGTGG 0: 1
1: 1
2: 24
3: 202
4: 740
Right 927928424 2:27028458-27028480 ATGTGGGTTACATGGCAAAAGGG 0: 1
1: 0
2: 4
3: 38
4: 232
927928412_927928424 16 Left 927928412 2:27028419-27028441 CCCCCAATGTCCACATCACAATC 0: 1
1: 0
2: 2
3: 24
4: 267
Right 927928424 2:27028458-27028480 ATGTGGGTTACATGGCAAAAGGG 0: 1
1: 0
2: 4
3: 38
4: 232
927928421_927928424 -8 Left 927928421 2:27028443-27028465 CCAGAAGCTGTGAATATGTGGGT 0: 1
1: 0
2: 2
3: 44
4: 364
Right 927928424 2:27028458-27028480 ATGTGGGTTACATGGCAAAAGGG 0: 1
1: 0
2: 4
3: 38
4: 232
927928416_927928424 6 Left 927928416 2:27028429-27028451 CCACATCACAATCCCCAGAAGCT 0: 1
1: 0
2: 11
3: 120
4: 727
Right 927928424 2:27028458-27028480 ATGTGGGTTACATGGCAAAAGGG 0: 1
1: 0
2: 4
3: 38
4: 232
927928413_927928424 15 Left 927928413 2:27028420-27028442 CCCCAATGTCCACATCACAATCC 0: 1
1: 0
2: 2
3: 37
4: 266
Right 927928424 2:27028458-27028480 ATGTGGGTTACATGGCAAAAGGG 0: 1
1: 0
2: 4
3: 38
4: 232
927928414_927928424 14 Left 927928414 2:27028421-27028443 CCCAATGTCCACATCACAATCCC 0: 1
1: 0
2: 9
3: 25
4: 217
Right 927928424 2:27028458-27028480 ATGTGGGTTACATGGCAAAAGGG 0: 1
1: 0
2: 4
3: 38
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927928424 Original CRISPR ATGTGGGTTACATGGCAAAA GGG Intergenic
900715626 1:4141687-4141709 ATGTCACTTACATGGCAAAAGGG + Intergenic
901167594 1:7231037-7231059 AACTGGGTCACATGGCAAGAGGG + Intronic
902256259 1:15190641-15190663 ATTTACGTTACATGGTAAAAGGG + Intronic
902605748 1:17568459-17568481 ATGATGGTGACATGGCAAAAAGG + Intronic
905023351 1:34833180-34833202 TGTTAGGTTACATGGCAAAATGG + Intronic
907733151 1:57087151-57087173 CTGTGGGTTGCATGCCAGAAAGG + Intronic
908269714 1:62411145-62411167 AAATGCCTTACATGGCAAAAGGG - Intergenic
909379094 1:74977199-74977221 ATGTGGGTCATATGGCACATAGG - Intergenic
909684343 1:78329608-78329630 ATGTGCGTTAAGAGGCAAAATGG - Intronic
911658643 1:100475181-100475203 GAGTGGGTTAAATGGCAGAATGG - Intronic
911806204 1:102211276-102211298 CTGTGGGCTACATGGGAACAGGG - Intergenic
912247220 1:107972036-107972058 ATCTGAGTGACATGCCAAAATGG - Intergenic
915683678 1:157608356-157608378 ATCTGTGTTATATAGCAAAAGGG + Intergenic
915939189 1:160107861-160107883 ATGTGGGGTACACAGCAAGAAGG - Intergenic
917314525 1:173710647-173710669 ATGTGCATTAAAGGGCAAAATGG - Intergenic
918127320 1:181595922-181595944 ATGTGGGTGACAGAGCGAAAAGG + Intronic
919126828 1:193404977-193404999 TGTTGGGTTACATGGCAAAAGGG + Intergenic
923927232 1:238645845-238645867 ATGGGGTTTATATTGCAAAAAGG + Intergenic
1062850847 10:741670-741692 GTGTGGGGTAGATGGCAACATGG - Intergenic
1063319683 10:5041144-5041166 ATCTGGGTTACATGCCAAACAGG - Intronic
1065885555 10:30073891-30073913 ATCTGGGTTCCCTGGCAGAATGG - Intronic
1065948063 10:30625415-30625437 TTGTACCTTACATGGCAAAAGGG - Intronic
1068931613 10:62596153-62596175 ATGTGGGTAACATGGAAATGTGG + Intronic
1069938717 10:71938417-71938439 ATGTTTGTTACATGGCATCATGG + Intergenic
1070366412 10:75741533-75741555 ATGGAGGTTTCATGCCAAAAGGG - Intronic
1071583357 10:86794113-86794135 ATGTTATTTAAATGGCAAAAGGG - Intronic
1071978650 10:90980762-90980784 ATGTGGCTCACATGCCAAGATGG + Intergenic
1073580020 10:104656779-104656801 CTGTGGGTTAGAGGGAAAAAAGG + Intronic
1074421152 10:113309723-113309745 ATGCGGGTTACACAGCAAAGCGG - Intergenic
1074423817 10:113333266-113333288 ATTTATGTTACATGGCAAAGGGG + Intergenic
1074710831 10:116176347-116176369 ATGGGGTTTACATCTCAAAATGG - Intronic
1074908897 10:117889226-117889248 ATGTGAATTATATGGCAACAAGG + Intergenic
1075405754 10:122194665-122194687 ATGTGGGTGAGTTGGCACAATGG + Intronic
1075515587 10:123105564-123105586 ATGTTACTTCCATGGCAAAAGGG + Intergenic
1075884386 10:125885314-125885336 ATGTACTTTGCATGGCAAAAGGG + Intronic
1076357210 10:129861766-129861788 ATGTGGTTTACATGGAAGGAAGG + Intronic
1077508910 11:2945278-2945300 GTGGGGGTCACTTGGCAAAAAGG - Exonic
1078179528 11:8999412-8999434 ATGTGGGTTACACTGTAAAGGGG - Intronic
1078444212 11:11392087-11392109 ATGAGGGATACAGGGCCAAAGGG - Intronic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1081080956 11:38738724-38738746 AATTGTGTTACGTGGCAAAAGGG + Intergenic
1081208961 11:40308452-40308474 ATGTCTCATACATGGCAAAAGGG + Intronic
1082984959 11:59160561-59160583 ATGTAGGTTATATGGGAAAAGGG + Intergenic
1084776229 11:71378369-71378391 TTGTGTGGTACATGGCATAATGG - Intergenic
1085528516 11:77177838-77177860 ATTTGGCTTACGTGGCACAATGG - Intronic
1085963937 11:81498093-81498115 ATGTGCATTAAAAGGCAAAATGG + Intergenic
1085985226 11:81778948-81778970 ATGTGGGCTTCCTGGAAAAACGG + Intergenic
1086250666 11:84809871-84809893 ATGTGGGGTCCAAGGCAAAATGG + Intronic
1086602355 11:88648836-88648858 ATATGTGTGACATGGTAAAATGG + Intronic
1089952223 11:122538900-122538922 ATGAGGGTTAAAAGTCAAAATGG + Intergenic
1090250122 11:125245191-125245213 ATGGGGATCACATGGCATAAGGG - Intronic
1090702538 11:129309544-129309566 CTGTGTGTCACATGGCAAAAGGG + Intergenic
1091847334 12:3667482-3667504 ATGTGGGTAACATGGGGGAATGG - Intronic
1094750718 12:33404152-33404174 ATGTTACTTAAATGGCAAAAGGG + Intronic
1095536434 12:43253847-43253869 TGGTAGGTTACATGGCAAAGGGG + Intergenic
1096091881 12:48907594-48907616 CTGTGGGATACAGGGTAAAATGG - Intronic
1102027310 12:109720804-109720826 ATGTGGGTTAATTGCCACAATGG + Intronic
1104152320 12:126095647-126095669 ATGTGGGTTATCCTGCAAAAAGG - Intergenic
1104278591 12:127353261-127353283 TTGTGGGTTACCTGCCAAGATGG - Intergenic
1110150700 13:72249644-72249666 TTGTGGGTGAAATGGGAAAATGG - Intergenic
1110865696 13:80393064-80393086 ATGTTACTTACATGTCAAAAGGG + Intergenic
1110930674 13:81212150-81212172 ATGTGCATTACAAGGCAAAATGG + Intergenic
1111777524 13:92683310-92683332 ATGTGGGTTACATAGCAACCTGG + Intronic
1112259127 13:97862570-97862592 TGTTAGGTTACATGGCAAAAAGG + Intergenic
1112476373 13:99734618-99734640 ATCTAAGTTACAGGGCAAAATGG - Intronic
1113069764 13:106409213-106409235 CAGTAGGTTACATGGCAAAGGGG + Intergenic
1120336281 14:83159932-83159954 ATGTAGGTTACATGGCACATTGG - Intergenic
1122181511 14:99958458-99958480 ATGTAGGTTACATGGCAAAGGGG + Intergenic
1124425566 15:29559818-29559840 CTGTGTCTCACATGGCAAAAAGG - Intronic
1124684030 15:31763411-31763433 AGATGGGTTAAATGGCAGAATGG + Intronic
1125122471 15:36178354-36178376 AAGTGGGTTACATGGCAGATGGG + Intergenic
1125124674 15:36206289-36206311 CTGTAGCTTACATGGCAGAAGGG - Intergenic
1126506362 15:49408048-49408070 ATGTGGGATACAAAACAAAAAGG - Intronic
1130090397 15:80816132-80816154 ATGTGGATTTCAGGGCAAAGTGG + Intronic
1131419595 15:92294193-92294215 ATATTGATTACATGTCAAAATGG + Intergenic
1133151619 16:3836568-3836590 GTGTGGGTTACATGGGTAAAGGG + Intronic
1138074442 16:54026880-54026902 TTGTGCGTTGCATTGCAAAAAGG - Intronic
1138124493 16:54427430-54427452 ATGTGGGGTACATGGCTAGTGGG + Intergenic
1139559993 16:67735840-67735862 AGGAGGGGAACATGGCAAAAGGG + Intronic
1140293294 16:73684572-73684594 TGTTGGGTTACATGGCAAAGAGG + Intergenic
1140336249 16:74107640-74107662 ATGAGTGGTAGATGGCAAAATGG - Intergenic
1141365365 16:83437755-83437777 ATCTGGGGTTCATGGGAAAAGGG - Intronic
1141525021 16:84605451-84605473 ATGTCCCTCACATGGCAAAAGGG + Intronic
1143614734 17:8042968-8042990 ATCAGGGTTACATAGCAAATTGG - Intronic
1144871406 17:18373975-18373997 ATGTTACTTATATGGCAAAAGGG + Intergenic
1147760473 17:42794867-42794889 ATGGGGGTTCCAGGGGAAAATGG - Exonic
1148679280 17:49464420-49464442 ATGTTACTTACATGGCAAAAGGG - Intronic
1149905007 17:60518237-60518259 GCCTGGGTAACATGGCAAAATGG - Intronic
1150115675 17:62546920-62546942 AGGTGGGTTAAATATCAAAATGG - Intronic
1150874264 17:68951187-68951209 ATTTATGTTACATAGCAAAAAGG - Intronic
1150918559 17:69460261-69460283 AGGTGGGGTACATGGAGAAAGGG + Intronic
1151112462 17:71695129-71695151 ATGTGGGATACAAAGCAAAATGG + Intergenic
1151908922 17:77068640-77068662 ATGTGACTTACTTGGTAAAAGGG - Intergenic
1153784375 18:8521426-8521448 ATGAGTGTTATATTGCAAAAGGG + Intergenic
1154084246 18:11286729-11286751 ATGTGGGTTTCAGGGTAAAAAGG - Intergenic
1156536331 18:37868128-37868150 ATGTGGGTTGATTGGCAGAAGGG - Intergenic
1156680489 18:39582670-39582692 ATGTGGGTTTCTTGCCAAAATGG - Intergenic
1157116865 18:44870265-44870287 ATGTGGCTCACATGGGAGAAGGG - Intronic
1157778294 18:50415098-50415120 GTGTGGGTTACATGGCTATATGG - Intergenic
1158835440 18:61326731-61326753 CTTTATGTTACATGGCAAAAGGG - Intergenic
1158888760 18:61853810-61853832 ATGTTACCTACATGGCAAAAGGG - Intronic
1160053693 18:75460024-75460046 ATGTGAGTTACATGGCAAAGAGG + Intergenic
1161441969 19:4296899-4296921 AAGTGGGGGACATGGCAAAGGGG + Intronic
1166315579 19:41987808-41987830 TTGTGAGTTAGATGGGAAAAAGG + Intronic
1166322458 19:42027038-42027060 ATGTGGGACACAGGGCAAGATGG - Intronic
1167526692 19:49988704-49988726 ATGAGGGTGACCTGGTAAAAGGG - Intronic
927010283 2:18897018-18897040 AGGTGGGTTTCATCGCAGAAAGG - Intergenic
927429418 2:23014458-23014480 ATATTGATTACATGTCAAAATGG + Intergenic
927928424 2:27028458-27028480 ATGTGGGTTACATGGCAAAAGGG + Intergenic
928223367 2:29424003-29424025 ATGTGCGATACATGAAAAAAAGG - Intronic
928539582 2:32271920-32271942 ATGTTTGTTACATGGCAAAGGGG - Intergenic
929570007 2:43016745-43016767 AAGTGTGTCACATGGCAAGAAGG - Intergenic
930450318 2:51527703-51527725 ATGTCTGTTACATGGAAAAGAGG - Intergenic
931049988 2:58401998-58402020 GTTTAGGTTACATGGCAAAGGGG - Intergenic
932857875 2:75256581-75256603 ATGTGAGTTACATATCAATAAGG - Intergenic
932961283 2:76415242-76415264 ATGTGCATTAAAAGGCAAAATGG + Intergenic
933795834 2:85918794-85918816 AGTTGGGGTACATGGCAACATGG + Intergenic
935248636 2:101241511-101241533 ATCTGGGCTACCTGTCAAAACGG + Intronic
936279762 2:111127878-111127900 ATATGGGTTACATGTTGAAATGG + Intronic
937034135 2:118766579-118766601 ATGTGGTCTACATGGCCAAACGG - Intergenic
939960990 2:148565594-148565616 ATATGGGCTACATAGCAACATGG - Intergenic
940506127 2:154555456-154555478 ATGTGAGTTAGATGGCATAAAGG + Intergenic
940619982 2:156100055-156100077 ATATGGTTTACATGACAGAACGG - Intergenic
941839055 2:170058986-170059008 ATGTGGGTTAAATTTAAAAAAGG - Intronic
941959010 2:171235415-171235437 ATGAGGGTTTCAAGGGAAAATGG + Intergenic
944157501 2:196622680-196622702 ATGTGTTTTTCATGGCCAAAGGG - Intergenic
945604020 2:211905432-211905454 TGTTAGGTTACATGGCAAAAGGG - Intronic
947870999 2:233437940-233437962 ATGTGGGGTACATGGCTCAGAGG + Intronic
1173240806 20:41295361-41295383 ATGCAGGTTACATAGCAACATGG + Intronic
1173249412 20:41356774-41356796 TTGTGGGTTACATCTCAAAGGGG + Intronic
1175026903 20:55912382-55912404 ATGTGAGTTACATCTCAATAAGG - Intergenic
1175587018 20:60149142-60149164 ATGTGCACTAAATGGCAAAATGG + Intergenic
1177841082 21:26234024-26234046 ATGTGCGTTACATGAAATAATGG + Intergenic
1180932840 22:19605196-19605218 ATGTTTGTTACATTGCTAAATGG + Intergenic
1181904184 22:26180262-26180284 ATGTGTCTTAACTGGCAAAAGGG - Intronic
1182161980 22:28131996-28132018 CTGTGGCTTACTTGGCATAATGG - Intronic
1183769802 22:39914164-39914186 CTTTGTGTTCCATGGCAAAAGGG - Intronic
950003670 3:9677344-9677366 ATCGGGATTACATGGCAGAAGGG + Exonic
950545195 3:13634196-13634218 AAGTGGGTGACAGAGCAAAAAGG - Intronic
951293358 3:20901550-20901572 ATAAGGGATACATGGCAAAAGGG + Intergenic
951934265 3:28003876-28003898 ATGTATTTTATATGGCAAAAGGG + Intergenic
953390817 3:42532663-42532685 ATGTGCCTCACATGGAAAAAGGG + Intronic
955066572 3:55538346-55538368 GTGTGGGTCACAGGGCCAAAGGG + Intronic
957610847 3:82463327-82463349 ATGTGCATTAAGTGGCAAAAAGG - Intergenic
959473640 3:106783627-106783649 ATGTGGGTTCCCGGGCAACATGG - Intergenic
962050491 3:131809063-131809085 ATGTTAGTTACATAGCAAAGGGG + Intronic
962173137 3:133124304-133124326 GTGTGACGTACATGGCAAAATGG + Intronic
962630208 3:137268091-137268113 ATGGGGGTTAAATGGCCTAAGGG + Intergenic
962928121 3:140013491-140013513 ATGTGGGTGATATGGAAATAAGG + Intronic
964775117 3:160267078-160267100 TTGTGGGTTTCATGGTAGAAAGG - Intronic
966997013 3:185292716-185292738 AGGTTGGATACATGGCAACAAGG + Intronic
970823620 4:20249312-20249334 AGTTGGGTTATATGGGAAAAGGG - Intergenic
972085246 4:35207315-35207337 AAGTGAGTTACATGAGAAAATGG + Intergenic
972388029 4:38586644-38586666 TGGTAGGTTACATGGCAAAGGGG - Intergenic
973053591 4:45626982-45627004 ATATTTGTAACATGGCAAAAAGG + Intergenic
976602940 4:86955437-86955459 ATGTTAGTGAAATGGCAAAAAGG - Intronic
976881309 4:89928843-89928865 ATGTACCTTACATGGCAAAAGGG - Intronic
977308502 4:95355227-95355249 GTGTGGGTTACATGAAATAAGGG + Intronic
977464625 4:97368253-97368275 ATTATGGTTATATGGCAAAAGGG - Intronic
977738002 4:100441873-100441895 ATGACGGTTAAATGTCAAAATGG - Intronic
980715974 4:136630332-136630354 ATGTGGATTACATGCAAAAGAGG + Intergenic
981366090 4:143905288-143905310 ATGTGGGGGAAATGGCACAAGGG - Intronic
981386719 4:144140416-144140438 ATGTGGGGGAAATGGCACAAGGG - Intronic
982162905 4:152587613-152587635 AGGTGCATCACATGGCAAAAAGG - Intergenic
982680794 4:158426736-158426758 TGTTGTGTTACATGGCAAAAGGG - Intronic
983350720 4:166584734-166584756 ATGTGGATTACATGGCTCCATGG + Intergenic
983352554 4:166610576-166610598 ATGTGGGAAACATGGAAAATTGG + Intergenic
984242361 4:177233019-177233041 TTGTGCCTTATATGGCAAAAAGG + Intergenic
984343582 4:178490687-178490709 ATGTGGTATACTTGGGAAAAGGG + Intergenic
986214675 5:5708277-5708299 ATGTAGGTTACATGGGAAAGGGG - Intergenic
986859973 5:11915727-11915749 ATGTTCCTTATATGGCAAAAGGG + Intergenic
987005113 5:13702885-13702907 CTGTAGGTTACTTGGCTAAATGG - Intronic
988639453 5:33025449-33025471 ATGAGAGTCACATGGCAGAAGGG + Intergenic
989178460 5:38553323-38553345 ATCAGGGTTGCATGGCAGAATGG - Intronic
989192150 5:38681130-38681152 ACTTGGGTTATTTGGCAAAATGG + Intergenic
989344280 5:40411675-40411697 TGTTGGGTTACATGGAAAAAGGG + Intergenic
989411103 5:41120934-41120956 ATTTGAGTTACATGACAAGATGG + Intergenic
993440944 5:87956103-87956125 ATGTGGGCAACATGGGAGAAAGG - Intergenic
994017304 5:94982536-94982558 ATGTTACTTATATGGCAAAAGGG + Intronic
995730490 5:115235121-115235143 ATGAGGGTAACATGTCAAAAGGG + Intronic
996015158 5:118525602-118525624 ATGTTTGTTACATGACAAAAGGG + Intergenic
996616577 5:125449080-125449102 ATGTGGGTTACATAGAGAAAAGG - Intergenic
997588846 5:135060863-135060885 ATGTACCTTACATGGCAAAAGGG - Intronic
998173952 5:139889098-139889120 AAGAGGGTTCCATGGGAAAATGG + Intronic
999330137 5:150668096-150668118 AAGTGAGTGACATGGAAAAAAGG - Intronic
1000564532 5:162831361-162831383 TGGTATGTTACATGGCAAAAGGG - Intergenic
1001540038 5:172531473-172531495 ATGAGGGCCACAGGGCAAAAGGG + Intergenic
1003073229 6:2960783-2960805 ATGCCCCTTACATGGCAAAAGGG + Exonic
1003249760 6:4415853-4415875 ATGTTACTTACATGGCAAAAAGG + Intergenic
1004763835 6:18701540-18701562 ATTGGGGTAACATGGCCAAAGGG - Intergenic
1006765824 6:36505506-36505528 ATGTCAGTTACATGTGAAAATGG - Intronic
1008263332 6:49393616-49393638 ATGTGAGTTAAATGGAAGAAAGG + Intergenic
1008828160 6:55724475-55724497 ATGTGATTTACAAGGCAAAAGGG + Intergenic
1008957887 6:57235644-57235666 ATGTACCTTGCATGGCAAAAAGG + Intergenic
1009400932 6:63254651-63254673 ATGTTCCTTACATGACAAAAGGG - Intergenic
1009596129 6:65739060-65739082 ATATGCCTTACATGGCAAAAGGG + Intergenic
1011541883 6:88439588-88439610 ATATTGGTTACATGGTAAAATGG - Intergenic
1012025103 6:93979722-93979744 ATGTGGTTTACTTGGCAGGATGG + Intergenic
1012091963 6:94909608-94909630 ATTTAAGTTTCATGGCAAAAGGG - Intergenic
1012864820 6:104606296-104606318 ATGTGTGTTACATAGCATAGTGG - Intergenic
1014004559 6:116403223-116403245 ATGTGTGTTCCTTAGCAAAAGGG - Intronic
1015429463 6:133113402-133113424 GTGTGAGTTACATGGCAGAAGGG - Intergenic
1015684803 6:135847984-135848006 ATGTTAATTGCATGGCAAAAGGG - Intergenic
1016235404 6:141857778-141857800 ATGTGCATTAAAAGGCAAAATGG - Intergenic
1016329376 6:142940801-142940823 ATGTGAGTGACAAGTCAAAAAGG + Intronic
1017714011 6:157195554-157195576 ATGTATGTTACATGGCAAAAGGG - Intronic
1017945246 6:159091237-159091259 ATGTGGGCCTCATTGCAAAAGGG - Intergenic
1021863516 7:24931352-24931374 ATGTACCTTATATGGCAAAAGGG + Intronic
1022246491 7:28565034-28565056 ATCTAGGTTACATGGCTACAAGG + Intronic
1022287525 7:28968470-28968492 GTTTAGGTTACATGGCAAAGAGG + Intergenic
1022831569 7:34072671-34072693 ATGTTATTTACATGGCAAGAGGG - Intronic
1024457804 7:49629129-49629151 ATGTGGGTTATATAGGAATAGGG - Intergenic
1028074128 7:86490112-86490134 ATGTGGGTTGAAAGGAAAAATGG + Intergenic
1028341896 7:89732585-89732607 GTGACTGTTACATGGCAAAAGGG + Intergenic
1028582124 7:92419532-92419554 ATGTGGATTACGTGTCAAAATGG + Intergenic
1029991284 7:104964939-104964961 GTCTGGCTTACATGGCAAATGGG - Intergenic
1030465122 7:109891399-109891421 ATGTGGATTAAATGACAAAGTGG + Intergenic
1031167865 7:118252105-118252127 ATGTTACTTAAATGGCAAAAGGG + Intergenic
1031335052 7:120518798-120518820 ATGTCCTTTACATGACAAAAGGG + Intronic
1031751430 7:125579982-125580004 ATGTGGGTAAAATGGCCACATGG + Intergenic
1032045399 7:128602624-128602646 AGGTGGGTTAAATATCAAAATGG - Intergenic
1032297197 7:130650263-130650285 ATGTACATTACATGGCAAAAGGG - Intronic
1032676053 7:134130448-134130470 ATGTGTCTTACAAGCCAAAAAGG - Intronic
1034367515 7:150564149-150564171 ATGTGGGCTACCTGCCAAACTGG - Intergenic
1037335332 8:17786202-17786224 ATGTGGCTTCCATTGCAAGAAGG - Intronic
1037874748 8:22536825-22536847 ATGTATGTTACATGGCCATATGG - Intronic
1038333119 8:26625066-26625088 CTGTGAGTGACATGGCAAGAGGG + Intronic
1039096953 8:33896676-33896698 ATGTGCATTAAAAGGCAAAATGG + Intergenic
1040592122 8:48803154-48803176 ATCAGGGATACATGGCAAACAGG - Intergenic
1040823057 8:51586133-51586155 ATGTGGCTTAACTGGCCAAATGG + Intronic
1043885112 8:85590016-85590038 ATGTGCATTAAAAGGCAAAATGG + Intergenic
1044368867 8:91384470-91384492 ATGTTGCTTACATGGCAAAAGGG - Intronic
1045172987 8:99691375-99691397 ATGTGAGTTATATGTCAATAAGG + Intronic
1045529921 8:102974719-102974741 ATGTTTCTTATATGGCAAAAGGG - Intronic
1047632722 8:126725817-126725839 TGGTGGGTAACATGGGAAAATGG + Intergenic
1048491512 8:134897954-134897976 ATCTGGGCTCCCTGGCAAAATGG - Intergenic
1049543564 8:143219295-143219317 ATGTGCCTTCTATGGCAAAAGGG - Intergenic
1050161309 9:2721545-2721567 TTGTGGGTTATATGACAAATTGG - Intronic
1050265479 9:3884992-3885014 CTGTGGGTTAGAGTGCAAAAAGG + Intronic
1050982200 9:12034944-12034966 ATGTTCTCTACATGGCAAAAGGG + Intergenic
1051191449 9:14517319-14517341 ATGTGGGTTACATGCCTCCAAGG + Intergenic
1052039253 9:23719589-23719611 ATTTGGTTTACAGGTCAAAAGGG + Intronic
1055133226 9:72799783-72799805 AAATATGTTACATGGCAAAATGG + Intronic
1055432438 9:76257727-76257749 ATTTGGGGTACTTGGCCAAAGGG - Intronic
1056090063 9:83196481-83196503 AAGTGGGAGACAGGGCAAAAAGG + Intergenic
1056320763 9:85432734-85432756 ATTTGTGTCACCTGGCAAAAAGG - Intergenic
1057079730 9:92164068-92164090 TGTTAGGTTACATGGCAAAAAGG + Intergenic
1057853322 9:98582112-98582134 TTTTATGTTACATGGCAAAAGGG + Intronic
1058932455 9:109734788-109734810 TTGTAGGTTACTTTGCAAAATGG + Intronic
1059112507 9:111570439-111570461 CTGTTCCTTACATGGCAAAAAGG + Intronic
1060301480 9:122376926-122376948 ATCTGGGTTAGATGCCAAGAGGG + Intronic
1060345278 9:122810521-122810543 ATGCGGGTTATAATGCAAAATGG - Intronic
1060383518 9:123200249-123200271 AAGTGGGTTTCATGGCAGAATGG - Intronic
1185709089 X:2287974-2287996 ATGTGACTTTCACGGCAAAAGGG + Intronic
1186168385 X:6851616-6851638 TTGTGTGTTACATGCTAAAATGG - Intergenic
1186223117 X:7370591-7370613 AAGTAGGTTACATAGCAAAAGGG - Intergenic
1186549944 X:10493102-10493124 ATGTTACTCACATGGCAAAAGGG + Intronic
1186571994 X:10724716-10724738 AGGTGGGCCAGATGGCAAAAAGG - Intronic
1186785007 X:12949039-12949061 TATTTGGTTACATGGCAAAAGGG + Intergenic
1188308264 X:28585860-28585882 TTGTGGGATACATTACAAAATGG + Intergenic
1188755953 X:33964078-33964100 ATGTTTGTTACATGGGTAAATGG + Intergenic
1189009265 X:37030109-37030131 ATGTGGGTGACATGGTAATGTGG + Intergenic
1189021523 X:37346697-37346719 AAATATGTTACATGGCAAAAGGG + Intergenic
1191677662 X:63808598-63808620 TGTTAGGTTACATGGCAAAAGGG + Intergenic
1191692679 X:63957175-63957197 ATGTGGGCTGGGTGGCAAAAGGG + Intergenic
1192186031 X:68947362-68947384 TTTTGGGTTACATGGGGAAAGGG - Intergenic
1192508316 X:71704825-71704847 ATGTGCGTTACATGGCGACAGGG - Intergenic
1192518380 X:71776728-71776750 ATGTGCGTTACATGGCGACAGGG + Intergenic
1194269664 X:91795512-91795534 ATGTGTGTTAAATAGTAAAATGG + Intronic
1194861423 X:99003211-99003233 TTTTAGGTTACATGGCAAAGGGG + Intergenic
1196266795 X:113658276-113658298 TTGGGGGTTACATTGCAACATGG + Intergenic
1196417972 X:115493239-115493261 ATCTGGTTTACGTGGCTAAATGG - Intergenic
1200586885 Y:5016493-5016515 ATGTGTGTTAAATAGTAAAACGG + Intronic
1200802248 Y:7397593-7397615 ATGGGGGTTAGATGGAAAATGGG - Intergenic
1200946634 Y:8847406-8847428 ATCAGGGTTAAATGACAAAAGGG - Intergenic