ID: 927945646

View in Genome Browser
Species Human (GRCh38)
Location 2:27133693-27133715
Sequence CTGCAGCTAGAGCTGATTAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927945646_927945653 3 Left 927945646 2:27133693-27133715 CCATTAATCAGCTCTAGCTGCAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 927945653 2:27133719-27133741 GTGCTGTGGGAGGGGGAACCCGG 0: 1
1: 0
2: 4
3: 63
4: 657
927945646_927945651 -5 Left 927945646 2:27133693-27133715 CCATTAATCAGCTCTAGCTGCAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 927945651 2:27133711-27133733 TGCAGAAAGTGCTGTGGGAGGGG 0: 1
1: 0
2: 5
3: 47
4: 397
927945646_927945652 -4 Left 927945646 2:27133693-27133715 CCATTAATCAGCTCTAGCTGCAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 927945652 2:27133712-27133734 GCAGAAAGTGCTGTGGGAGGGGG 0: 1
1: 0
2: 5
3: 60
4: 606
927945646_927945654 18 Left 927945646 2:27133693-27133715 CCATTAATCAGCTCTAGCTGCAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 927945654 2:27133734-27133756 GAACCCGGATGAGCAAGTTCAGG 0: 1
1: 0
2: 0
3: 1
4: 69
927945646_927945650 -6 Left 927945646 2:27133693-27133715 CCATTAATCAGCTCTAGCTGCAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 927945650 2:27133710-27133732 CTGCAGAAAGTGCTGTGGGAGGG 0: 1
1: 0
2: 6
3: 47
4: 373
927945646_927945648 -10 Left 927945646 2:27133693-27133715 CCATTAATCAGCTCTAGCTGCAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 927945648 2:27133706-27133728 CTAGCTGCAGAAAGTGCTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 202
927945646_927945656 20 Left 927945646 2:27133693-27133715 CCATTAATCAGCTCTAGCTGCAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 927945656 2:27133736-27133758 ACCCGGATGAGCAAGTTCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 57
927945646_927945655 19 Left 927945646 2:27133693-27133715 CCATTAATCAGCTCTAGCTGCAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 927945655 2:27133735-27133757 AACCCGGATGAGCAAGTTCAGGG 0: 1
1: 0
2: 0
3: 1
4: 70
927945646_927945649 -7 Left 927945646 2:27133693-27133715 CCATTAATCAGCTCTAGCTGCAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 927945649 2:27133709-27133731 GCTGCAGAAAGTGCTGTGGGAGG 0: 1
1: 0
2: 4
3: 23
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927945646 Original CRISPR CTGCAGCTAGAGCTGATTAA TGG (reversed) Exonic
901322870 1:8350063-8350085 CTGCAGCTGGAGCTCATCAGGGG + Intergenic
902395715 1:16131651-16131673 CTGCAGTTTGAGATGAGTAAAGG + Intronic
907194442 1:52675203-52675225 ATGCTGCTAGGGCTGATTCATGG - Intergenic
908027532 1:59968594-59968616 CTGCAGCCAATGGTGATTAACGG - Intergenic
908433746 1:64084508-64084530 CTACAGTTAGAGCAGATCAAAGG + Intronic
909284272 1:73795118-73795140 CTGAAGCCAGAGCTGGCTAAAGG + Intergenic
911875489 1:103157090-103157112 CTGCTGCTACTGCTGAATAATGG + Intergenic
916844670 1:168637599-168637621 CTACAGCTAAAGCTGTTGAATGG - Intergenic
919778429 1:201208420-201208442 CTGGAGCTGGAGCTGGTTATAGG + Exonic
920089530 1:203442371-203442393 CTGGAGCTAGAGCTGGTATAGGG - Intergenic
921490350 1:215768427-215768449 CTGCAGCTGGAGCTGCTCCAAGG + Intronic
1063874139 10:10454647-10454669 ATCCAGCTAGAGCTTATGAAGGG - Intergenic
1069607882 10:69751542-69751564 CTGCAGACAGAGCTCATAAAGGG + Intergenic
1071543421 10:86508676-86508698 GAGCAGCTAGAGCAGCTTAAGGG - Intronic
1071882667 10:89916508-89916530 CTTCAGCTAGAGCTGCTGATGGG + Intergenic
1076030219 10:127151093-127151115 CTGCAGGAAGAGATGATAAAGGG - Intronic
1077516135 11:3003138-3003160 CTGCAGGGAGAGCTTATTAGTGG + Intronic
1079489247 11:20969080-20969102 CTGAAGCTAGAACTCATTTATGG - Intronic
1082888632 11:58114496-58114518 CTTCAGTTAGAGCTGACTACAGG + Intronic
1085195791 11:74670821-74670843 CTGCAGCTGGGGCGGGTTAAGGG + Intergenic
1086369053 11:86138478-86138500 GAGGAGCTAGAGCTGGTTAATGG + Intergenic
1086899987 11:92356402-92356424 TAGCAGCTTGAGCTGACTAAGGG - Intronic
1089145566 11:116327433-116327455 CTCCAGCTAAAGCTGACCAAGGG - Intergenic
1090440126 11:126718508-126718530 CTGCTGCTAATGCTGCTTAAAGG - Intronic
1091300811 11:134506560-134506582 CTGCAGCCAGTGGTGATTACAGG + Intergenic
1092296335 12:7202127-7202149 CTGCAGCTAGAGATGGTCAGGGG + Intronic
1094223660 12:28022810-28022832 CTGCAGCAATAGCTAACTAATGG - Intergenic
1095096124 12:38150270-38150292 CTCCAGCTTGAGCTGATTGCTGG + Intergenic
1095531399 12:43190584-43190606 CTGCAGCTACTGCTATTTAATGG - Intergenic
1103145044 12:118588455-118588477 CTGGAGCTAGTGCTCACTAAGGG + Intergenic
1104122030 12:125808809-125808831 CTGCTGCCAGGGCTGATGAATGG + Intergenic
1104323565 12:127774531-127774553 CTGCTGCCAGGGCTGATGAATGG - Intergenic
1107458364 13:40576577-40576599 CTGCAGCTAGTGCTGAGAGAAGG + Intronic
1109739189 13:66529037-66529059 CAGCAGTTAGAGGAGATTAAAGG - Intronic
1110435949 13:75478687-75478709 CTGCAGCTAGACATGTTAAAGGG - Intronic
1110609491 13:77473320-77473342 CTGCAGTGAGTGCTGATGAATGG - Intergenic
1111324587 13:86676761-86676783 CTGAACCTAGAGATGAGTAAAGG + Intergenic
1114523544 14:23353332-23353354 CTGAAGCTAGGGCTGATACAGGG - Intergenic
1116432386 14:44861587-44861609 CTGCAACTAGAGCTGCTGCATGG + Intergenic
1117065146 14:52006015-52006037 ATGCAGCTAGAGATGAGCAATGG - Exonic
1117776722 14:59190471-59190493 CTGCACCTAGAGCAAATTGAGGG - Intronic
1119498047 14:75097889-75097911 CTGCAGCTAGAACAAAGTAAAGG + Intronic
1124353651 15:28978876-28978898 AAGCAGCTTGAGCTGCTTAATGG + Intronic
1124397495 15:29316643-29316665 TGGCAGCTATAGCTGAGTAATGG + Intronic
1125512198 15:40298121-40298143 CTGAAGCTAGAGAAGATGAATGG - Intronic
1127009346 15:54605219-54605241 ATCCAGCTAGGACTGATTAACGG - Intronic
1127148897 15:56053723-56053745 CTGCAGCTCTAGATGATAAAAGG + Intergenic
1129950903 15:79590300-79590322 CAACAGCTGGAGCTGAGTAAAGG - Intergenic
1131524632 15:93143178-93143200 CTGGAGCGAGAGCTGAGTGAGGG - Intergenic
1132060143 15:98685728-98685750 CTGCCGCTAGACCTGAATACTGG - Intronic
1132757180 16:1491371-1491393 CTGCAGGCAGAGCTGATGGATGG - Intergenic
1134558174 16:15184237-15184259 GTGCAGGTGGTGCTGATTAATGG + Intergenic
1134918706 16:18095839-18095861 GTGCAGGTGGTGCTGATTAATGG + Intergenic
1141455093 16:84136060-84136082 CTGCAGGTGGAGCTGAAGAAGGG - Intronic
1146242411 17:31242992-31243014 CTGCAGCTATATCTGCTTTAGGG + Intronic
1146895651 17:36539902-36539924 TTTGAGCTAGAGCTGATTAGTGG + Intronic
1148732199 17:49844122-49844144 CTGCAGCTGGAGCTGAATGCTGG + Exonic
1149078724 17:52629362-52629384 CTGAGGCTAGAGCTACTTAAAGG - Intergenic
1150442520 17:65202883-65202905 CTGCAGCCAGTGCAGATGAAAGG - Intronic
1151837166 17:76589507-76589529 CTGAAGCAAGAGCTGAAGAATGG - Intergenic
1156468378 18:37362220-37362242 CTGGAGCTGGAGCTAATTACTGG - Intronic
1156510185 18:37629859-37629881 CTGCAGATGGAGCACATTAAGGG - Intergenic
1160288980 18:77572709-77572731 CAGGAGCTAGAGCTGCTGAAGGG - Intergenic
1160309059 18:77771787-77771809 CTGTAGCCAGAGCTTCTTAATGG + Intergenic
1160375097 18:78405737-78405759 CTGCAGGTAGAACTGATTTCTGG + Intergenic
1160950745 19:1666057-1666079 CTGCAGCTAGGGCTGAGTCAGGG + Intergenic
1165798872 19:38535712-38535734 CGGCAGCAAGAGGTGAATAAAGG - Intronic
1166039354 19:40192323-40192345 CTGCAGCTAGAGGAGATCATCGG + Exonic
927945646 2:27133693-27133715 CTGCAGCTAGAGCTGATTAATGG - Exonic
938053859 2:128198842-128198864 CTGGAGCTTGAGCTGAAGAAGGG - Intergenic
943304721 2:186245890-186245912 CTGCAGCTAGAGATGGCTAAAGG - Intergenic
943704965 2:191024897-191024919 CTACAGCTAGAGCAGAATACTGG + Intergenic
944646725 2:201787594-201787616 CTGCTGCTAGAGCTGAGAAAAGG + Intergenic
945319522 2:208406015-208406037 TAGCATCCAGAGCTGATTAAAGG + Intronic
948735298 2:239999726-239999748 CTGCAGCTAAAGCTGAATTTTGG + Intronic
1171043507 20:21788829-21788851 CTGCCGCTAGAGCAGAATGAGGG - Intergenic
1174013386 20:47468832-47468854 ATGCTGCTAGATCTGAATAATGG + Intergenic
1175321671 20:58092642-58092664 ATGCAGGAAGAGCTGAATAAAGG + Intergenic
1175952378 20:62590437-62590459 CTGGAGCCAGAGATGACTAAGGG + Intergenic
1178524550 21:33316011-33316033 CTGCAGTAAGAGATGTTTAAGGG - Intergenic
1179531056 21:42019966-42019988 GTGCAGCTAGAGGTGGTGAAAGG - Intergenic
1185267568 22:49912281-49912303 CTGCAGCTTCAGCTGGTGAACGG - Intronic
950290835 3:11782998-11783020 CTGCAGCTCCAGCTGAATCATGG - Intergenic
951372405 3:21866542-21866564 CTGGAGCAAGGGCTCATTAAAGG + Intronic
951803435 3:26622530-26622552 CTGCAAGTAGAGCTGTGTAAGGG + Intergenic
952319203 3:32259934-32259956 CTGCAGATAGAGCAGCTCAACGG + Intronic
952482082 3:33771879-33771901 TTGCAGCTAGAACTGATTGGTGG + Intergenic
960622541 3:119650898-119650920 CTGCAGGTAGAGCTGCTTTCGGG - Intronic
961572406 3:127809268-127809290 TTGCAGCTAGAGCTGGCTATAGG - Intronic
962462270 3:135625425-135625447 CTGCATTTTTAGCTGATTAAGGG + Intergenic
975740990 4:77428786-77428808 CTGCAGCTATAGCAGATAAAGGG - Intronic
976732645 4:88279688-88279710 CTGCAGGTAGAGCTGTTTCTGGG + Intronic
977663024 4:99612817-99612839 CTGCAGCTAGAACTTCTCAAGGG - Intronic
978933589 4:114348197-114348219 GTGTAGCTGGAGCTGAGTAAGGG + Intergenic
980418281 4:132521990-132522012 CTGCAGCTAGAGGAGAAAAAAGG + Intergenic
980984738 4:139684446-139684468 CTGCAGAGAGATCTGAATAAAGG + Intronic
981075050 4:140582254-140582276 CTGCATTTAGAGCTGATAAGTGG - Intergenic
989268206 5:39502112-39502134 CTGCTGATAAAGCTGTTTAAGGG + Intergenic
990816047 5:59786162-59786184 CTGCAGAAAGAGCTGATCGATGG - Intronic
992626711 5:78642655-78642677 CTGGAGCTAGAGATGATAGAGGG - Intronic
994610391 5:102030732-102030754 CTGGAGCAAAAGATGATTAATGG + Intergenic
1003781708 6:9435501-9435523 CTCCAGTTACAGCTGATTAAAGG - Intergenic
1004630148 6:17413134-17413156 CTGCAGTGAGACCTGATTAGAGG + Intronic
1005707972 6:28475262-28475284 ATACATTTAGAGCTGATTAAAGG + Intergenic
1006973152 6:38067997-38068019 CTGCTGCTAGGGAGGATTAATGG + Intronic
1007021953 6:38529395-38529417 CTGCAGCTATATCTGCTTTAGGG - Intronic
1007112939 6:39323884-39323906 CTGCAGCCACAGCTCATTAAAGG - Intergenic
1007957849 6:45933464-45933486 CTGCAGTTACAACTGATGAAGGG + Intronic
1013086207 6:106859872-106859894 CTGCAGCTGGAGCTGGGGAAAGG + Intergenic
1015168776 6:130228274-130228296 CTGCAGCTAGAGCTCCTTCCAGG + Intronic
1019496091 7:1341309-1341331 CTGCAGCTGGGGCTGATCCAGGG - Intergenic
1021120827 7:16793500-16793522 CTGCTGCTAGAGCTTATAAAAGG - Intronic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1024771418 7:52727944-52727966 CAGCAGTTAGAGCTGTTCAAAGG + Intergenic
1026353243 7:69535621-69535643 CTGCAGCTATAGCTGAGTATAGG - Intergenic
1028393455 7:90340884-90340906 CTTCAGCTAGTGCTGATTTTAGG - Intronic
1030950327 7:115783097-115783119 TAGCAGCTATAGCTGAATAATGG + Intergenic
1031942434 7:127803132-127803154 CTGCAGCTAGAGCAGAATGCAGG - Intronic
1033304553 7:140214898-140214920 CAGCAGCAAGAGCTGGTAAATGG + Intergenic
1033789894 7:144778985-144779007 CTGGACCTGGATCTGATTAAGGG - Intronic
1037985899 8:23290329-23290351 CTGCAGCTAGACCTGGAAAAGGG + Exonic
1040598284 8:48860948-48860970 CTGCAGCTGGAGCTGATGGAGGG + Intergenic
1049080019 8:140435316-140435338 CTGCAGTTTGAGCTAATGAAGGG - Intronic
1053418502 9:37961929-37961951 CTGCAGCTAGCTCCGATGAATGG + Intronic
1055755361 9:79552028-79552050 CTTCAGCTTGAGCTGAGAAATGG + Intergenic
1059202507 9:112431145-112431167 CTGCAGATAGAGCAGATGGAGGG + Intronic
1060289540 9:122288161-122288183 CTGCAGCTAGAGTTAATGATGGG + Intronic
1061180719 9:129023640-129023662 CTGCAGCCAGGGATGATTCATGG - Intronic
1186533374 X:10320282-10320304 CTGCATATTGAACTGATTAATGG - Intergenic
1193448493 X:81636753-81636775 CTGCAGCTATATCTGAATTAGGG - Intergenic
1195998884 X:110760046-110760068 ATGCAGCTAGAGCTGGGGAATGG - Intronic
1196012996 X:110907916-110907938 CTGAAGCAAGAGCAGATTATAGG + Intergenic
1196699722 X:118654921-118654943 CTGCAACTAGAGCTGCTACATGG - Exonic
1198297748 X:135303721-135303743 GTGAAGCTGGAGCAGATTAATGG + Intronic