ID: 927933119

View in Genome Browser
Species Human (GRCh38)
Location 2:27058414-27058436
Sequence GGCCATTGCAGCCCTGGACA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927933115_927933119 -2 Left 927933115 2:27058393-27058415 CCCACAGGTGGGACGAGCTATGG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG 0: 1
1: 0
2: 0
3: 16
4: 247
927933111_927933119 12 Left 927933111 2:27058379-27058401 CCAAACTGGACTACCCCACAGGT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG 0: 1
1: 0
2: 0
3: 16
4: 247
927933117_927933119 -3 Left 927933117 2:27058394-27058416 CCACAGGTGGGACGAGCTATGGC 0: 1
1: 0
2: 1
3: 4
4: 74
Right 927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG 0: 1
1: 0
2: 0
3: 16
4: 247
927933109_927933119 25 Left 927933109 2:27058366-27058388 CCAGCATGCTGAGCCAAACTGGA 0: 1
1: 0
2: 0
3: 12
4: 133
Right 927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG 0: 1
1: 0
2: 0
3: 16
4: 247
927933114_927933119 -1 Left 927933114 2:27058392-27058414 CCCCACAGGTGGGACGAGCTATG 0: 1
1: 0
2: 0
3: 9
4: 56
Right 927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG 0: 1
1: 0
2: 0
3: 16
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927933119 Original CRISPR GGCCATTGCAGCCCTGGACA TGG Exonic