ID: 927931733

View in Genome Browser
Species Human (GRCh38)
Location 2:27049983-27050005
Sequence GGCCCACGTGAGGTCGGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 259}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927931733_927931740 -9 Left 927931733 2:27049983-27050005 CCGACCCCGACCTCACGTGGGCC 0: 1
1: 0
2: 0
3: 16
4: 259
Right 927931740 2:27049997-27050019 ACGTGGGCCTCGGAGGCTGCAGG 0: 1
1: 0
2: 1
3: 25
4: 259
927931733_927931741 -8 Left 927931733 2:27049983-27050005 CCGACCCCGACCTCACGTGGGCC 0: 1
1: 0
2: 0
3: 16
4: 259
Right 927931741 2:27049998-27050020 CGTGGGCCTCGGAGGCTGCAGGG 0: 1
1: 0
2: 0
3: 23
4: 208
927931733_927931743 2 Left 927931733 2:27049983-27050005 CCGACCCCGACCTCACGTGGGCC 0: 1
1: 0
2: 0
3: 16
4: 259
Right 927931743 2:27050008-27050030 GGAGGCTGCAGGGACCTACCCGG 0: 1
1: 0
2: 3
3: 32
4: 293
927931733_927931748 26 Left 927931733 2:27049983-27050005 CCGACCCCGACCTCACGTGGGCC 0: 1
1: 0
2: 0
3: 16
4: 259
Right 927931748 2:27050032-27050054 CGCGCGCCGCCCACCATCCCAGG 0: 1
1: 0
2: 1
3: 19
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927931733 Original CRISPR GGCCCACGTGAGGTCGGGGT CGG (reversed) Intronic