ID: 927939072

View in Genome Browser
Species Human (GRCh38)
Location 2:27092511-27092533
Sequence ATGTATCCACCCTGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927939066_927939072 6 Left 927939066 2:27092482-27092504 CCTGCCTGCATCATTGTGGGAGA 0: 1
1: 0
2: 1
3: 14
4: 324
Right 927939072 2:27092511-27092533 ATGTATCCACCCTGGGTGGATGG 0: 1
1: 0
2: 0
3: 12
4: 136
927939062_927939072 20 Left 927939062 2:27092468-27092490 CCCACTGGGGAAGGCCTGCCTGC 0: 1
1: 0
2: 4
3: 33
4: 224
Right 927939072 2:27092511-27092533 ATGTATCCACCCTGGGTGGATGG 0: 1
1: 0
2: 0
3: 12
4: 136
927939063_927939072 19 Left 927939063 2:27092469-27092491 CCACTGGGGAAGGCCTGCCTGCA 0: 1
1: 0
2: 8
3: 35
4: 253
Right 927939072 2:27092511-27092533 ATGTATCCACCCTGGGTGGATGG 0: 1
1: 0
2: 0
3: 12
4: 136
927939067_927939072 2 Left 927939067 2:27092486-27092508 CCTGCATCATTGTGGGAGAAGAA 0: 1
1: 0
2: 3
3: 19
4: 210
Right 927939072 2:27092511-27092533 ATGTATCCACCCTGGGTGGATGG 0: 1
1: 0
2: 0
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927939072 Original CRISPR ATGTATCCACCCTGGGTGGA TGG Intronic
902189694 1:14753727-14753749 ATGTAGCCTCTATGGGTGGAGGG - Intronic
904624160 1:31792807-31792829 ATGCGTCCACCCTGAGTGGGTGG - Intronic
905965550 1:42092471-42092493 CTGTTTCCACCCATGGTGGAAGG + Intergenic
906154874 1:43608081-43608103 GTCCATCCACCCTGGGAGGAAGG - Intronic
906772652 1:48498974-48498996 ATTTATTCACTCTGGGTGTAGGG + Intergenic
910123752 1:83818294-83818316 ATGTTTCCACTCATGGTGGACGG - Intergenic
910778777 1:90903748-90903770 ATCTATCCACCCTGAGAGAATGG + Intergenic
913170862 1:116230980-116231002 ATGAAGACACCCTGGGAGGAGGG + Intergenic
918883199 1:190154199-190154221 ATGTATCCACCTTAGGTGCAAGG + Intronic
920797882 1:209158245-209158267 ATGTATCACCCCTGGAAGGAGGG + Intergenic
922350057 1:224727976-224727998 ATGAATCCTCCCTGCTTGGAAGG + Intronic
924117315 1:240761231-240761253 AAGTATCCACCTTGGGTTGCAGG + Intergenic
924183713 1:241465175-241465197 ATGTATCCACCGTGGATAGGGGG - Intergenic
1063631793 10:7740787-7740809 TTGTATCCACCCTGCAGGGAGGG - Intronic
1065847882 10:29761258-29761280 ATCTACCGACCATGGGTGGATGG + Intergenic
1066353704 10:34661978-34662000 ATGTAAGCACCCTGGGGAGATGG + Intronic
1068660693 10:59620366-59620388 ATGTGTCCATCCTAGCTGGAAGG - Intergenic
1072041851 10:91614094-91614116 ATGTCTCCACCCTGGTTTGATGG + Intergenic
1073253231 10:102134444-102134466 AAGTTTCCACCCAGGGTAGAAGG + Intronic
1073429853 10:103479031-103479053 ATGGCTCCAGCCTGGGTGGGTGG + Exonic
1076213662 10:128674590-128674612 AGGTATCTGCCCAGGGTGGATGG + Intergenic
1076987470 11:249296-249318 CTGCATCTACGCTGGGTGGAGGG + Intronic
1077229678 11:1453096-1453118 ATGCACCCACCCTGTGAGGAAGG + Intronic
1077378181 11:2215405-2215427 AAGCATCCACCCTGGGGGAAAGG + Intergenic
1078056659 11:8014795-8014817 CTGTATCCTCACTTGGTGGAAGG + Intergenic
1078922486 11:15843465-15843487 ATGTAACCACCAGGGCTGGAAGG - Intergenic
1079891891 11:26066474-26066496 ATGTATCCACCCAAGGCAGATGG - Intergenic
1084227615 11:67727033-67727055 GTGTACCCACTCTGGGTGGGTGG - Intergenic
1085183596 11:74556942-74556964 CTGAATCCACCCTGTCTGGAGGG - Intronic
1087976557 11:104556820-104556842 AAGAAGCTACCCTGGGTGGATGG + Intergenic
1090507846 11:127338558-127338580 TTCTATCCACCCAGGCTGGATGG + Intergenic
1095701245 12:45193429-45193451 AGGGAACCACCTTGGGTGGAAGG - Intergenic
1096098564 12:48954979-48955001 TTTTATCCACCCAGGCTGGAGGG - Intronic
1101588776 12:106108343-106108365 ATGGGTCCACCCAGGGTCGAAGG - Intronic
1104210231 12:126681902-126681924 ATGTAACCACCATGACTGGATGG - Intergenic
1105939485 13:25134582-25134604 ATGTGTCAACCCATGGTGGAAGG + Intergenic
1107905265 13:45055782-45055804 ATGGATCCACCCTGGGACGTGGG - Intergenic
1109803080 13:67402553-67402575 ATGTACTTACTCTGGGTGGATGG + Intergenic
1118901561 14:69990454-69990476 ATGAAGCCACCCTGTGTGGAAGG + Intronic
1119385501 14:74255737-74255759 AGGTATCCACACTGGGTGGGTGG + Intronic
1120342756 14:83243326-83243348 TAGTCTCCACTCTGGGTGGATGG + Intergenic
1121488723 14:94342623-94342645 ATGCAGCCACCCTGGGTGTGTGG - Intergenic
1123974339 15:25538704-25538726 ATGTATACACTCTAAGTGGATGG + Intergenic
1125214971 15:37261731-37261753 ATGTAGCCATCCTGTGAGGAGGG + Intergenic
1125649125 15:41299082-41299104 AAGTATCCACCTTGGGTTGCAGG - Intergenic
1127048625 15:55055714-55055736 TTGTATCCTCACAGGGTGGAAGG - Intergenic
1132787776 16:1667543-1667565 ATTTATCCACCCTGGGCAGTCGG - Intronic
1135411574 16:22238921-22238943 GTGTGTCTACCCTGGGTGCAGGG + Intronic
1135914080 16:26588249-26588271 ATTTATGCACACTTGGTGGAAGG - Intergenic
1140654100 16:77122148-77122170 ATGTGTCCTCCCATGGTGGAAGG - Intergenic
1140688729 16:77460234-77460256 ATTAATCAACCCTGGCTGGATGG + Intergenic
1140770659 16:78201075-78201097 ATTAATCCACCCTGGATAGAAGG + Intronic
1146116552 17:30145724-30145746 ATGTATCCACTATTTGTGGATGG - Intronic
1150836613 17:68569757-68569779 ATCTATCCACCATGGGTGCTTGG + Intronic
1152218107 17:79046088-79046110 ATGTTTCCAACCTGATTGGAAGG - Intronic
1152810559 17:82379900-82379922 ATGGAGGCCCCCTGGGTGGAAGG - Intergenic
1158672712 18:59491329-59491351 ATGGATCCACCCTGTGAGGAAGG - Intronic
1160441542 18:78896506-78896528 ATGTATGTGGCCTGGGTGGATGG - Intergenic
1162916768 19:13878642-13878664 CTCTATCCACCCAGGCTGGATGG + Intronic
1163475362 19:17522884-17522906 ATGAAACCACCCTGGGTGCAAGG - Intergenic
1163519356 19:17782815-17782837 AAGAATCCACCCTGGGCTGAAGG - Intronic
1164947613 19:32309735-32309757 ATGTATCCGCCCTGGGCGCCTGG - Intergenic
1167325340 19:48820992-48821014 ATCTATCCATCCTGGCTGGGTGG - Intronic
1167793674 19:51695528-51695550 CTGGATGCCCCCTGGGTGGATGG - Intergenic
927227798 2:20786838-20786860 CTTTATCCAACCTGGGGGGAAGG - Intronic
927939072 2:27092511-27092533 ATGTATCCACCCTGGGTGGATGG + Intronic
928166982 2:28978894-28978916 CTGTATCGACCCCTGGTGGAAGG - Intronic
928890930 2:36201956-36201978 ATGCATCCAACCTGGGTGGGTGG + Intergenic
933477695 2:82813587-82813609 ATGTATCCACCCTAGATGATTGG + Intergenic
934025154 2:87996352-87996374 AAGCATCCAGCCTGGGAGGAAGG + Intergenic
934115320 2:88785086-88785108 ATGTTTTCACCAAGGGTGGAAGG + Intergenic
934631076 2:95923179-95923201 ATGTTTTCACCAAGGGTGGAAGG - Intronic
934631329 2:95926908-95926930 ATGTTTTCACCAAGGGTGGATGG - Intronic
934802970 2:97185804-97185826 ATGTTTTCACCAAGGGTGGAAGG + Intronic
934833230 2:97554743-97554765 ATGTTTTCACCAAGGGTGGAAGG - Intronic
935400818 2:102658119-102658141 ATGAAACCACCCTGTGTGCAGGG - Intronic
938562982 2:132490865-132490887 AAATATCCACCCTGGTTGGAGGG + Intronic
941917059 2:170819956-170819978 TTGTATCCCTCCTGGGTGGCGGG - Intronic
942054092 2:172166461-172166483 AAGTATCCACCTTGGGTTGCAGG - Intergenic
944936987 2:204579745-204579767 AGGGGTCCACCCTGGGTAGAGGG - Intronic
946173313 2:217908145-217908167 ATACATCCACCCTGGTAGGAGGG - Intronic
947818785 2:233056586-233056608 ATCTATCCACCCAGGCTGGGGGG + Intergenic
1168768881 20:401249-401271 ATGTATCCCCCCTGGATAAATGG - Intergenic
1169754297 20:9026811-9026833 CTGTTTCCACTCTTGGTGGAAGG + Intergenic
1170029910 20:11933803-11933825 ATGTATCCTCACAGGGTGAAAGG + Intergenic
1171059234 20:21940262-21940284 ATTTATCCCCCCAGGCTGGAGGG + Intergenic
1174395790 20:50246258-50246280 AGGTGCCCACCCTGGCTGGAGGG - Intergenic
1175143421 20:56877907-56877929 ATGTAAGTACCCTGGGTGGAAGG - Intergenic
1175647568 20:60687810-60687832 ATTTATCCAGCCTGGGAGGCTGG + Intergenic
1179936658 21:44610348-44610370 CTGTATGCAGCCTGGGTGAAAGG + Intronic
1183049538 22:35249671-35249693 ATGTATTCACTCTGGGTGGTGGG + Intergenic
1183605682 22:38865810-38865832 CTGTGTCCACCCTCGGTGGGGGG + Exonic
1183629364 22:39023930-39023952 AAGTCTCCTCCCTGGGTGGAGGG - Intronic
955437866 3:58922626-58922648 CTGCATCCACTCTTGGTGGAAGG - Intronic
956232424 3:67031642-67031664 ATGTTTCCACCTTGGCTGAAAGG - Intergenic
956700115 3:71951459-71951481 AAGTATCAGCCCTGGCTGGAAGG + Intergenic
961074861 3:123973004-123973026 ATGTGTCCTCACTTGGTGGAGGG + Intronic
961308817 3:125979477-125979499 ATGTGTCCTCACTTGGTGGAGGG - Intronic
962851918 3:139314348-139314370 ATGTATCCTCCTTTGATGGAGGG - Intronic
965768676 3:172158012-172158034 ATGTGTCCACACAGGGTAGAAGG - Intronic
966080373 3:175992830-175992852 ATGTATCCCCCATGGATGGGTGG - Intergenic
969128456 4:4972208-4972230 CTGTGTCCACACAGGGTGGAAGG - Intergenic
972323995 4:37998205-37998227 ATGTATTCACTCTGGGTGTGAGG + Intronic
974991784 4:69101466-69101488 ATTTATCCACCCAGTGTTGAAGG - Intronic
977605342 4:98978971-98978993 ATGTATCCTCACGTGGTGGAAGG + Intergenic
981093674 4:140757273-140757295 ATTTATCCACTCTTGGTAGATGG + Intergenic
984930366 4:184841901-184841923 TTGTACCCACCCTGTGGGGAAGG + Intergenic
985795664 5:1960156-1960178 ATGTAGCCACCCTGAGTGGTGGG + Intergenic
986313942 5:6573652-6573674 GTGTCTCCACCCTGGCTGGTGGG + Intergenic
996038912 5:118788692-118788714 ATGTAGGAAGCCTGGGTGGATGG + Intergenic
999529831 5:152450757-152450779 TTGTAATCACCCTGAGTGGAAGG - Intergenic
1001970242 5:175949532-175949554 ATGCATCCACCATGGCTGCAGGG - Intronic
1002247196 5:177894232-177894254 ATGCATCCACCATGGCTGCAGGG + Intergenic
1002298612 5:178245370-178245392 ATCTATCCACTATGGATGGATGG - Intronic
1007361350 6:41358620-41358642 CTGATTCCACCCTGGCTGGAAGG - Intergenic
1007652799 6:43433678-43433700 ATGTGGCCACCCTGGGAGGTAGG + Intronic
1008635686 6:53408270-53408292 ATTTATCCAGCCTGTCTGGAGGG + Intergenic
1013426676 6:110018588-110018610 ATGCATCCAGCCAGGGTGGCTGG - Intergenic
1013705649 6:112830849-112830871 ATGTATCCCCCCTGGATAAAGGG - Intergenic
1016871212 6:148818577-148818599 ATGTTTCAAACCTGGGTGGCTGG + Intronic
1018101331 6:160443413-160443435 AAGTCTCCAGCGTGGGTGGAGGG - Intronic
1021845791 7:24761428-24761450 ATGTGTCCACACCTGGTGGAAGG + Intergenic
1028399872 7:90413312-90413334 AAGTATGCATACTGGGTGGATGG - Exonic
1028780728 7:94733264-94733286 ATGTATCCTTCCTGGATGTATGG - Intergenic
1030516723 7:110548319-110548341 ATGTATCCACCTTTGGTTTATGG + Intergenic
1033008206 7:137590386-137590408 ATGGCTCCACCCTGGGGAGATGG - Intronic
1033064517 7:138141199-138141221 ATGTATCAAGGCTGGGTGCAGGG - Intergenic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035056170 7:156038322-156038344 ATCTCTCCACCCAGGCTGGAAGG - Intergenic
1037184901 8:16050869-16050891 GTGTATCCTCACTTGGTGGAGGG - Intergenic
1038809666 8:30827589-30827611 ATCTTTCCACCCTGGCTGGTGGG + Intergenic
1045500527 8:102740954-102740976 AACTATCCATCCTGGGTGCATGG + Intergenic
1046974845 8:120262880-120262902 AAGAATCCACTGTGGGTGGAGGG + Exonic
1047323901 8:123818170-123818192 ATGTGTCCTCACGGGGTGGAGGG + Intergenic
1056331008 9:85521372-85521394 ATTGATTCACTCTGGGTGGAAGG - Intergenic
1059533828 9:115062886-115062908 ATGTCTCCAGTCTGGGAGGAGGG + Intronic
1062220336 9:135411618-135411640 ATCGATCCACCCTGTGTGGGAGG - Intergenic
1062223993 9:135438587-135438609 GTGTACCCACTCTGGGTGGGTGG - Intergenic
1203582843 Un_KI270746v1:28483-28505 ATGTTTTCACCAAGGGTGGAAGG + Intergenic
1185481827 X:451985-452007 TTGTACCCACCATGGGTCGAAGG + Intergenic
1186150933 X:6673833-6673855 GTGTATCCAATCTGGGTGTATGG + Intergenic
1186877111 X:13827556-13827578 TTGTCTCCAACCTGGGTGGGAGG - Intronic
1189395694 X:40620878-40620900 AAGTATCCACCTTGGGTTGCAGG + Intergenic
1190163960 X:48056164-48056186 ATGTATCCTCACATGGTGGAAGG + Intronic
1191920288 X:66248850-66248872 ATGTATCCTCCTTGGATAGAGGG + Intronic
1192498991 X:71636321-71636343 AGGTATACAGCCTGGGTAGAAGG + Intergenic
1193733052 X:85124842-85124864 ATAAATCTACCCAGGGTGGATGG + Intergenic
1195877441 X:109556701-109556723 ATATATACACACTGGGTGTATGG - Intergenic
1199324189 X:146477180-146477202 ATGGAGCCAGACTGGGTGGAGGG - Intergenic