ID: 927933119

View in Genome Browser
Species Human (GRCh38)
Location 2:27058414-27058436
Sequence GGCCATTGCAGCCCTGGACA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927933111_927933119 12 Left 927933111 2:27058379-27058401 CCAAACTGGACTACCCCACAGGT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG 0: 1
1: 0
2: 0
3: 16
4: 247
927933117_927933119 -3 Left 927933117 2:27058394-27058416 CCACAGGTGGGACGAGCTATGGC 0: 1
1: 0
2: 1
3: 4
4: 74
Right 927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG 0: 1
1: 0
2: 0
3: 16
4: 247
927933115_927933119 -2 Left 927933115 2:27058393-27058415 CCCACAGGTGGGACGAGCTATGG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG 0: 1
1: 0
2: 0
3: 16
4: 247
927933109_927933119 25 Left 927933109 2:27058366-27058388 CCAGCATGCTGAGCCAAACTGGA 0: 1
1: 0
2: 0
3: 12
4: 133
Right 927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG 0: 1
1: 0
2: 0
3: 16
4: 247
927933114_927933119 -1 Left 927933114 2:27058392-27058414 CCCCACAGGTGGGACGAGCTATG 0: 1
1: 0
2: 0
3: 9
4: 56
Right 927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG 0: 1
1: 0
2: 0
3: 16
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927933119 Original CRISPR GGCCATTGCAGCCCTGGACA TGG Exonic
900014382 1:138209-138231 GGCCTCTGCAGGCCTCGACAAGG - Intergenic
900044247 1:493411-493433 GGCCTCTGCAGGCCTCGACAAGG - Intergenic
900065655 1:728317-728339 GGCCTCTGCAGGCCTCGACAAGG - Intergenic
901701148 1:11045326-11045348 GGCCATTGCTGCTCTGCCCAGGG - Intronic
902518437 1:17002274-17002296 GGTCAGTGCTGCCCTGGACCGGG - Exonic
902838592 1:19061658-19061680 GGCCATTCCTGCCCGTGACAGGG - Intergenic
903027989 1:20443168-20443190 TGCCATGGCAGCCCTGGAATGGG + Intergenic
904975130 1:34450250-34450272 GTAAATTGCAGCCCTGGTCATGG - Intergenic
905035295 1:34914194-34914216 GCCTATGGCAGCCCTGGAGAAGG - Intronic
906666856 1:47628136-47628158 GGCCCATGAAGCCCTGGGCATGG - Intergenic
906708319 1:47910960-47910982 GGCCATTCCAGCCTTGGGCAAGG - Intronic
907874879 1:58476075-58476097 GACCAATGCTGCCCAGGACAAGG + Intronic
909873602 1:80777047-80777069 GGCCATTGCAGAACTGAACAGGG - Intergenic
912378797 1:109235284-109235306 GCCCATTGCTGCCCTGCACCGGG + Exonic
912647494 1:111407767-111407789 GGCCAGTGTAGCAATGGACATGG + Intergenic
914947819 1:152081313-152081335 GGCCACAGCAGCCATGGAGAAGG - Intergenic
915835219 1:159171276-159171298 AGCCACTGCAGGCCTGGGCAAGG - Intergenic
916344180 1:163769655-163769677 GGCCAAAGTAGTCCTGGACAAGG - Intergenic
916480531 1:165210523-165210545 GGCCACAGCAGCCCTGCAGAAGG - Intronic
916932744 1:169596098-169596120 GGACATTGCACCCCTGGAGTAGG + Exonic
920046836 1:203138613-203138635 GGCCATTGGTGACCTTGACAAGG + Intronic
920444115 1:206002740-206002762 TGGCATTGCAGCACTGGGCAAGG + Intronic
920863148 1:209727844-209727866 AGCCATTTCAGCCATGGAGAGGG - Intronic
921960693 1:221030772-221030794 ATCCATTGCACCCCTGGCCAAGG + Intergenic
922100439 1:222473866-222473888 GGCCTCTGCAGGCCTCGACAAGG - Intergenic
922262055 1:223951704-223951726 GGCCTCTGCAGGCCTCGACAAGG - Intergenic
922734213 1:227970874-227970896 GGCCTCTGCAGGCCTCGACAAGG + Intergenic
922785360 1:228279842-228279864 GGCCGTTGGAGCCCAAGACAGGG + Exonic
924261642 1:242237634-242237656 TGCCCTTGCAGCCCTGGCCTGGG + Intronic
1065358765 10:24869361-24869383 GCCCATTACAGCCCTGGGGAAGG - Intronic
1066026656 10:31364554-31364576 GGCCACGGCAGCCATGGAGAAGG - Intronic
1066435178 10:35391165-35391187 GGCCAGAGCACACCTGGACAGGG + Intronic
1067473135 10:46550214-46550236 GGCCCCTGCAGGCCTGGAAAGGG - Exonic
1067697612 10:48547358-48547380 GGCAATAGGAGGCCTGGACAGGG - Intronic
1071265909 10:83964781-83964803 GGTCATTAAAGCCATGGACATGG + Intergenic
1071475804 10:86024126-86024148 GCCCATTCCAACCCTGGTCATGG - Intronic
1073059616 10:100725595-100725617 GACCATTGCAGGCCTAGAGAAGG + Intergenic
1074195058 10:111176474-111176496 GTGCATGGCAGCCCTGGACTAGG + Intergenic
1076064382 10:127437767-127437789 GGCCATTGCAGGGCCGGGCATGG - Intronic
1076387772 10:130070313-130070335 GGCCATCGCACCCCCGGACCTGG + Intergenic
1076857155 10:133123000-133123022 GTCCCGTGCAGCCATGGACATGG - Intronic
1076868717 10:133182281-133182303 GGCCAGGGCAGCCCAGGACACGG + Intronic
1076970579 11:129886-129908 GGCCTCTGCAGGCCTCGACAAGG - Intergenic
1078241756 11:9536449-9536471 TGACACTGGAGCCCTGGACAGGG - Intergenic
1078354838 11:10625863-10625885 GGCCAGAGCTGCCCTGGCCAGGG + Intronic
1079135862 11:17775722-17775744 GGACCCTGCAGCCCTGGACGCGG - Intronic
1080746315 11:35111564-35111586 GGCTATTGCTGCCCAGGACTGGG - Intergenic
1081536896 11:44002890-44002912 GACCCCTCCAGCCCTGGACAAGG - Intergenic
1083267251 11:61552343-61552365 GCCCATATCAGCCCTGGACCTGG - Intronic
1084705898 11:70815817-70815839 GCCCACTGCAGTCCTGGCCAAGG + Intronic
1084870826 11:72097612-72097634 GGCCTTTGAAGCTCTGGCCAGGG - Exonic
1085254935 11:75167072-75167094 GGCCATTAGAGCCCTGAATAGGG + Intronic
1085781705 11:79415042-79415064 CCACTTTGCAGCCCTGGACAAGG + Intronic
1086064853 11:82733627-82733649 CGCCTTCGGAGCCCTGGACAAGG - Exonic
1089297437 11:117478469-117478491 GGCCATTGCAGCCCTGCAGCTGG - Intronic
1089731413 11:120521587-120521609 GGCAGATGCAGCCCTGGGCAAGG - Intronic
1090093783 11:123724282-123724304 GGACACTGAAGCCCTGGAAAAGG + Exonic
1096018110 12:48296806-48296828 GGCTATCGGAGCCCGGGACAGGG + Intergenic
1096594402 12:52685461-52685483 GGACATTTAAGCCCTTGACATGG + Intergenic
1096628079 12:52907361-52907383 GGGTATGGCAGCCCTGGAAAGGG + Intronic
1099936156 12:89128358-89128380 GGCCATTGCAGGCCTAGGGAGGG - Intergenic
1103705004 12:122866683-122866705 GGCCACTGCAGCCCTGGTGAGGG - Exonic
1105996395 13:25676499-25676521 GGACATTGCAGCCCTTGTCCTGG + Intronic
1106558506 13:30829975-30829997 GGCCATTGCTGCCCAGCACGAGG - Intergenic
1106564482 13:30872586-30872608 GCTCATTGCAGCCCCGGGCAGGG + Intergenic
1109603106 13:64658334-64658356 GTCTAGTGCAGCCGTGGACATGG + Intergenic
1110627022 13:77663131-77663153 GGCCACGGCAGCCATGGAGAAGG - Intergenic
1112752528 13:102597152-102597174 GCTCATCGCAGTCCTGGACACGG + Exonic
1113513289 13:110872535-110872557 GGACACTGCAGCCCTGGTCATGG + Intergenic
1113825624 13:113251081-113251103 CCCCATTGCAGCACTGTACATGG - Intronic
1115936627 14:38559880-38559902 GGGCATTGGGGCCCTGGACCTGG + Intergenic
1118733056 14:68682812-68682834 GGAGTTTGCAGCCCTGGAAATGG + Intronic
1120805023 14:88737495-88737517 GCCCAGTGCAGCCCGGGACAGGG + Intronic
1122009756 14:98736441-98736463 GTCCATGGCAGCCCAGGCCAGGG + Intergenic
1122410130 14:101521568-101521590 GGGCATTGCATTCCTGGAAAGGG + Intergenic
1123112961 14:105881633-105881655 GGACTTGGCTGCCCTGGACAGGG + Intergenic
1124366419 15:29074911-29074933 GACCATTGCAAACCTGGAAACGG - Exonic
1124957098 15:34366913-34366935 GGCCATTTGAGCCCTGGCAAAGG - Intronic
1126808552 15:52378135-52378157 GGCCATTTCAGGCCTGGATCAGG - Intronic
1131074549 15:89486992-89487014 GGACAGTGCAGCCCGGGACTCGG + Intronic
1132481558 16:168815-168837 GGCCAGTGGAGCCCTGGAGTGGG - Intergenic
1132714628 16:1284596-1284618 GGCCAATGCAGCCCAAGATAGGG + Intergenic
1133021752 16:2969932-2969954 GGCCGGGGCAGCCCTGGACTTGG - Intronic
1134015599 16:10885902-10885924 GCCCAGTGCAGCCCAGGTCATGG + Intronic
1134682839 16:16138436-16138458 GGCCACGGCAGCCGTGGACCTGG + Exonic
1135503895 16:23019953-23019975 GGGCAGTCCAGCCCTGGGCAGGG + Intergenic
1135655682 16:24246847-24246869 GATCACTGGAGCCCTGGACATGG - Intergenic
1136277495 16:29187537-29187559 GGTCATAGCAGCCCTCAACAGGG + Intergenic
1138829670 16:60360194-60360216 GGCCACGGCAGCCATGGAGAAGG - Intergenic
1142155266 16:88530104-88530126 GGCCATTGCACCCCTCCACCAGG + Intronic
1142282751 16:89157049-89157071 GGCCCTTCTAGCCCTGGCCAAGG + Intergenic
1142449669 16:90167596-90167618 GGCCTCTGCAGGCCTCGACAAGG + Intergenic
1142457419 17:64249-64271 GGCCTCTGCAGGCCTCGACAAGG - Intergenic
1143319606 17:6059604-6059626 AGCTAGCGCAGCCCTGGACAGGG - Intronic
1143502594 17:7347872-7347894 GGCCACTGCCCCCCTGCACAGGG + Intronic
1144736280 17:17557303-17557325 GGCCAGTGGAGCCCAGTACAGGG - Intronic
1145728729 17:27156614-27156636 GGCCATTGCAAGCCTGAAAAGGG + Intergenic
1147535279 17:41316799-41316821 GCCCATGGCAGCCCTGGAGCTGG + Intergenic
1148463278 17:47850238-47850260 GGCCATTGCATCCCAGGCCTGGG - Intronic
1151841950 17:76625307-76625329 GACCATGGCAGCCCTGGCCCCGG + Exonic
1152252422 17:79218970-79218992 AGCCATGGCAGCCGTGGAGAAGG - Intronic
1152613489 17:81327436-81327458 GTCCACAGCAGCCCTGGTCACGG - Intronic
1152644488 17:81462557-81462579 GGCCATGGCAGCCATGGATCTGG - Intronic
1152676127 17:81642280-81642302 GAACAGTGCAGCCCTGGGCATGG - Intronic
1153205207 18:2691901-2691923 GGCCACTGCAGCCCTAGTTATGG - Intronic
1154172023 18:12059447-12059469 GGGCAGTGCAACCCTGGATAGGG + Intergenic
1155582395 18:27324465-27324487 GGCCTTTGCTGACCTGGACGAGG - Intergenic
1158169897 18:54585940-54585962 GGCTACTGCAGCCCTGAACAGGG + Intergenic
1159962053 18:74563007-74563029 GAGCCTTGCAGCCTTGGACAGGG - Intronic
1161706263 19:5823526-5823548 GACCAGAGCTGCCCTGGACATGG - Intergenic
1162345159 19:10114483-10114505 GGCCACAGCAGCCCTGGAGCTGG + Exonic
1162612513 19:11767389-11767411 GGCCACTGCGGCCCTGGCCCTGG + Intronic
1164816118 19:31204779-31204801 GCACCTTGCAGCGCTGGACAGGG - Intergenic
1164888083 19:31800409-31800431 AGCCACTGCAGGCCTGGACCGGG + Intergenic
1165762147 19:38327585-38327607 GCCCAGTGGAGCCCGGGACATGG - Exonic
1165889347 19:39101140-39101162 GGCCTTTGCGGACCTGGGCAGGG - Exonic
1166864509 19:45827799-45827821 GGTCAGTGCAGCCCGGGGCAGGG - Intronic
1166884868 19:45954218-45954240 GCCCACAGCAGCCCTGGGCAGGG + Intronic
1166918084 19:46209444-46209466 GGCTCCTGCAGCCCTGGACATGG - Intergenic
1167732150 19:51266122-51266144 GGACTTGGCAGCCCTGGAAAAGG + Intronic
1168120879 19:54252019-54252041 GGCCTTTGGTGCCCGGGACAGGG + Intronic
1168325332 19:55536072-55536094 GGCCATAGCAACCCTGGCCCAGG + Exonic
1168488415 19:56785673-56785695 GTACATTCCAGCCCTTGACATGG + Intronic
927041208 2:19232219-19232241 GCCCATTCCAGCCCTGGAAGAGG - Intergenic
927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG + Exonic
931249966 2:60521553-60521575 GGCAATTGCAGAGCTGGAAAGGG - Intronic
932063585 2:68529968-68529990 GGCCACAGCAGCCATGGAGAAGG - Intronic
932376819 2:71243784-71243806 GGCTCCTGCAGCCCTGGAAAGGG - Intergenic
932801688 2:74747329-74747351 GGCCAATGCTACCCTGGAAAGGG + Intergenic
935990187 2:108712442-108712464 GGCGATTGAAGCCCTGCATAGGG - Intergenic
937037419 2:118793537-118793559 GGCCACTGTAACCCTGGCCATGG - Intergenic
937318933 2:120949135-120949157 GACTAATGCACCCCTGGACAAGG - Intronic
937476064 2:122216552-122216574 GGCCAATTCAGCCCTGGTGAAGG + Intergenic
938974176 2:136459491-136459513 GGGCAGTACAGCCCTGGACCTGG + Intergenic
945704898 2:213218051-213218073 AGATATTGTAGCCCTGGACAGGG - Intergenic
947238508 2:227969445-227969467 GGTGATTCCAGCCCTGGAAAAGG + Intergenic
948832282 2:240603940-240603962 CCCCATGGCATCCCTGGACAAGG + Intronic
1170351578 20:15447529-15447551 GGCCATGGCAGCCCTGGGGCTGG - Intronic
1170620403 20:17990969-17990991 GCCCATTACAGCCCTGGGGAAGG + Exonic
1171224006 20:23425383-23425405 GGCCACTGCAGACCTGGGCAGGG - Intergenic
1173018445 20:39247641-39247663 GACCACTGCAGCTCAGGACAGGG - Intergenic
1173503768 20:43571560-43571582 GGCCTTTGTGCCCCTGGACATGG + Intronic
1173551794 20:43937697-43937719 GGCCCTCCCAGCCCTGCACATGG - Intronic
1173872793 20:46352257-46352279 GGCCAAGGCAGCCCAGGACCCGG - Intronic
1175795470 20:61767761-61767783 GGACACTGCAGCCCTGGGCAGGG + Intronic
1175846301 20:62060734-62060756 GGCCTTTGGAGGCCTGGACCTGG - Intronic
1176256286 20:64154815-64154837 GGCAGCTGGAGCCCTGGACAGGG - Intronic
1178114745 21:29405602-29405624 GAGCAGTGGAGCCCTGGACAGGG - Intronic
1179978456 21:44884198-44884220 GGCCACTGCAGACCTGCAAATGG - Intergenic
1180197508 21:46206566-46206588 GGCCCTTGCAGCCTCGGGCAAGG + Intronic
1181559228 22:23690317-23690339 GGCCATCCCAGCCCTGGCCAAGG - Intronic
1181960040 22:26616299-26616321 GGCCTTTGCAGCCTGAGACATGG + Exonic
1182719230 22:32384241-32384263 GGCCATTTCAGCCCTTGGCAGGG - Intergenic
1182796864 22:32997258-32997280 AGCCATTGAACCCCTGGTCAGGG + Intronic
1183028985 22:35087815-35087837 GGCCATGGGAGCCCTGGGCCAGG + Intergenic
1183459534 22:37941499-37941521 GGCCGTCGCAGCCCTGGTCCTGG - Exonic
1184728136 22:46357945-46357967 GGTCAGTGCTGCCCTGGCCAGGG + Intergenic
949442636 3:4099017-4099039 GGCCACTGCAGTCCTTAACAAGG + Intronic
950365440 3:12480286-12480308 GCCCATTCCAGCCTTGCACATGG + Intergenic
953707356 3:45241252-45241274 GGCCATGCCAGCCTTGGGCAGGG + Intergenic
953753438 3:45627103-45627125 GGCCCTTGGAACCCTGGGCATGG - Intronic
953914097 3:46906852-46906874 GGCCATGGCAGCCTTGGGCTGGG - Intergenic
954030840 3:47818788-47818810 GGCCTTAGCAGGCCTGGAAAAGG - Intronic
954215613 3:49122785-49122807 GGCCCAGGCAGCCCTGGACAAGG - Exonic
954464568 3:50646912-50646934 GCCCATTCCAGCCCTGCACTGGG - Intronic
954843468 3:53533674-53533696 GGCCATAGCAGCCGTGGAGGAGG - Intronic
954962081 3:54575643-54575665 GGCCAGTGCAGTCTTGGAGAGGG + Intronic
961506517 3:127374191-127374213 GGCCCCAGCAGCCCTGGAAAGGG - Intergenic
961864183 3:129941720-129941742 GGCCTTTGGAGCCCTGTAAAAGG - Intergenic
963075813 3:141345351-141345373 GGCCCTTGCAGCCATAGCCAAGG - Intronic
964734550 3:159903238-159903260 CGCCACTGCAGCCCTTGCCACGG + Intergenic
965849690 3:173009408-173009430 GGCCTTTGTAGTCCTGGCCATGG + Intronic
967945286 3:194799166-194799188 GGCTATTGCTGCCCAGGACCAGG + Intergenic
969051462 4:4376259-4376281 GGCCTTTGCAGGACAGGACAGGG - Intronic
969422012 4:7103033-7103055 TGCCTCTGCGGCCCTGGACAGGG - Intergenic
970508285 4:16755076-16755098 GGCCATTGTGGACCTGGACCTGG + Intronic
977014096 4:91670603-91670625 GGCAAGGGCAGCCCTGGACCTGG + Intergenic
979259376 4:118633774-118633796 GGCCTCTGCAGGCCTCGACAAGG + Intergenic
979328975 4:119406789-119406811 GGCCTCTGCAGGCCTCGACAAGG - Intergenic
979968304 4:127104157-127104179 AGCCAATGCAGATCTGGACAGGG - Intergenic
982600699 4:157444444-157444466 GACCTTTGCAACCCTGGGCACGG - Intergenic
985432667 4:189896412-189896434 GGCCCAGGCAGCCCTGGACCAGG + Intergenic
985834680 5:2261657-2261679 GGCCATTGCTGCTGTGGACGCGG - Intergenic
987416645 5:17669441-17669463 GGTCATTCCAGCCATGGGCATGG + Intergenic
991921100 5:71657782-71657804 GGCCATTTCAGCCCCTGTCATGG + Exonic
992680553 5:79148864-79148886 GCCCATCGCAGACCTGGAAAGGG - Intronic
995585160 5:113641282-113641304 GGCCTTTGCAGTCCAGGACTTGG + Intergenic
995986910 5:118187781-118187803 GGCCATTGAAGCCCGAGGCATGG + Intergenic
997525019 5:134547243-134547265 TGCCAATGCAGCCCTGGAGGGGG - Intronic
997743409 5:136277828-136277850 GGCCATTCCTGCCCAGAACATGG + Intronic
1000537050 5:162492255-162492277 GGCCAATGCAGAACTGGTCAGGG - Intergenic
1001052132 5:168422116-168422138 GGCCACTGCTCCCCTGGGCATGG + Intronic
1001325729 5:170722423-170722445 GACCACTGCAGCCATGGATAAGG + Intronic
1001694509 5:173660175-173660197 AGCCCTGGCAGCCCTGGGCAGGG - Intergenic
1001873968 5:175183145-175183167 GGACAGGGCAGCACTGGACAAGG + Intergenic
1002026750 5:176400971-176400993 GGCCAGGGCAGGCCAGGACAGGG + Intronic
1002602901 5:180364163-180364185 GGCCTTTGCTGCCCTGGGCCTGG + Intergenic
1002729596 5:181325518-181325540 GGCCTCTGCAGGCCTCGACAAGG + Intergenic
1003106377 6:3219557-3219579 GGCCACTGCAGCTCTGATCATGG - Intergenic
1005242966 6:23853685-23853707 GGCCACGGCAGCCATGGAGAAGG + Intergenic
1007094594 6:39205496-39205518 GGCCATAGCCACCCTGGGCAGGG - Intronic
1007383512 6:41505109-41505131 GGCCAAGGCCGCCCTGGGCAGGG + Intergenic
1009398875 6:63230841-63230863 GGCCACGGCAGCCATGGAGAAGG - Intergenic
1009702477 6:67201812-67201834 GCCCATTGCTGCTCTGGATAGGG + Intergenic
1011850356 6:91620115-91620137 GGCCAGCCCAGCCCTGGCCATGG + Intergenic
1012276632 6:97282767-97282789 GGGCTCTGCAGCCCAGGACAAGG + Intronic
1014801473 6:125783007-125783029 GGCCATTGCTGCCTTTGAAAAGG + Intronic
1015858112 6:137647351-137647373 GGTCTTTGCAGTCCTGGACTTGG + Intergenic
1017281252 6:152628454-152628476 GGCCTTTGCAGCACTCAACAAGG + Exonic
1019285086 7:219375-219397 GGCCATTGCTGTCCTGGGCTGGG - Intronic
1019285096 7:219415-219437 GGCCATTGCTGTCCTGGGCTGGG - Intronic
1019436265 7:1023801-1023823 GGCCCCTGCAGCCCAGGCCAGGG + Intronic
1021647179 7:22799861-22799883 GGTAATTGCAGTCCTGGCCAAGG - Intergenic
1022886013 7:34644616-34644638 GTCCATTGGAGCCCTGGTTAGGG - Intergenic
1023029267 7:36078815-36078837 GCCCACTGCAGCCCTGGCGATGG + Intergenic
1023400819 7:39792304-39792326 GGCCTCTGCAGGCCTCGACAAGG + Intergenic
1025811230 7:64876954-64876976 GGCGATTGCAAGCCTGGAAAAGG - Intronic
1031972960 7:128077083-128077105 GGCCAATCCAGCCCTGTGCAGGG - Intronic
1032051317 7:128652639-128652661 GGCCTCTGCAGGCCTCGACAAGG + Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1034262794 7:149767039-149767061 GACCATTGCAGCACCCGACAGGG - Intronic
1035220798 7:157405557-157405579 GGCCCTGTCAGCCCTGAACATGG + Intronic
1035314540 7:157989898-157989920 GGTCAGCGCAGCCCTGGGCAGGG - Intronic
1038373262 8:27012876-27012898 GGCCACGGCAGCCATGGAGAAGG - Intergenic
1042194653 8:66221886-66221908 GGCCATTCCAGTCCTCCACAAGG + Intergenic
1046398316 8:113670778-113670800 AGACATTGCAGCCATGGAGATGG - Intergenic
1047430758 8:124789659-124789681 GGCCTTTACAGACCAGGACATGG - Intergenic
1048087667 8:131201617-131201639 AGCCATTCCAGCTCTGGCCATGG + Intergenic
1049601978 8:143512184-143512206 GGCCACTGCAGCGCTGCCCAGGG + Intronic
1051907508 9:22113288-22113310 GGCCATTGCTGGCCTGAAGATGG - Intergenic
1052413077 9:28147459-28147481 GGCCACGGCAGCCATGGAGAAGG + Intronic
1052798551 9:32946451-32946473 GGTCATTGCAGCCCTTGAACCGG - Intergenic
1053721851 9:40954633-40954655 GGCCCAGGCAGCCCTGGACCAGG + Intergenic
1054344114 9:63897356-63897378 GGCCCAGGCAGCCCTGGACCAGG - Intergenic
1055402027 9:75934166-75934188 GGCCATTGCAGGCCAGCCCAAGG + Intronic
1055587986 9:77776172-77776194 GGCTATTGCAGAGCTGGAAAAGG - Intronic
1056020532 9:82433635-82433657 GGCCACAGCAGCCATGGAGAAGG - Intergenic
1056796577 9:89662820-89662842 GGCCAGGGCAGCCATGGGCAGGG - Intergenic
1057071365 9:92103680-92103702 GGCCACGGCAGCCATGGAGAAGG + Intronic
1057371627 9:94479571-94479593 GGGCAGCGCAGCCCTGGATAGGG - Intergenic
1059095899 9:111414459-111414481 GGCCAATGTAGATCTGGACAGGG + Exonic
1060004998 9:119992042-119992064 GGCAGATGCAGCCCTGTACAGGG - Intergenic
1060971633 9:127741793-127741815 GGTCATGGGTGCCCTGGACATGG - Exonic
1061500408 9:130998409-130998431 GGCCATTGCTGCACAGGGCAGGG - Intergenic
1061584657 9:131558052-131558074 GGCCCGTGCAGCACTGGGCAGGG + Intergenic
1061923778 9:133796106-133796128 GGCCATGGCAGAAATGGACATGG - Intronic
1061933799 9:133846549-133846571 GGCCAGGGCAGCCAGGGACAGGG - Intronic
1062448384 9:136605184-136605206 GGCCATGGCACCCCAGGACTGGG + Intergenic
1062547547 9:137070440-137070462 GGCCATGGCGGCCCCGGCCATGG + Exonic
1203453308 Un_GL000219v1:141369-141391 GGCCAAGGCAGCCCTGGACCAGG - Intergenic
1203577566 Un_KI270745v1:20787-20809 GGCCTCTGCAGGCCTCGACAAGG + Intergenic
1186374973 X:8988933-8988955 GACCTTTGCAACCCTGGGCATGG - Intergenic
1186865531 X:13717334-13717356 AGCCATTTCAGCCCAGGAAAAGG - Intronic
1186991652 X:15075878-15075900 GACCATTGCAGCACAGGAGAGGG - Intergenic
1188168662 X:26893202-26893224 GGCAATTGCAGCTGTGGGCAGGG - Intergenic
1192036722 X:67571019-67571041 GGTCACAGCAGCCCAGGACAAGG - Intronic
1192263493 X:69523367-69523389 GGCGCTTGCAGCCCTGGCCAGGG - Intronic
1192340477 X:70259619-70259641 GGCCATGGCCCCCCTGGAGATGG + Exonic
1194058323 X:89164543-89164565 GGCGAGTGCACACCTGGACAAGG + Intergenic
1198308104 X:135402411-135402433 GGCCATTCCAGCACTGTATAAGG + Intergenic
1200982337 Y:9273617-9273639 GGCAATTGCCACCCTGGAAAGGG + Intergenic
1200986831 Y:9309802-9309824 GCTCACTGCAGCCTTGGACACGG - Intergenic
1202349136 Y:23968795-23968817 AGCCATTTCAGCCCAGGAAAAGG - Intergenic
1202521639 Y:25701309-25701331 AGCCATTTCAGCCCAGGAAAAGG + Intergenic