ID: 927929092

View in Genome Browser
Species Human (GRCh38)
Location 2:27032856-27032878
Sequence GGAGAGCCCGGCCCAGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 356}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927929084_927929092 10 Left 927929084 2:27032823-27032845 CCGCGGAAGCCTCTTCCCGATGC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 927929092 2:27032856-27032878 GGAGAGCCCGGCCCAGGAGAGGG 0: 1
1: 0
2: 1
3: 41
4: 356
927929083_927929092 20 Left 927929083 2:27032813-27032835 CCGCAGGCTGCCGCGGAAGCCTC 0: 1
1: 0
2: 0
3: 20
4: 178
Right 927929092 2:27032856-27032878 GGAGAGCCCGGCCCAGGAGAGGG 0: 1
1: 0
2: 1
3: 41
4: 356
927929087_927929092 -5 Left 927929087 2:27032838-27032860 CCCGATGCTCTTCGCTCAGGAGA 0: 1
1: 0
2: 1
3: 6
4: 67
Right 927929092 2:27032856-27032878 GGAGAGCCCGGCCCAGGAGAGGG 0: 1
1: 0
2: 1
3: 41
4: 356
927929085_927929092 1 Left 927929085 2:27032832-27032854 CCTCTTCCCGATGCTCTTCGCTC 0: 1
1: 0
2: 0
3: 15
4: 149
Right 927929092 2:27032856-27032878 GGAGAGCCCGGCCCAGGAGAGGG 0: 1
1: 0
2: 1
3: 41
4: 356
927929088_927929092 -6 Left 927929088 2:27032839-27032861 CCGATGCTCTTCGCTCAGGAGAG 0: 1
1: 0
2: 0
3: 11
4: 119
Right 927929092 2:27032856-27032878 GGAGAGCCCGGCCCAGGAGAGGG 0: 1
1: 0
2: 1
3: 41
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927929092 Original CRISPR GGAGAGCCCGGCCCAGGAGA GGG Intergenic
900503404 1:3017436-3017458 GGTGAGCCCTGCCCTGGAGGGGG + Intergenic
900674836 1:3878689-3878711 AGCGAGGCCGGCCCGGGAGAGGG - Intronic
900917202 1:5647136-5647158 GGAAAGGCTGGACCAGGAGAAGG + Intergenic
901174878 1:7291695-7291717 AGAGAGCCTAGCCCAGGAGTGGG + Intronic
901181837 1:7347302-7347324 GGAGAGCCAAGCTCCGGAGAGGG + Intronic
901238770 1:7681044-7681066 GGAGAGACCGGGCGTGGAGATGG + Intronic
901428643 1:9199124-9199146 GGAGAGCCTGGCCCACGACATGG + Intergenic
902219889 1:14958110-14958132 GCAGAGCCAGGTCCAGGGGAGGG - Intronic
902545937 1:17190428-17190450 TGAAAGCCGGGCCCAGGACATGG + Intergenic
902611788 1:17602168-17602190 GGAGTGCCGGGCCCCGGAGAAGG - Exonic
902702636 1:18183036-18183058 GGGCAGCCAGGCCCAGGAGGGGG - Intronic
902919297 1:19656874-19656896 GGAGTGCCCGGGCCACGAGGAGG + Exonic
903358292 1:22761671-22761693 GGAGAGAGAGGTCCAGGAGAGGG - Intronic
903815979 1:26064855-26064877 GCAGTGCCCAGCCCAGGGGAAGG - Intronic
903858997 1:26354086-26354108 GGGGAGCACGGCCCAGCAGCAGG - Exonic
903897858 1:26620610-26620632 GGAGAGCCGGGCCGGGGGGAGGG - Intergenic
904040778 1:27583577-27583599 GGAGAGACCTGGCCAGGAGAGGG - Intronic
904160457 1:28518731-28518753 AGGGAGCCCTGCCCGGGAGAGGG + Intronic
905554673 1:38872996-38873018 GGTGAGCCTGGGCTAGGAGAGGG - Exonic
905692787 1:39955364-39955386 TGAACGCCCGGCCCAGGTGAAGG + Exonic
907255691 1:53177056-53177078 GGACAGCCCTGGCCAGGAAAGGG - Intergenic
907271362 1:53293279-53293301 GGTCAGCCCCGCCCAGGAAATGG + Intronic
912879162 1:113391089-113391111 CGGGGGCCCGGCCCAGGACACGG - Exonic
913655304 1:120954640-120954662 TGAGGACCCGGCCCAGAAGAGGG + Intergenic
915269862 1:154746350-154746372 GGAGTGGCAGGCTCAGGAGAAGG + Intronic
915506495 1:156360189-156360211 GGAGGGCCCAGCAAAGGAGACGG - Intronic
915556719 1:156664887-156664909 TGAGAGCCCAGCCCTGGAGTGGG - Intergenic
917587112 1:176438349-176438371 GCAGAGCCTGGCCCATCAGAAGG + Intergenic
917964794 1:180171709-180171731 GGAGAGACCGGGGTAGGAGATGG + Intronic
918260216 1:182789371-182789393 GCAGAGCCCTGCGCAAGAGAAGG + Intronic
919792511 1:201301120-201301142 GGAGCACCAGACCCAGGAGAGGG + Intronic
920080135 1:203367115-203367137 GGAGAGCTAGGCCCCTGAGAAGG - Intergenic
920844329 1:209581111-209581133 GCAGAGCCAGGCACAGGAGGAGG + Intergenic
921685367 1:218083326-218083348 GGAAAGCCCTGCCCAGGAAGAGG - Intergenic
922800939 1:228364499-228364521 GCAGGGCCTGGCCCAGGAGAAGG + Intronic
923641993 1:235772742-235772764 GGGGAGTCAGGTCCAGGAGAGGG - Intronic
923684029 1:236142127-236142149 GGAGCGCGCGGCCCCGGGGATGG + Intergenic
923684079 1:236142244-236142266 GGAGCGCGCGGCCCCGGGGATGG + Intergenic
1065879195 10:30025146-30025168 GAAGGGCCCAGCTCAGGAGAGGG + Intronic
1065997663 10:31074498-31074520 GGAGAGCTCTGCAGAGGAGAGGG + Intergenic
1066126524 10:32347386-32347408 GGAGAGCACGACCCAAGAGCCGG - Intronic
1067078537 10:43201528-43201550 GGACAGCAAGGGCCAGGAGAGGG + Intronic
1070714357 10:78708338-78708360 GGAGAGGACAGCCCAAGAGAGGG - Intergenic
1072294198 10:93993875-93993897 GGAAAGCCCGGCCCAGGGCGGGG + Intergenic
1072656767 10:97335016-97335038 GGAGGCCGCGGCCCAGGAGGCGG - Intergenic
1075658381 10:124176300-124176322 GGATAGCCTGGCCCAGCAGGTGG + Intergenic
1075664505 10:124221070-124221092 GGAGAGCCCAGCCAAGGAGAGGG + Intergenic
1075665048 10:124223957-124223979 CGAGAGCCAGGGCCTGGAGATGG + Intergenic
1075880349 10:125845758-125845780 CGAGAGCCCTGCCCAGGGCAAGG - Intronic
1076526388 10:131115073-131115095 GGAGAGCCCTGCCTGGGAGCAGG - Intronic
1076606074 10:131690890-131690912 AGAGAGCGGGGCCCAGGACACGG - Intergenic
1076746539 10:132517511-132517533 GGAGAGGCCACCCCAGGAGGAGG - Intergenic
1076903987 10:133353219-133353241 GTAGACCCAGGCCCAGGACATGG + Intergenic
1077196538 11:1283809-1283831 AGAGCGCCCGGCCCAGAAGTTGG + Intronic
1077474116 11:2778415-2778437 AGACAGCTGGGCCCAGGAGAAGG - Intronic
1077488745 11:2850875-2850897 GGAGAGCCTGGCAGAGGAGGTGG - Intergenic
1077535536 11:3122326-3122348 GGTGAGCCCGGGCCCGGGGAGGG - Exonic
1077571424 11:3341479-3341501 GCAGAGGCCAGGCCAGGAGAGGG + Intronic
1077791244 11:5442383-5442405 GGAGAGCCTGTCCTTGGAGAAGG - Intronic
1080012419 11:27472311-27472333 GGAGAGGCCGGCGCGGGAGGCGG - Exonic
1081976612 11:47239419-47239441 GGAGACCCCAGCCCAGCTGAGGG + Exonic
1082791150 11:57347534-57347556 GGAGAGCCCGTCGTTGGAGAGGG + Intronic
1082990635 11:59204882-59204904 GGACAGCACTGCCCAGGAGAAGG + Exonic
1083258438 11:61510343-61510365 GGAGGGCCTGGCCCAGGAGCAGG + Exonic
1083303030 11:61748647-61748669 GTAGAGGCCAGCCCAGGAGAAGG - Intergenic
1083614118 11:64018103-64018125 GGGGAGGCCAGGCCAGGAGATGG + Intronic
1083690802 11:64407386-64407408 GGAAGGGCCGGCTCAGGAGAAGG + Intergenic
1083933119 11:65856946-65856968 GGGGTGCCCGAGCCAGGAGAGGG + Intronic
1084437529 11:69152953-69152975 ATAAAGCCCGACCCAGGAGAAGG - Intergenic
1084589922 11:70084647-70084669 GGTGAGGCCAGCCCAGGACAGGG - Intronic
1084708513 11:70829826-70829848 GCAGAGCCTGGCCCAGGACCGGG - Intronic
1084793358 11:71489025-71489047 TCAGAGGCAGGCCCAGGAGAAGG + Intronic
1084860759 11:72016434-72016456 GGATAACCCACCCCAGGAGAAGG - Exonic
1085031771 11:73275441-73275463 GGACAGACCTGCACAGGAGAAGG + Intronic
1085052119 11:73385204-73385226 GGAGGGCCCTGCCTAGGGGAGGG + Intronic
1085052603 11:73387561-73387583 GGAAAGCCAGGGACAGGAGAAGG - Intronic
1085777398 11:79379091-79379113 GCAGAGACAGGCCCAGGGGAAGG + Intronic
1088193339 11:107250221-107250243 GCAGAGGCAGGCCCAGGTGAGGG + Intergenic
1088952265 11:114583856-114583878 GGAGAGTACTTCCCAGGAGATGG + Intronic
1089088900 11:115849589-115849611 GGAGGGCCCTGCTCTGGAGATGG - Intergenic
1091229871 11:133981364-133981386 GGTGACCGCGCCCCAGGAGAGGG + Intergenic
1091319502 11:134639903-134639925 GTAGAGGCGGGCCCTGGAGAAGG + Intergenic
1091319511 11:134639930-134639952 GTAGAGGCGGGCCCTGGAGAAGG + Intergenic
1091319520 11:134639957-134639979 GTAGAGGCGGGCCCTGGAGAAGG + Intergenic
1091319529 11:134639984-134640006 GTAGAGGCGGGCCCTGGAGAAGG + Intergenic
1091319538 11:134640011-134640033 GTAGAGGCGGGCCCTGGAGAAGG + Intergenic
1091319558 11:134640065-134640087 GTAGAGGCGGGCCCTGGAGAAGG + Intergenic
1091806861 12:3363089-3363111 GGAGAGACAGGCCCTGGACAGGG - Intergenic
1092182112 12:6453063-6453085 GCAGAGCCCCACCCAGCAGAGGG + Exonic
1092529429 12:9332200-9332222 GGAGTGCCCAGGCCAAGAGACGG - Intergenic
1094502067 12:31030660-31030682 GGCCAGCCCAGCCCAGGAGGAGG + Intergenic
1096658314 12:53105386-53105408 GCAGAGCGAGGCCCAGTAGATGG - Intronic
1096771613 12:53939188-53939210 GGACATCCCGGCCCCGGAGGCGG + Exonic
1097013112 12:55966969-55966991 GGTCAGCCCGGCCCTGGAGCGGG - Exonic
1098163379 12:67669302-67669324 AGTGAGCCAGGCCAAGGAGAGGG - Intergenic
1098595760 12:72272282-72272304 CGAGAGCGCGGCGCAGGGGAGGG + Intronic
1100589760 12:96015859-96015881 GGGAAGCCCAGCCCAGCAGATGG + Intronic
1100712714 12:97275379-97275401 GCCGAGCCCGCTCCAGGAGACGG + Intergenic
1101823576 12:108202959-108202981 AGAGAGACCTGCCCAGGAGGAGG - Intronic
1103004247 12:117408746-117408768 GGACAGCTGGGCCCAGGTGACGG - Intronic
1103204645 12:119118953-119118975 GGAGAGGCTGGACCAGGAGTAGG - Intronic
1103562793 12:121800860-121800882 GGGGAGCCCGGAGCAGGAGGCGG - Intronic
1105682643 13:22745086-22745108 GGAGAGCCCGGGCCACTAAACGG - Intergenic
1108534340 13:51358133-51358155 ATAGCACCCGGCCCAGGAGAGGG - Intronic
1109104893 13:58238865-58238887 GGAGATCCCAGCACAGGAAAGGG + Intergenic
1113154421 13:107302202-107302224 GCAGAGCCCACACCAGGAGAAGG + Intronic
1113429818 13:110240387-110240409 GCAGAGCCCGGGCCAGGACTGGG - Intronic
1113651952 13:112039740-112039762 GGAGATCCAGGCTCTGGAGATGG - Intergenic
1114620113 14:24090731-24090753 GGAGAGCCTGGCCCACCAGCTGG - Intronic
1115752445 14:36505938-36505960 GGGGACCCCGGCGCAGGAGGAGG - Intronic
1118350176 14:64968020-64968042 TGAGAGCCTGGCCAAGGAGGTGG - Intronic
1119385724 14:74257281-74257303 GGAGACCCCCGCCAAGGAAAGGG - Intronic
1120183168 14:81366474-81366496 GGAGAGCCCAGCTCAGCTGAGGG + Intronic
1121018011 14:90560122-90560144 GGAAAGGCAGGCACAGGAGACGG - Intronic
1121314128 14:92951078-92951100 GGAGAGGCCAGCCCAGGACAGGG + Intronic
1122444722 14:101760835-101760857 GGAGGGCCCGGCCAAGGGGAGGG + Intergenic
1122444738 14:101760869-101760891 GGAGGGGCCGGTCGAGGAGAGGG + Intergenic
1122861240 14:104583246-104583268 GCAGAGCGTGGCCCAGGGGAAGG + Intronic
1122913402 14:104844604-104844626 GGAGGCCCAGGCCCTGGAGATGG + Intergenic
1123112901 14:105881344-105881366 GGGGATCCAGGGCCAGGAGATGG - Intergenic
1124453748 15:29822159-29822181 GAAGGGCCCGGCCCAGGGGGAGG + Exonic
1124594896 15:31084035-31084057 GGGAACCCTGGCCCAGGAGAGGG - Intronic
1125886005 15:43230041-43230063 GGAGAGCCAGGACTAGGAGAAGG + Intergenic
1126345519 15:47689784-47689806 GGAGAGACATGCCCAGAAGAAGG - Intronic
1126369623 15:47932398-47932420 GAAGAGGCGAGCCCAGGAGAAGG + Intergenic
1126436655 15:48644883-48644905 GAGGAGCCCGGCCCGGGGGACGG - Exonic
1127854483 15:62943241-62943263 GGTGAGCCAGGCCAAAGAGAGGG + Intergenic
1127867125 15:63042317-63042339 GGAGAGCGCGGACCAGGTGGTGG - Intergenic
1128305135 15:66593379-66593401 AGAGAGGCAGGCCCAGGAGGTGG + Intronic
1128684105 15:69671076-69671098 GCAGAGCACAGCCCAGGAGATGG + Intergenic
1128743366 15:70097718-70097740 GGAGAGCCGGGCCGAGGGGAAGG - Exonic
1128794156 15:70452508-70452530 GGAGAAACCGGCTCAAGAGAGGG + Intergenic
1129355243 15:74986496-74986518 TGAGAGCCAAGCCCAGGAGAGGG + Intronic
1129606633 15:77028292-77028314 GAAGAGCACAGCCCAGGAGGCGG + Intronic
1129607034 15:77030030-77030052 GGAGAGGCCTTCCCAGGGGAAGG - Intronic
1129933783 15:79432549-79432571 GGAGAGCCCGGGCCGGGCGGAGG + Intronic
1130415084 15:83686014-83686036 GAAGAGGCCAGACCAGGAGAAGG - Intronic
1130879938 15:88046326-88046348 TCAGAGCCCAGCACAGGAGAAGG - Intronic
1131090977 15:89624841-89624863 GGAGAGCCAGGCCCACAGGAAGG - Exonic
1131400757 15:92123942-92123964 GGACTGCCCAGCTCAGGAGAAGG - Intronic
1132399530 15:101496881-101496903 GCAGAGCCCGGCGCAGGTGTGGG - Intronic
1132577882 16:672264-672286 GAAGAGGCTGGACCAGGAGAAGG + Exonic
1132620912 16:867915-867937 GGAGACCCCAGCCAAGGAGCCGG - Intronic
1132697207 16:1207327-1207349 GTAGAGGGCGGCCCAGGAGGAGG - Exonic
1132711860 16:1272428-1272450 GGAGAGGCTGGCCCGGGAGGGGG - Intergenic
1132996855 16:2827953-2827975 GCAGAGCCCAGGCCAGGGGAGGG - Intergenic
1133316190 16:4885501-4885523 GAAGAGCCGGGCGCAGGAGAAGG - Exonic
1133817678 16:9210563-9210585 GGAAAGCACAGCCAAGGAGAGGG - Intergenic
1134378401 16:13701236-13701258 GAACATCCAGGCCCAGGAGAAGG - Intergenic
1136061839 16:27731956-27731978 GGAGAGCCAGGCCCTGCAGGAGG + Intronic
1136141873 16:28293300-28293322 GGTAAGCCGGGCCCAGGTGAGGG + Exonic
1136235431 16:28910902-28910924 CGTGAGCCAGGCCCAGGAGCGGG - Exonic
1136278087 16:29191405-29191427 GGAGAGCCCTCACCAGGACACGG - Intergenic
1137628043 16:49921895-49921917 GGAGAGCCAAGCCCAGCTGATGG + Intergenic
1137630597 16:49941010-49941032 GGAGCTCCCGCCCCTGGAGATGG + Intergenic
1137732593 16:50699636-50699658 AGAGAGGCTGGCCCAGGAGGTGG - Exonic
1138479151 16:57290290-57290312 GGAGTGCCAGGCCCTGGGGATGG + Intergenic
1139434089 16:66926223-66926245 GGATACCCCAGCCCAGAAGAGGG + Intergenic
1141630321 16:85284136-85284158 GATGCCCCCGGCCCAGGAGAAGG + Intergenic
1142035817 16:87861626-87861648 TGAGAGCCACCCCCAGGAGAGGG - Intronic
1142123345 16:88397971-88397993 CCAGAGCCGGGCACAGGAGATGG + Intergenic
1142180063 16:88663929-88663951 GGGGATCCTGGCCCAGGACATGG - Intergenic
1142294362 16:89210771-89210793 GGTGAGCCTGGGGCAGGAGAAGG - Intergenic
1142366283 16:89651688-89651710 GGAGAGCCGGGCCTGGGGGATGG - Intronic
1142764181 17:2056477-2056499 GGCCCGCCCGGACCAGGAGAAGG - Intronic
1142795437 17:2303596-2303618 GGCAGGCCCGGCCCAGGAGCTGG + Intronic
1143387953 17:6543242-6543264 GGAGACCCAGGCCCATGACAAGG - Intronic
1143589747 17:7875420-7875442 GGAGAGCTCAGCCCAGGAGCTGG - Intronic
1144607908 17:16684196-16684218 GGAGAGGCTGACCCAGGGGATGG + Intergenic
1145196927 17:20901988-20902010 GGAGAGGCTGACCCAGGGGATGG - Intergenic
1146017671 17:29246941-29246963 GCAGAGACATGCCCAGGAGAGGG + Intronic
1146773119 17:35587362-35587384 GGAGAGCACAGCCCAGGTGGTGG - Exonic
1147970991 17:44219106-44219128 GGGGAGCCGAGCCAAGGAGAGGG + Intronic
1148752373 17:49952633-49952655 GCAGAGCCTGCCCCAGCAGAAGG - Intergenic
1148779395 17:50112949-50112971 GGAGCGCAAGGCCCAGGAGAAGG - Exonic
1148783962 17:50136173-50136195 GCAGAGCCTGGAGCAGGAGAAGG - Exonic
1149446376 17:56716549-56716571 AGGGAGCTGGGCCCAGGAGAGGG - Intergenic
1149602658 17:57903288-57903310 GGAGAACCCAGACCAGGACAGGG - Intronic
1150561891 17:66302225-66302247 GGAGAGCCGGGCGCAGGAAGGGG + Intergenic
1151325305 17:73376216-73376238 GGAGAGCCAGGTCCATGAGGAGG - Intronic
1151326569 17:73383459-73383481 GGACAGCCCGGTGCATGAGAAGG - Intronic
1152345457 17:79748260-79748282 GCAGGGCCCGGCCGCGGAGAGGG - Intergenic
1152407885 17:80107913-80107935 GGAGACCCCGGCCCGGGCGCTGG - Intergenic
1152551892 17:81034450-81034472 AGAGAGCTCGGCCCTGGAGTGGG - Intergenic
1152639999 17:81445383-81445405 GGAGGAGCCCGCCCAGGAGAAGG + Exonic
1152735831 17:81996343-81996365 GGTGAGCCTGGGCCGGGAGAGGG + Intronic
1153585639 18:6617397-6617419 GGAGAGCCCGGCCCAACCCAAGG + Intergenic
1153618369 18:6954228-6954250 GGAGACCAAGGCCAAGGAGATGG - Intronic
1153814863 18:8783501-8783523 GGAGAGAACAGCCCGGGAGAAGG - Intronic
1154166111 18:12015580-12015602 GGAGAGCCCAGAGCAGGGGAAGG + Intronic
1154329528 18:13418238-13418260 GTAGAGCCCTGCCCAGGTGGAGG - Intronic
1155392645 18:25351944-25351966 GGAGAGCCGGGAGCAGGAGGAGG + Intronic
1156535939 18:37864615-37864637 GCAGAGCCAGGCCCAGAAAAAGG - Intergenic
1157147859 18:45183820-45183842 GGATAGCTTGGCCCAGGAGTTGG - Intergenic
1159954245 18:74508104-74508126 GCAGACCCAGGCCCACGAGAAGG + Intronic
1160384729 18:78488246-78488268 GGAGAGGCCGCCCCAGGAGGAGG - Intergenic
1160497134 18:79382276-79382298 GGAGAGCTCGGGCGAGGAGAAGG + Intergenic
1160509848 18:79447268-79447290 GGGGAGCCCGGGCCAGGGGACGG - Intronic
1160510407 18:79450540-79450562 GCAGAGAGCGGCCCAGGGGAGGG - Intronic
1160623723 18:80188802-80188824 GGAGAGACAAGCCCACGAGATGG + Intronic
1160903490 19:1440852-1440874 GGAGAGCCCAGGCCAGGTGAGGG - Exonic
1161028804 19:2048655-2048677 GGAGACCCAAGGCCAGGAGATGG + Intronic
1161072794 19:2270873-2270895 GGAGGGCCCGGGCCTGGAGCGGG + Intronic
1161156163 19:2732837-2732859 GGAGATCCTGGCCAAGGAGCTGG - Exonic
1161355777 19:3819008-3819030 TGAGAGCCGGGCCCTGGGGAAGG + Intronic
1161579395 19:5072367-5072389 GGAGAGCACATGCCAGGAGAGGG - Intronic
1162194998 19:8977702-8977724 GCAGAGCCAGGATCAGGAGATGG + Exonic
1162198980 19:9007681-9007703 GTACTGCCCGTCCCAGGAGAAGG - Intergenic
1162302958 19:9854588-9854610 GGAGAAGCCGCCCCAGGAGTAGG + Exonic
1162459209 19:10804161-10804183 TTAGATCCAGGCCCAGGAGAGGG + Intronic
1162876218 19:13622870-13622892 TGAGAGACTGACCCAGGAGAAGG - Intronic
1163784099 19:19265812-19265834 GGGGTGCAGGGCCCAGGAGATGG - Intronic
1165161838 19:33820919-33820941 GGAGAGCCTGGGCCTTGAGAGGG - Intergenic
1165694170 19:37888003-37888025 GAAGAATCTGGCCCAGGAGAAGG - Exonic
1165779773 19:38425708-38425730 GCAGGGCCTGGCCCAGGAGAGGG - Intronic
1166302757 19:41921710-41921732 GGCGAGCCCGGCCCTGGAGGTGG + Intronic
1166723597 19:45011983-45012005 GGACAGCCGGGCCCGGGCGAGGG + Exonic
1166783623 19:45354874-45354896 GGAGGACCTGGGCCAGGAGAGGG - Intronic
1167320932 19:48796821-48796843 GGAGAGACAGACCCAGGAGAAGG + Intronic
1167648712 19:50718790-50718812 GGAGAACCCGGCCGGGGAGAGGG + Intronic
1167713330 19:51125462-51125484 GGAGCCCCTGCCCCAGGAGAGGG + Intronic
1168187778 19:54710521-54710543 GGAGGGCCCAGCCCATGAGAGGG + Intergenic
1168246429 19:55114964-55114986 GGAGAGCCAGGGGCATGAGATGG + Intronic
1168344281 19:55642758-55642780 GGAGAGCCCGGCCCTCGCAAGGG + Exonic
926108327 2:10166325-10166347 GGACAGCAGGGCCCGGGAGAAGG - Intronic
926375073 2:12219214-12219236 GGAGAGCCCTGACCAGGGGATGG + Intergenic
927929092 2:27032856-27032878 GGAGAGCCCGGCCCAGGAGAGGG + Intergenic
928366119 2:30704810-30704832 GGAGAGACAAGCCCAGGAGCAGG + Intergenic
928511859 2:32010376-32010398 GATCAGCCCGGCCCAGGAGGAGG + Exonic
930270423 2:49250122-49250144 TGAGAGGCAGGCCCAGGAGTGGG + Intergenic
932126830 2:69152210-69152232 GGAGAGCCAGGGCTAGGAGCAGG - Exonic
932616194 2:73233157-73233179 GCCGGGCCCGGCCCTGGAGATGG - Exonic
932624141 2:73284493-73284515 GGAGAGCCCGCCCCGGAGGAGGG - Intergenic
932699905 2:73985215-73985237 GGGGGGCCCGGCCCGGGGGAGGG + Intergenic
934522018 2:95025652-95025674 GGGGAGCCCGGGGCAGAAGAGGG - Intergenic
934888458 2:98045413-98045435 GGAGCTCCTGGGCCAGGAGAAGG + Intergenic
935442982 2:103123493-103123515 GAGGAGCACCGCCCAGGAGAAGG - Intergenic
935731135 2:106065690-106065712 GGAGAACCGGGCGCGGGAGAGGG - Exonic
935815590 2:106843496-106843518 GGGGAGCCAGGCCCACGGGAGGG - Exonic
936463015 2:112725530-112725552 GGACATCTGGGCCCAGGAGAAGG + Exonic
938067922 2:128292012-128292034 GAAGGGTCCGGCTCAGGAGAAGG + Intronic
938127816 2:128687100-128687122 TTAGAGCCCTGCCCAGGACAGGG + Intergenic
938903446 2:135817665-135817687 GAAGATCCGGGACCAGGAGATGG + Exonic
941686978 2:168456869-168456891 GGAGAGCAGGGCCCAGGAGGAGG - Intronic
944183821 2:196926436-196926458 GGAGCGCCCGGCTGAGGAGAGGG + Intronic
944423698 2:199557536-199557558 GGAGAGCCTAGCACAGGAGGCGG - Intergenic
945404008 2:209423794-209423816 GGAGAGCCCCGCCCAGCCGCTGG - Intergenic
946382485 2:219358511-219358533 GGAGGCCCCGGCCCAGGACTGGG + Intergenic
947202229 2:227624273-227624295 GGAGAGGCCAGCAAAGGAGACGG + Intronic
947859389 2:233348109-233348131 GCAGAGCCCAGCCCTGGAGATGG + Intergenic
948399961 2:237676790-237676812 ACAGTGCCCGGCCCAGGAGATGG + Intronic
948454896 2:238100401-238100423 TGAGAGCCCGGGCCAGAGGATGG + Exonic
949003033 2:241628249-241628271 TCAGTGCCCGGCCCAGGAGCAGG - Intronic
1172363869 20:34334007-34334029 GGAGAGGCCCACCCAGGAGCTGG - Intergenic
1172617242 20:36297495-36297517 GGAGAGACCGAGCCTGGAGAGGG - Intergenic
1172755935 20:37284316-37284338 GCAGAGATGGGCCCAGGAGATGG - Intergenic
1173227808 20:41172137-41172159 CTACAGCCCTGCCCAGGAGAAGG - Intronic
1173570368 20:44071831-44071853 GGAGAACCTGGCCCACGACAAGG - Intergenic
1174035890 20:47668020-47668042 GGAGAGAAGTGCCCAGGAGAAGG - Intronic
1174171565 20:48620994-48621016 GGCAAGCCCAGCCCAGGAGAGGG + Intergenic
1174580638 20:51569123-51569145 GGAGGGCATGGCCCAGGAGCAGG - Intergenic
1174650973 20:52125317-52125339 GGAGAGCCAGGCTCAGGTGATGG + Intronic
1175408696 20:58752119-58752141 GGAGGCCCCGGACCAGGGGAAGG + Intergenic
1175446580 20:59024275-59024297 GGTGAGCTCGGCCACGGAGAGGG - Exonic
1175530384 20:59670873-59670895 GGTGAGCAACGCCCAGGAGATGG - Intronic
1175597915 20:60250160-60250182 AGAGAGCCCAGCAAAGGAGAGGG - Intergenic
1175722156 20:61294010-61294032 GGAGACCCCGGGACAGGTGAAGG + Intronic
1176038132 20:63050197-63050219 GGGAAGCCCGGCCCAGGGCAGGG + Intergenic
1176056731 20:63152857-63152879 GGAGAGCCAGGCCCGGGGGTAGG + Intergenic
1178238402 21:30870728-30870750 GGAGAAACCGGCCCGCGAGATGG - Intergenic
1178839969 21:36130338-36130360 GATCAGCCCGGCCCAGGAGGAGG - Intergenic
1179523682 21:41961750-41961772 GGAGAGCCCGGAGGAGGAGCTGG - Intergenic
1179809987 21:43864697-43864719 GGAGACCCCGGCAGGGGAGATGG + Intergenic
1180078553 21:45475578-45475600 GGAGAGCCCCTCCCAGCAGTGGG + Intronic
1180157948 21:45987074-45987096 TGAGGCCCCTGCCCAGGAGACGG + Intronic
1180963082 22:19771186-19771208 GCAGAGCCTGGCCAAGGAGCAGG + Intronic
1180988861 22:19921654-19921676 GGAGAATCCAGCACAGGAGAGGG + Intronic
1181033508 22:20159229-20159251 GGACAGCCCATCCCAGGAGCTGG + Intergenic
1182471880 22:30553856-30553878 GGAGAGACAGGCACTGGAGATGG + Intergenic
1183079642 22:35448258-35448280 GGAGAGCCTGGCCTACGGGAAGG + Intergenic
1183458783 22:37937096-37937118 GGAGGACCGGGCCCGGGAGAAGG + Exonic
1184250236 22:43255986-43256008 GGAGAGGCAGGCACAGGACAAGG + Intronic
1184649563 22:45913394-45913416 GGCTAGCCGGGCCCAGGAGCAGG - Intergenic
1184839654 22:47045051-47045073 GGAGAGACCGCCCCATGTGAAGG - Intronic
1184977933 22:48076319-48076341 GGAGAGCAAGGCCCAGAAGGAGG + Intergenic
1185071803 22:48660749-48660771 AGAGACCCCGGCCTGGGAGAGGG - Intronic
1185269664 22:49923178-49923200 GGACAGCCCGGCCAGGGAGCGGG - Intronic
1185347244 22:50315948-50315970 GGACCACCCGGCCCAGGAGCAGG + Intronic
950005419 3:9688186-9688208 GGAGAAGCCAGCCCAGGAGTAGG + Intronic
950415933 3:12869104-12869126 AGAGAGCCCGGCCTGGGAGGCGG - Intronic
950417381 3:12876219-12876241 AGAGAGCCCGGCCTGGGAGGCGG - Intergenic
953679838 3:45030870-45030892 GGACACCCTGGCCCAGGAGGTGG + Exonic
953930990 3:47005546-47005568 GGAGAGCCCTGCCGATGTGAAGG + Exonic
954682105 3:52351400-52351422 TCAGGGCCCTGCCCAGGAGAGGG + Intronic
954881552 3:53839063-53839085 GGGGAGCCCGGACCAGCAGAAGG + Intronic
955846395 3:63167620-63167642 GCACAGCCCAGCCCAGAAGAGGG - Intergenic
957039969 3:75329159-75329181 GGAGATCCCAGCCAAGCAGATGG - Intergenic
958814482 3:98901234-98901256 GGGGAGCGCGGCCCAGGCGGGGG + Exonic
960275173 3:115720917-115720939 GGAGAGACAGGCTCAGGAGAGGG - Exonic
961044749 3:123700698-123700720 GGAGATCCCAGCCGAGCAGATGG - Exonic
963537310 3:146544509-146544531 AGAGAGCCGGGGCCAGGCGATGG + Exonic
965671941 3:171156665-171156687 TGAGAGTCTGGCCCAGGACAAGG + Intronic
966023967 3:175252485-175252507 GGAGAGGGAGGCCCAGGAGAGGG - Intronic
966194311 3:177298120-177298142 GGAGAGAGCTGCCCAGGAGGTGG + Intergenic
968091577 3:195901340-195901362 GGAGAGCCCTGCCAAGGTCAGGG + Intronic
968434319 4:576777-576799 GGAGAGCCTGGGTAAGGAGAAGG + Intergenic
968472999 4:790447-790469 GGAGAGTGAGGCCCAGGAGAGGG - Intronic
968481208 4:833854-833876 ACAGAGCCCTGCCCAGGAGCTGG + Intergenic
968564699 4:1305294-1305316 GGTGAGCCCGGCCCTGGTGAGGG + Intronic
968883882 4:3317136-3317158 CGGGAGCCTGGCCCAGGAGGAGG + Exonic
968929725 4:3572464-3572486 GGAGAGCCAGCCCCAGGACGCGG + Intergenic
969325320 4:6440786-6440808 GGAGAACCCAGCCTAGCAGAGGG - Intronic
969352136 4:6604059-6604081 GGATGGCCCCTCCCAGGAGAAGG + Intronic
976431319 4:84966231-84966253 GGCGGGACAGGCCCAGGAGACGG + Exonic
978576718 4:110196779-110196801 GGTGCGCGCGGCCCAGGAGGCGG + Intronic
982110189 4:152046277-152046299 AAGGAGCCCGGGCCAGGAGAGGG + Intergenic
984999439 4:185469954-185469976 GCAGAGCACGGGGCAGGAGAAGG - Intronic
985662333 5:1163510-1163532 GCAGGGGCCGGCCCTGGAGATGG - Intergenic
986233408 5:5886503-5886525 GGAGAGCCGGGCCCACGCCACGG + Intergenic
987371117 5:17193867-17193889 GGAGAGACAAGCCAAGGAGAGGG + Intronic
988482176 5:31639652-31639674 GGAGGGCGCAGCCCAGGGGAGGG + Intronic
991029592 5:62068785-62068807 GAAAACCCAGGCCCAGGAGAGGG + Intergenic
996334014 5:122363520-122363542 GGAAAGTGAGGCCCAGGAGAAGG + Intronic
997111471 5:131079620-131079642 GGAGAGCCCAACACATGAGAAGG + Intergenic
997884346 5:137616763-137616785 GCGGAGGCCAGCCCAGGAGAGGG + Intergenic
998039692 5:138944468-138944490 GGTCAGCCCAGCCCAGGAGCAGG + Intergenic
998591780 5:143486469-143486491 GAAGATCACAGCCCAGGAGAGGG + Intergenic
999205181 5:149842504-149842526 GGAAAGCCAGGCCCATGAGAAGG + Intronic
1001556625 5:172641445-172641467 GGGGAGCCCTGCCCGGGAGGCGG + Intronic
1002198547 5:177514066-177514088 TGAGAGGCTGACCCAGGAGAAGG - Intronic
1002372094 5:178762981-178763003 GGAGAGGCCGACCCAGGAATTGG + Intergenic
1002405064 5:179024033-179024055 GGTGAACCCGGCCCCGGAGGGGG + Intronic
1002474691 5:179457822-179457844 GGAGGGCCCGGGACAGAAGACGG + Intergenic
1002716855 5:181233542-181233564 GGAGAGGAGGGTCCAGGAGATGG - Intronic
1004479541 6:16005667-16005689 GGAGAGCCAGCCCGAGGACAAGG - Intergenic
1006304502 6:33211222-33211244 GGAGAGCCCGGGGAGGGAGAAGG + Exonic
1007229766 6:40340081-40340103 TGACAGCCCAGCCCAGGACAAGG - Intergenic
1009762817 6:68029577-68029599 GCACAGCGCTGCCCAGGAGAGGG - Intergenic
1014104658 6:117548189-117548211 GGAGAAGCCGCCCGAGGAGAGGG - Intronic
1014121389 6:117729384-117729406 GGAAAGCTGGGGCCAGGAGAAGG - Intergenic
1014432939 6:121390650-121390672 GGTGAGCCCTGCTTAGGAGAAGG - Intergenic
1017449032 6:154536714-154536736 GCAGACCCCGCACCAGGAGAGGG + Intergenic
1018190208 6:161304009-161304031 TGAGCGCCAGGCCCAGGACACGG - Intergenic
1018229293 6:161660644-161660666 GGAAAGAGCGGCCCAGGACATGG - Intronic
1018291139 6:162293526-162293548 GGAGATCACCGCCCTGGAGAGGG + Intronic
1018726449 6:166616552-166616574 GGACAGCCAGGCTCAAGAGAGGG + Intronic
1018935088 6:168269105-168269127 GGAGATCCCAGCCCTGAAGATGG + Intergenic
1019329588 7:455901-455923 GGAGAGACCAGACCAGGAGGGGG + Intergenic
1019397697 7:831007-831029 GAGGAGCCCGGCACAGGACAGGG - Intronic
1019530654 7:1501640-1501662 CGAGAGCCCGGGCCAGGATGAGG + Intronic
1020120241 7:5499158-5499180 GGAGAGGTCGGCTCAGGAGGGGG - Intronic
1021963128 7:25892147-25892169 GGAGCTCCAGGCCCAGGAGGGGG - Intergenic
1024058206 7:45679643-45679665 GGAGAGGCGGACCCAAGAGATGG - Intronic
1024251626 7:47509772-47509794 GCTGAGCCGGGCCCAGGAGGTGG - Intronic
1026554113 7:71391302-71391324 GTAGAGCCCAGCCCAGGAGGAGG + Intronic
1026681867 7:72473014-72473036 GTGGACCCTGGCCCAGGAGATGG - Intergenic
1028963982 7:96781032-96781054 GGAGAGCCTGGTCCAAGTGAGGG + Intergenic
1029595837 7:101537283-101537305 GTAAAGCCCGGGGCAGGAGAGGG - Intronic
1029734331 7:102457251-102457273 TGTGAGCCCTGCCCAGGAGCAGG - Exonic
1030065174 7:105653833-105653855 GGAGAGCCCGGCCCACAGAAAGG - Intronic
1031988155 7:128177240-128177262 GGAGGGCCAGGTTCAGGAGATGG + Intergenic
1033436135 7:141335181-141335203 AGAGAGTCTGGCCCAGCAGAAGG + Intronic
1034075239 7:148225259-148225281 GGAGGGCCTGGCCAAGGGGAAGG + Intronic
1034162119 7:149001585-149001607 GGAGAGGCCGACTCAGGAGCTGG - Intergenic
1035032418 7:155870088-155870110 GGCGACCCTGGCCCATGAGAAGG - Intergenic
1035417937 7:158705093-158705115 GGAGTGCGCGGTCCAGGAGAGGG + Intergenic
1035444274 7:158929322-158929344 GAAGACCCCAGCCCGGGAGAGGG + Intronic
1035695455 8:1592167-1592189 GGAGAGCTGCGGCCAGGAGATGG - Intronic
1036662318 8:10716253-10716275 TGAGAGCCCTGCCCAGGGAAGGG - Intergenic
1037820660 8:22133292-22133314 GCAGCCCCCGGCCCAGGGGAGGG + Intronic
1037892380 8:22630119-22630141 GCAAAGCCAGGCCCAGGACAAGG - Intronic
1043399686 8:79871770-79871792 GGAGAGCCAGACCCGGGAGCTGG - Intergenic
1045679172 8:104640479-104640501 GGAGAGGCGGACCCAGGAGGAGG + Intronic
1048437580 8:134432470-134432492 GGAGAGACTGGGGCAGGAGAAGG + Intergenic
1048987265 8:139741204-139741226 GGAGTGCCACGCCCAGGGGAGGG - Intronic
1049081301 8:140445412-140445434 GGAGAGGACAGCCCAGGACAAGG + Intronic
1049427018 8:142542230-142542252 GCTGAGCCGGGCCCAGGAGAAGG + Exonic
1049560561 8:143307979-143308001 GGAGAGGGCGGCAGAGGAGAGGG + Intronic
1049772813 8:144391588-144391610 GGGGACCCTGGCCCAGGAGCTGG + Exonic
1056403241 9:86248663-86248685 GGAGTGCCAGGCCCAGCAGGGGG - Intronic
1057019049 9:91681612-91681634 GGAGAGCCGGGCGCCGGGGAAGG - Intronic
1057141487 9:92729155-92729177 GGAGAGCCTGATCCAGGAGTCGG - Exonic
1057335794 9:94154092-94154114 TGAGAGCACAGCCCAGGAAACGG + Intergenic
1058176095 9:101738007-101738029 GGCGAGCCGGGCGCAGGAGGGGG - Exonic
1058917204 9:109579097-109579119 GGAGAGGCTGGGCCTGGAGATGG + Intergenic
1060139846 9:121201077-121201099 GGGGAGCCCGGCCCTGCAGCCGG - Intronic
1060187196 9:121570901-121570923 GGAGAGAGAGCCCCAGGAGAAGG - Intronic
1060766035 9:126295691-126295713 GGAGAGTCTCGCCAAGGAGAGGG + Intergenic
1061028112 9:128063586-128063608 GGAGCGCCAGGCCCAGGCCATGG - Exonic
1061478567 9:130885035-130885057 GCAGAGCCCGAGCCAGGAGGCGG + Exonic
1061913088 9:133735152-133735174 GGAGGGGCCTGCCCAGGAGGAGG - Intronic
1062281085 9:135751991-135752013 GGAGAAACAGGCCCAGCAGATGG - Intronic
1185460747 X:331870-331892 CGAGAGCCCCGCCCAGAACAAGG - Intergenic
1185595747 X:1305682-1305704 GAAGACCCCGACCCGGGAGAAGG - Intronic
1187682324 X:21779653-21779675 GGTGAGCCTGGCCCAGGCAAAGG + Intergenic
1197041620 X:121943417-121943439 GGATCACCTGGCCCAGGAGATGG + Intergenic
1200052961 X:153444533-153444555 GGAGAGCACGGCCCTGGAAGCGG + Intergenic
1200123936 X:153804465-153804487 CGAGAGCCTGGGCCACGAGATGG - Exonic
1201897876 Y:19012850-19012872 GGAGAGAGAGGGCCAGGAGAGGG + Intergenic