ID: 927933267

View in Genome Browser
Species Human (GRCh38)
Location 2:27059352-27059374
Sequence CCTTTTGGGTACTAGAGCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927933267_927933283 22 Left 927933267 2:27059352-27059374 CCTGGGCTCTAGTACCCAAAAGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 927933283 2:27059397-27059419 CGTCAGAGGTAAGCCAGTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 71
927933267_927933278 8 Left 927933267 2:27059352-27059374 CCTGGGCTCTAGTACCCAAAAGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 927933278 2:27059383-27059405 CGGGTGCTGGGCCCCGTCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 128
927933267_927933274 -4 Left 927933267 2:27059352-27059374 CCTGGGCTCTAGTACCCAAAAGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 927933274 2:27059371-27059393 AAGGTCACCCACCGGGTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 101
927933267_927933282 21 Left 927933267 2:27059352-27059374 CCTGGGCTCTAGTACCCAAAAGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 927933282 2:27059396-27059418 CCGTCAGAGGTAAGCCAGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 59
927933267_927933273 -5 Left 927933267 2:27059352-27059374 CCTGGGCTCTAGTACCCAAAAGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 927933273 2:27059370-27059392 AAAGGTCACCCACCGGGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927933267 Original CRISPR CCTTTTGGGTACTAGAGCCC AGG (reversed) Exonic
902677261 1:18017447-18017469 CCTGTTGTGTACCAGACCCCGGG - Intergenic
904528913 1:31155306-31155328 CCTTTTGGGGGCTGGAGACCCGG + Intergenic
908806810 1:67940231-67940253 CTTTTGGGGTACTCCAGCCCTGG + Intergenic
909915457 1:81312480-81312502 CCTTCTGGGTGCCAGGGCCCAGG + Intronic
912135564 1:106656676-106656698 CTTTTTGGGAACTAGAGCAAAGG - Intergenic
919464535 1:197913172-197913194 CCCTTTGGGGAGAAGAGCCCAGG + Intronic
920232585 1:204480535-204480557 CCTTCTGGGTACTGGGGCTCTGG - Intronic
1065748354 10:28862425-28862447 CCTTTTTGGTCCTATAGTCCAGG + Intronic
1067097343 10:43310763-43310785 CCTCCTGGGCACTTGAGCCCAGG - Intergenic
1067269956 10:44782950-44782972 CCCTTTGGGACTTAGAGCCCAGG - Intergenic
1072086169 10:92081414-92081436 CCTTTGGGGTACTTCAGCTCTGG + Exonic
1072248478 10:93563515-93563537 GCCTTTGGGGACCAGAGCCCTGG - Intergenic
1075411467 10:122231651-122231673 CCTGTTGGGGACTAGAACTCAGG + Intronic
1080360658 11:31509668-31509690 CCTATTGGTTACGAGAGCCGCGG + Intergenic
1080523919 11:33094427-33094449 CCTTCTGGTTACTAGAGTCTGGG - Intronic
1081060084 11:38463375-38463397 CCTTTTGAGTACTGGAGACCTGG - Intergenic
1084555506 11:69873566-69873588 TCTTTGGGGGACTGGAGCCCAGG - Intergenic
1085199345 11:74692209-74692231 CCTTATGGGTCCCAGAGCACAGG - Intergenic
1086614253 11:88795860-88795882 CCTATTGTGTAGGAGAGCCCTGG + Intronic
1087368586 11:97252359-97252381 GCTTTTGAGTAATGGAGCCCAGG - Intergenic
1092481879 12:8866666-8866688 CCTTTTGTGGACTGGAGCCAGGG - Intronic
1096516523 12:52158761-52158783 CCTTTTGGGGGCTAGGGGCCTGG + Intergenic
1101373432 12:104150979-104151001 CCTTTTTGGCACCAGAGACCAGG - Intergenic
1101818622 12:108165356-108165378 CCTTTGGGGTAACAGAGCCTGGG - Intronic
1103027981 12:117589402-117589424 CCTTTTAGGTGCTAAAGCTCAGG + Intronic
1104605769 12:130186265-130186287 CCTATTGGGTAACACAGCCCCGG - Intergenic
1105203010 13:18195109-18195131 CCTCTAGGGCCCTAGAGCCCGGG + Intergenic
1105227271 13:18447773-18447795 CCTATTGGGAACTAGAGCAAAGG + Intergenic
1114011720 14:18376227-18376249 CCTATTGGGAACTAGAGCAAAGG + Intergenic
1114207001 14:20581434-20581456 CATCTTGGGTACTTGAGGCCAGG + Intergenic
1118255212 14:64199930-64199952 CATTTTGGATACCACAGCCCTGG + Intronic
1118741568 14:68743191-68743213 CCCTTTGGCTCCTACAGCCCTGG + Intergenic
1122224606 14:100266656-100266678 ACTTTTGGGTTCTTCAGCCCTGG - Intronic
1126437850 15:48654187-48654209 CCTTCTGGGTACTCATGCCCAGG + Intergenic
1128501702 15:68231224-68231246 CCTGTGGGCTGCTAGAGCCCAGG - Intronic
1129556813 15:76518600-76518622 CCTTTTAGGTGCTAGAGAACAGG - Intronic
1135140359 16:19916065-19916087 CCTTTTTGGTAATAAAACCCTGG + Intergenic
1149190127 17:54051052-54051074 CTTGTTGGGAACTGGAGCCCAGG - Intergenic
1152103446 17:78315811-78315833 CCTTTTGGAAACTGGAGCCCCGG - Intergenic
1154269458 18:12906844-12906866 CCCTTTGGGTGCTAGAGGCAGGG + Intronic
1158373377 18:56833953-56833975 CCTTTTGTGTCCTAGAGCAGAGG - Intronic
1159605018 18:70466126-70466148 CCTTTTTGGTACCAGGGACCAGG - Intergenic
1160043507 18:75366774-75366796 CCTTTTGGATCCAAAAGCCCAGG - Intergenic
1160707315 19:535661-535683 CCTTCTGGGGACTTGACCCCAGG + Intronic
1163692370 19:18744751-18744773 CCTTTTGGGGGCAAGAGCCACGG + Intronic
1163783634 19:19263166-19263188 CCTTTGGGGTGCTGGAGACCAGG - Intergenic
1164480905 19:28610238-28610260 CCTGTTGGGTAGTAAATCCCAGG - Intergenic
1166071077 19:40388389-40388411 CCTCTTGGGTACTGAAGCCCTGG - Intronic
1167782511 19:51608301-51608323 CCTTTTGGGAAGGAGAGGCCAGG + Intergenic
925285559 2:2713508-2713530 GCTTTTGGGTGGCAGAGCCCGGG + Intergenic
927200074 2:20572723-20572745 TCTTCAGGGTACTGGAGCCCGGG + Intronic
927933267 2:27059352-27059374 CCTTTTGGGTACTAGAGCCCAGG - Exonic
930680428 2:54251944-54251966 CCTTGTGGGAATTAGAGCTCAGG + Intronic
943118349 2:183703405-183703427 CCGTTTGGTTACTATACCCCTGG - Intergenic
1170441308 20:16381932-16381954 ACTTTTGGGTACTTGAACTCAGG + Intronic
1173003045 20:39119285-39119307 CCTTTGGGGTAATAGAGAACTGG + Intergenic
1176714949 21:10342896-10342918 CCTCTAGGGCCCTAGAGCCCGGG - Intergenic
1176771316 21:13076787-13076809 CCTATTGGGAACTAGAGCAAAGG + Intergenic
1177471334 21:21564048-21564070 ATTTTTGGCTACTAGACCCCTGG + Intergenic
1178587667 21:33883710-33883732 CCTTGTGTGTCCTAGAGCCGTGG - Intronic
1180436213 22:15307035-15307057 CCTATTGGGAACTAGAGCAAAGG + Intergenic
1180603399 22:17037042-17037064 CCTCTAGGGCCCTAGAGCCCGGG + Intergenic
1182894698 22:33849519-33849541 CCTACTGGGTACTAGACACCAGG + Intronic
1184716020 22:46282258-46282280 ACTTTGGTGTCCTAGAGCCCAGG + Intronic
1185220717 22:49627917-49627939 CTGTTTGGGTACAAAAGCCCAGG + Intronic
949737680 3:7192897-7192919 CCTCTTGGGTACTAATCCCCTGG + Intronic
953772130 3:45785841-45785863 CCATGTTGGTACCAGAGCCCAGG + Intronic
956422692 3:69101183-69101205 CCTACTGTGTACTAGAGCCCAGG + Intronic
958114415 3:89196865-89196887 CCATTTGGGTGGTAGAGCCACGG - Intronic
961822778 3:129583727-129583749 CCTTTTGGGTTCTAGTTCCTGGG - Intronic
962636001 3:137332068-137332090 CCTTTGGGGTCAGAGAGCCCAGG - Intergenic
966047948 3:175575866-175575888 CCTAATGGGTGGTAGAGCCCAGG - Intronic
966065790 3:175819923-175819945 CCTTTTAGGGACTAAAGCACTGG - Intergenic
969134352 4:5018586-5018608 GCTTTTGGGGACTAGAACCCAGG - Intronic
970337338 4:15062144-15062166 CCTTTTGGGTATTTTAGCTCAGG - Exonic
972487879 4:39559597-39559619 CCTTTTGTGGAATTGAGCCCTGG - Intronic
974632456 4:64511007-64511029 CATTTTGGTTACTATAGCTCTGG + Intergenic
975723733 4:77272302-77272324 GCTTCTGGGTCCTTGAGCCCAGG + Intronic
976700949 4:87967668-87967690 CATTTTGGATAGCAGAGCCCAGG - Intergenic
983065281 4:163203306-163203328 ACTTTTGAGTACTGCAGCCCAGG + Intergenic
988516802 5:31912064-31912086 TCTTTTGTGTAGTAGAGCCAAGG - Intronic
988730108 5:33963972-33963994 CCTTTTGGGTGCTATAGACTGGG - Exonic
989203179 5:38786132-38786154 CTTTTTGGGAACTAGAGCAAAGG + Intergenic
995902562 5:117087407-117087429 TGTCTTGGGTACTAGAGCCAAGG + Intergenic
1000852844 5:166361879-166361901 GCTTTTGGGTTCCAGAGCCATGG + Intergenic
1001359322 5:171065247-171065269 CCTTTTTGGCACTAGGGACCAGG + Intronic
1001730621 5:173953156-173953178 CCTTTTGGGTATTTTAGCTCAGG - Exonic
1004363014 6:14987606-14987628 CCTGTAGGGTATCAGAGCCCAGG - Intergenic
1005430929 6:25756137-25756159 CATTTTGGGTCCTATAGGCCTGG - Intronic
1005629492 6:27694141-27694163 CCCTTTGGGCACAAGAGCTCAGG - Intergenic
1009266975 6:61568226-61568248 TGTTTTGGGTACTATAGCCTTGG + Intergenic
1012521684 6:100128180-100128202 CCTGTTGGGTACTATTGACCAGG + Intergenic
1016003358 6:139065325-139065347 CTATTTGGGTACCATAGCCCAGG + Intergenic
1016295304 6:142567017-142567039 CCTTTTTGGGACTAGGGCCAAGG - Intergenic
1029455765 7:100671220-100671242 CCTATTGGGTACTGTACCCCAGG - Intergenic
1030657251 7:112181887-112181909 CCCTTTGGGTACAGGTGCCCAGG - Intronic
1032620983 7:133531813-133531835 AGTTTTGGGGACTAGAGGCCTGG + Intronic
1035973120 8:4274861-4274883 CCTTTTGGGTACTTGAGTCTGGG - Intronic
1037547600 8:19939651-19939673 CCGTTTCGGGGCTAGAGCCCAGG - Intronic
1039403661 8:37294443-37294465 CCTGTTGTGTTCTAGAACCCAGG - Intergenic
1041497436 8:58502586-58502608 CTTTTTGGGAACTAGAGCAAGGG + Intergenic
1043079399 8:75746756-75746778 TGTTTTGGTTACTAGAGCCTTGG - Intergenic
1052699508 9:31920955-31920977 CCTTTTGGGCACAAGGGACCAGG - Intergenic
1053399624 9:37806522-37806544 CCCTTTGGGAACTACAGCCCCGG + Intronic
1053703922 9:40730520-40730542 CCTATTGGGAACTAGAGCAAAGG - Intergenic
1054414005 9:64854129-64854151 CCTATTGGGAACTAGAGCAAAGG - Intergenic
1058967266 9:110049304-110049326 CCTTTTGGGTGGCAGAGCCGGGG + Intronic
1060826682 9:126691876-126691898 CCTTTTGGGGGCTAGAGCAGAGG - Intronic
1061980654 9:134101642-134101664 CCTACTGTGTACCAGAGCCCGGG - Intergenic
1187305756 X:18093873-18093895 CATTTTGAGGACAAGAGCCCAGG + Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1197833448 X:130670163-130670185 TCTTGTCAGTACTAGAGCCCAGG + Exonic