ID: 927937418

View in Genome Browser
Species Human (GRCh38)
Location 2:27083557-27083579
Sequence TGAGCTCCAGACCACTGTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927937415_927937418 -4 Left 927937415 2:27083538-27083560 CCCTCAATGACTCACTGAATGAG 0: 1
1: 0
2: 1
3: 23
4: 338
Right 927937418 2:27083557-27083579 TGAGCTCCAGACCACTGTGGAGG 0: 1
1: 0
2: 0
3: 14
4: 171
927937416_927937418 -5 Left 927937416 2:27083539-27083561 CCTCAATGACTCACTGAATGAGC 0: 1
1: 0
2: 1
3: 13
4: 123
Right 927937418 2:27083557-27083579 TGAGCTCCAGACCACTGTGGAGG 0: 1
1: 0
2: 0
3: 14
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927937418 Original CRISPR TGAGCTCCAGACCACTGTGG AGG Exonic
900777221 1:4594231-4594253 TGAGTTCCAGACTGCTCTGGGGG + Intergenic
900896664 1:5487442-5487464 GAAGCTCCAGGCCTCTGTGGTGG + Intergenic
904473297 1:30748806-30748828 TGAGCCCCAGAGCCCAGTGGAGG - Intronic
904698355 1:32343342-32343364 TGAGGTGCAGACCACACTGGAGG + Intergenic
907015181 1:51005489-51005511 TCAACTTCAGACCACTGTGCTGG - Intergenic
908551793 1:65215745-65215767 TGAGCTCTAGAGCCCTCTGGAGG - Intronic
910827846 1:91428343-91428365 TCAGCTTCAGACTACTGTGCTGG + Intergenic
912520556 1:110241908-110241930 TGAGCTCCTGACCACTGAGCAGG - Intronic
913230673 1:116738306-116738328 TGAGCCCCAGAACACTAAGGAGG - Intergenic
914513440 1:148353931-148353953 TGGGACCCAGACCACTGAGGAGG - Intergenic
914755961 1:150561752-150561774 TGAGCACCTGAACCCTGTGGGGG + Intergenic
916032005 1:160885117-160885139 TGAGCTCCAGGGCGCAGTGGAGG - Exonic
916572752 1:166041581-166041603 GGACCTCCAGAGGACTGTGGTGG + Intergenic
917426845 1:174923467-174923489 TGAGCTCCAGTTCATTGAGGAGG - Intronic
918506926 1:185265580-185265602 TCAACTTCAGACCACTCTGGAGG - Intronic
918647724 1:186921835-186921857 TGTCCTCTTGACCACTGTGGGGG + Intronic
923537506 1:234864355-234864377 TGAGCTCCAGAAAACAGTGCAGG + Intergenic
924055450 1:240119737-240119759 GGAGTTCCAGAACAGTGTGGAGG - Intronic
1063375072 10:5549700-5549722 TGAGCTCCACTCCACAGTGTGGG + Intergenic
1063880169 10:10522989-10523011 TGAGGTCCAGACCACAGAGTTGG + Intergenic
1065152598 10:22837545-22837567 GGAGCTCCAGACCACGGGGCGGG - Intergenic
1067252011 10:44594389-44594411 TCAGCTCCAGACTGCTGTGCTGG - Intergenic
1067850684 10:49751948-49751970 TGAACTCCAGGCCAATGTGCTGG + Exonic
1068669952 10:59712219-59712241 TGTGCTCCAGATCACCCTGGGGG + Intronic
1069842074 10:71346147-71346169 GGACCTCCAGACCACTGAAGAGG - Intronic
1072674133 10:97452960-97452982 TTAGCTCCAGAGCACTGTACAGG + Intronic
1074117938 10:110471727-110471749 TCAGCTCCAGGCCTGTGTGGGGG - Intergenic
1078091898 11:8269118-8269140 TGAGCTCAAGACAAGGGTGGGGG + Intergenic
1078474607 11:11620460-11620482 TGCGCTCCAGACCAGCGCGGGGG - Intronic
1081675570 11:44967098-44967120 AGGGCTCCAGACCCCTGTGCAGG - Intergenic
1084586070 11:70063369-70063391 TGGTCTCCAGACCACTGTCAGGG - Intergenic
1085344477 11:75759249-75759271 TGAGCTCAAGAGCACAGTGTGGG + Intergenic
1086404231 11:86486486-86486508 TGGGCTCCAGCCCACTGTTCTGG + Intronic
1091097923 11:132841400-132841422 TGATCTCTAGCCCACTGTAGAGG + Intronic
1091606491 12:1957102-1957124 TGAGCTACAAACTACTGAGGTGG - Intronic
1101209529 12:102522248-102522270 TGTACTCCAGATGACTGTGGGGG + Intergenic
1101733699 12:107447051-107447073 TCGGTTCCAGAACACTGTGGGGG + Intronic
1102687109 12:114733934-114733956 TGAACTCCAGAGCCCAGTGGAGG + Intergenic
1104519600 12:129461195-129461217 TGAGCTGCAAGCCTCTGTGGTGG - Intronic
1106904029 13:34386194-34386216 TTAGCTCAGGCCCACTGTGGAGG - Intergenic
1108288412 13:48932365-48932387 TGAGACCCAGACCTCTGAGGAGG - Intergenic
1111019392 13:82427473-82427495 AGAGCTCCATGCCACTGTGATGG - Intergenic
1113777741 13:112958404-112958426 TGAGGCCCAGCCCACTGTGGAGG + Intronic
1114586364 14:23817467-23817489 TGAAGTCAAGACCCCTGTGGGGG + Intergenic
1118924863 14:70182888-70182910 TGAGCTCCTGGGCACTGTGCAGG + Intronic
1119121957 14:72088018-72088040 TCAGATAGAGACCACTGTGGAGG + Intronic
1120182870 14:81363878-81363900 AGAGCTCCAAACCAGAGTGGAGG - Intronic
1120945066 14:89987078-89987100 TGAGCTCCAGGCAGCTGTGATGG - Intronic
1122536354 14:102466225-102466247 TCGGCTCCAGAGCTCTGTGGAGG + Intronic
1123410741 15:20056776-20056798 TCAGCTCTAGCACACTGTGGAGG - Intergenic
1123520070 15:21063482-21063504 TCAGCTCTAGCACACTGTGGAGG - Intergenic
1124061548 15:26298142-26298164 TGCGCAGCAGCCCACTGTGGAGG + Intergenic
1126687791 15:51263644-51263666 TGAGATCCAGGCACCTGTGGAGG + Intronic
1127508225 15:59615312-59615334 TGAGATCCAGACCTCTCAGGAGG - Intronic
1127789082 15:62382224-62382246 TCAACACCAGACCACAGTGGTGG + Intergenic
1131172827 15:90190616-90190638 TGAGCACCAGACCCCTGTGAGGG - Intronic
1131205937 15:90447216-90447238 TGAGCACCATACCAAGGTGGTGG - Intronic
1132381941 15:101372148-101372170 TCAGCTGCAGATCACTGGGGTGG - Intronic
1138270943 16:55695421-55695443 TGGGCCCCAGCCCACTGAGGCGG + Intronic
1139373754 16:66484231-66484253 GGAGCCCCAGAGCACTGAGGTGG - Intronic
1142916397 17:3142712-3142734 TGAGCTCCCTGCCAGTGTGGTGG - Intergenic
1143655823 17:8293015-8293037 TCAGCTCGATACCTCTGTGGGGG - Intronic
1144074087 17:11701368-11701390 TGAATCCCAGACCACTGTGAGGG + Intronic
1145033010 17:19519525-19519547 TGAGCTCCTGGCCAGTCTGGGGG + Intronic
1146824948 17:36013896-36013918 TCTCCTCCAGAGCACTGTGGAGG + Exonic
1146905314 17:36614281-36614303 TGAGCTGAAGACCACTAGGGAGG - Intergenic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1148652433 17:49259845-49259867 GGATCTCCAGACCACGGGGGAGG - Intergenic
1148736125 17:49865880-49865902 TGAGCTGCAGTCAACAGTGGGGG - Intergenic
1152364871 17:79849785-79849807 TGAGCCCCAGACAAGGGTGGTGG + Intergenic
1155065818 18:22268052-22268074 TGAACTCCAGGCCACTCTGGAGG + Intergenic
1157272982 18:46290738-46290760 TGAGCTGCAGATCCCTGTGCAGG - Intergenic
1161650312 19:5480270-5480292 TTAGCTTCAGAGCACTGTTGAGG + Intergenic
1161801877 19:6420900-6420922 TGAGCTCCACAGCACTGAGTGGG + Intronic
1161959679 19:7516530-7516552 TGAGCTCCAGACCCCAGAGCTGG - Intronic
1162971536 19:14183828-14183850 TGAGCTGCAGACCCCGGAGGGGG - Intronic
1165622083 19:37256717-37256739 TGAGCTCCAGATCCTAGTGGAGG - Intergenic
1166145311 19:40830519-40830541 TGAGCTCCTGGCCATTGTGCTGG + Intronic
1166412421 19:42564886-42564908 GGAGCTCCCGGCCCCTGTGGTGG - Intergenic
1167143923 19:47671164-47671186 TATGCCCCAGCCCACTGTGGGGG + Intronic
925144280 2:1570464-1570486 TGAGCTCTAGACCCCTGGGGAGG - Intergenic
925409909 2:3633999-3634021 TCAGCTTCAGACCACGGTGAGGG + Intronic
926965961 2:18411170-18411192 TGAGATCCAGACCTTGGTGGAGG - Intergenic
927884989 2:26712854-26712876 TGAGCTCCTGAGCCCTGGGGAGG + Intronic
927937418 2:27083557-27083579 TGAGCTCCAGACCACTGTGGAGG + Exonic
929790684 2:45020478-45020500 TGAGCTCCAGACCCCTGCCTTGG + Intergenic
934761463 2:96859214-96859236 TGTGCACCAGACCACTGTCCTGG - Intergenic
935160628 2:100526733-100526755 TGAGCTCCAGAGGGATGTGGGGG + Intergenic
936251928 2:110874015-110874037 TGAGGCCCAGAGCACTGTGCTGG + Intronic
937150592 2:119683179-119683201 TGAGCTCCAGCCCACAGTGAGGG - Intronic
938261615 2:129900145-129900167 TGAGCTCCAGATCAATGTCCTGG - Intergenic
938995759 2:136675688-136675710 AGAGCTTCATGCCACTGTGGGGG + Intergenic
942586336 2:177483084-177483106 TGATATCCAGAGCAGTGTGGAGG + Intronic
947653916 2:231810239-231810261 TGAGCTCCCAGCCACTGAGGAGG + Intergenic
948715800 2:239862088-239862110 TGAGTTTGATACCACTGTGGTGG - Intergenic
1170051972 20:12155971-12155993 TGAGCTTCAGGACATTGTGGTGG + Intergenic
1175414646 20:58793564-58793586 TGAGCCGCAGACCACTAGGGGGG + Intergenic
1176111134 20:63411328-63411350 TCAGCACCTGCCCACTGTGGGGG - Intronic
1176914466 21:14608443-14608465 AGTGCTTCAGCCCACTGTGGAGG - Intronic
1178041850 21:28647931-28647953 TGAGCTGAAGACCATTATGGGGG + Intergenic
1179970052 21:44831173-44831195 TGAGCCCCAGACACCTGTGGGGG + Intergenic
1181310912 22:21944255-21944277 TGAGCTCTAGGCAGCTGTGGGGG + Intronic
1181601264 22:23953204-23953226 GGAGCCCCAGACCAAGGTGGTGG + Intergenic
1181607247 22:23988133-23988155 GGAGCCCCAGACCAAGGTGGTGG - Intergenic
1182577520 22:31283060-31283082 TGGGCTCCTGCCCACTGGGGGGG + Exonic
1184128411 22:42502986-42503008 TGAGCTCCAGACCTTGGTGATGG - Intergenic
1184137203 22:42556301-42556323 TGAGCTCCAGACCTTGGTGATGG - Intronic
1185119438 22:48957337-48957359 TGGGCCCCAGGCCACTGTGAGGG + Intergenic
1185327324 22:50233275-50233297 CCAGCCCCACACCACTGTGGCGG + Intronic
952300336 3:32099260-32099282 TGAGATGGAGACCAGTGTGGTGG - Intergenic
955927589 3:64023170-64023192 GGAGCTCCAGACCCCTCTGACGG - Intronic
957036340 3:75296753-75296775 TAATCTCCAGACAGCTGTGGTGG + Intergenic
958054358 3:88389986-88390008 TGTTCTCCAGACCATTGTGAGGG - Intergenic
959421276 3:106132483-106132505 TGAGCTCTAAACCACTCTGGTGG + Intergenic
960501365 3:118442807-118442829 AGAGTTCCAGATCACTGTGAAGG + Intergenic
961467625 3:127091182-127091204 TGAGCTCCACATCACTGGGGTGG + Intergenic
961532945 3:127551026-127551048 TGAGCTGCAGAGCAGTGAGGTGG + Intergenic
961820099 3:129571511-129571533 TGGGCTCCCGGCCAATGTGGTGG + Exonic
962251085 3:133836548-133836570 TGGGTTCCAGAGCACTCTGGGGG + Intronic
963043189 3:141083898-141083920 TGAACTCCAGAACCCTCTGGAGG + Intronic
963770797 3:149384307-149384329 TGAGCTTCAGACCACAGGGCAGG - Intergenic
966142746 3:176774300-176774322 TGAGCTCCAGATCAATGTCCTGG - Intergenic
966206026 3:177407448-177407470 TGAGCTCCAGATCACTGTCTAGG + Intergenic
968931272 4:3580818-3580840 TGATCACCAGATCACTGTAGGGG - Intronic
969617083 4:8260009-8260031 TGGCCTCCAGAGAACTGTGGGGG - Intergenic
970859240 4:20682908-20682930 TGGGATACAGACCACTGAGGAGG + Intergenic
974085457 4:57255801-57255823 TCAGCTCCAGAGCACTATGCGGG + Intergenic
976367278 4:84245492-84245514 TGAGCTGAGGACCTCTGTGGGGG - Intergenic
982368204 4:154603781-154603803 TTAGCTCCAAACACCTGTGGTGG - Intergenic
986195993 5:5536770-5536792 TACTCACCAGACCACTGTGGGGG + Intergenic
986414327 5:7512896-7512918 AGAGATCCAGACCTCTGTAGAGG + Intronic
987795350 5:22620971-22620993 TGATCTCCAGAACTCTGTGAAGG - Intronic
990875969 5:60486177-60486199 TGGGCTCCAGACCACCTTGAGGG + Intronic
993749200 5:91645646-91645668 AGTGCTCCAGATCACTGTGTAGG + Intergenic
994155490 5:96498888-96498910 TGAACTCAAGACCACTATGGAGG + Intergenic
996334560 5:122368669-122368691 AGAGCTCCAGGCCACTCTGATGG - Intronic
996969097 5:129342086-129342108 TGACCTCCAGTCCTCTGTGCTGG - Intergenic
997589517 5:135064249-135064271 GGAGCTGCAGACAAATGTGGGGG - Intronic
997841229 5:137242159-137242181 TGAGTTCAAGACCAGTCTGGTGG + Intronic
997883503 5:137611393-137611415 GGAGCTCCAGAACTCTGGGGTGG - Intergenic
999477170 5:151911114-151911136 TGAGCTCAAGGCCACTGGGTAGG - Intronic
999564472 5:152841940-152841962 TGAGCTCAAGATCAGGGTGGAGG - Intergenic
1001932880 5:175685718-175685740 TGAGCTTCAGGCAACTCTGGAGG - Exonic
1002685778 5:181008289-181008311 TCAGCTCCAGACTACTGTGCTGG - Intergenic
1002716673 5:181232459-181232481 TGAGTTTGAGACCACTGTGCTGG + Intronic
1003908316 6:10721912-10721934 AAAGCTACAGACCTCTGTGGTGG - Intergenic
1005197932 6:23310611-23310633 AGACCTCCTGCCCACTGTGGAGG - Intergenic
1005811275 6:29518280-29518302 TGGCCTCCAGGGCACTGTGGAGG + Intergenic
1006285080 6:33086530-33086552 TGAGCTCAGGAACCCTGTGGGGG - Exonic
1013649601 6:112181203-112181225 TCTTCTCTAGACCACTGTGGCGG + Intronic
1014478101 6:121900094-121900116 AGAGCTCCAGACTTCAGTGGAGG + Intergenic
1016427290 6:143948244-143948266 TGAACTCCAGACCACGGGAGAGG + Exonic
1017438645 6:154442131-154442153 TGAGTTCCTGACCTCGGTGGTGG - Exonic
1018028063 6:159821071-159821093 TGTAGTGCAGACCACTGTGGAGG - Intergenic
1025002819 7:55331532-55331554 TGAGCTCCTGCCCACTGTTCAGG + Intergenic
1026424278 7:70274414-70274436 TGAGGTCCAGGCTACTTTGGAGG - Intronic
1026556442 7:71412627-71412649 TCACCTCCAGACCATTGTCGTGG + Intronic
1026639206 7:72109682-72109704 TGTGCTCAAGGACACTGTGGTGG + Intronic
1027833273 7:83207943-83207965 TGAACTCAAGACCACTATGGAGG - Intergenic
1029203580 7:98855212-98855234 TGAGCTCCAGAGCGCACTGGGGG - Intronic
1030916002 7:115314321-115314343 GGAGTTCAAGACCACTGTGCTGG + Intergenic
1034343922 7:150374244-150374266 GAAGCTCCAGAGAACTGTGGTGG + Intronic
1034926805 7:155129297-155129319 TGGGCTGCAGTCCAATGTGGTGG - Intergenic
1037706414 8:21319159-21319181 TGGGCTCTAGAACAGTGTGGGGG + Intergenic
1037805900 8:22057756-22057778 GGAGCCCCAGAACCCTGTGGGGG - Intronic
1046478014 8:114774259-114774281 TGAACTCCAGAAAACAGTGGAGG + Intergenic
1046969982 8:120212083-120212105 TGAGCTCCAGGCCAGTGTGCTGG - Intronic
1047023685 8:120804768-120804790 TGACCTTCAGACTACTGAGGGGG - Intronic
1048470543 8:134700529-134700551 TGAGCTGCCGAGCACTGGGGTGG - Intronic
1049240397 8:141534978-141535000 TGAGCTGCAGGCCAGGGTGGGGG - Intergenic
1051746614 9:20300756-20300778 TAAGTTCCAGACCTCTGTGAAGG - Intergenic
1051986782 9:23098363-23098385 TGAGGTCCAGAAGTCTGTGGTGG - Intergenic
1053292839 9:36893362-36893384 TGGCATCCAGACCTCTGTGGTGG + Intronic
1056285445 9:85083141-85083163 TGTGCTAGAGACCACTGTAGGGG + Intergenic
1056623969 9:88238503-88238525 TCATCACCAGACCACTGTGAGGG + Intergenic
1057256409 9:93551741-93551763 TGAGCTCCACACAATTGAGGAGG - Intronic
1057514535 9:95710402-95710424 TAGGATCCAGACCAGTGTGGGGG + Intergenic
1059900604 9:118921284-118921306 GGTGCTCCACCCCACTGTGGTGG + Intergenic
1186447487 X:9643901-9643923 TGAGATCCAGGCCACATTGGGGG + Intronic
1186714803 X:12240337-12240359 TGAGTTCCAGCCAACTGTGAAGG - Intronic
1187254362 X:17628706-17628728 TGGGCTCCTGACCACTATGCTGG - Intronic
1188922751 X:35998533-35998555 TTAGCTCCACACCAGTATGGTGG - Intergenic
1189492901 X:41483474-41483496 TGTACCCCAGACCACAGTGGGGG - Intergenic
1194160267 X:90440563-90440585 AGAGGTCCAAACCACTTTGGTGG - Intergenic
1200506558 Y:4017511-4017533 AGAGGTCCAAACCACTTTGGTGG - Intergenic
1201157004 Y:11139912-11139934 GGAGTTCCAGACCACCCTGGTGG - Intergenic