ID: 927945676

View in Genome Browser
Species Human (GRCh38)
Location 2:27133901-27133923
Sequence CACCCTGTTCTGTAAAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 313}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927945676_927945678 -9 Left 927945676 2:27133901-27133923 CCTCTATTTTACAGAACAGGGTG 0: 1
1: 0
2: 1
3: 32
4: 313
Right 927945678 2:27133915-27133937 AACAGGGTGAAGCTCAGGAGAGG 0: 1
1: 0
2: 3
3: 18
4: 228
927945676_927945680 -4 Left 927945676 2:27133901-27133923 CCTCTATTTTACAGAACAGGGTG 0: 1
1: 0
2: 1
3: 32
4: 313
Right 927945680 2:27133920-27133942 GGTGAAGCTCAGGAGAGGGAAGG 0: 1
1: 0
2: 1
3: 53
4: 470
927945676_927945679 -8 Left 927945676 2:27133901-27133923 CCTCTATTTTACAGAACAGGGTG 0: 1
1: 0
2: 1
3: 32
4: 313
Right 927945679 2:27133916-27133938 ACAGGGTGAAGCTCAGGAGAGGG 0: 1
1: 0
2: 1
3: 42
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927945676 Original CRISPR CACCCTGTTCTGTAAAATAG AGG (reversed) Intronic
901897299 1:12325090-12325112 CACCCTGTCTTTTAAAAAAGGGG - Intronic
902774290 1:18664723-18664745 CTTCCTGATCTGTAAAATGGGGG - Intronic
904407661 1:30303786-30303808 TTTCCTTTTCTGTAAAATAGGGG - Intergenic
904690658 1:32291470-32291492 TATCCTGTCCTGTAAAATGGAGG + Intergenic
905397012 1:37673246-37673268 CATCCTTGTCTGTAAAACAGGGG + Intergenic
905592824 1:39179500-39179522 TTTCCTGTTCTGTAAAATGGAGG + Intronic
906864467 1:49401721-49401743 CAATCTGTTCTGAAAAATAGAGG - Intronic
908175259 1:61549384-61549406 CAACCTATTCTGAAAACTAGAGG - Intergenic
908958518 1:69666360-69666382 CAAACTATTCTGAAAAATAGAGG - Intronic
908979302 1:69934877-69934899 CTCCCTGTGCTGGAAAAAAGAGG + Intronic
909203265 1:72720922-72720944 CACCCTTTTTTACAAAATAGAGG - Intergenic
911020257 1:93379178-93379200 CAAACTATTCTGAAAAATAGAGG + Intergenic
911283675 1:95962307-95962329 CAAACTATTCTGCAAAATAGAGG - Intergenic
912614841 1:111088085-111088107 CAAACTATTCTGAAAAATAGAGG - Intergenic
912644198 1:111375692-111375714 CAAACTATTCTGAAAAATAGAGG + Intergenic
912898929 1:113626499-113626521 CAAACTATTCTGAAAAATAGAGG - Intronic
913036615 1:114971959-114971981 CAAACTATTCTGAAAAATAGAGG - Intronic
913165076 1:116177735-116177757 CACCTTTAGCTGTAAAATAGTGG + Intergenic
915178111 1:154034223-154034245 CAAACTATTCTGAAAAATAGAGG - Intronic
916177663 1:162056051-162056073 CAATGTGTTCTGTAAAATGGGGG + Intergenic
916360861 1:163966685-163966707 CAAACTATTCTGAAAAATAGAGG + Intergenic
917623306 1:176820065-176820087 CACTCTGTTCAATGAAATAGAGG - Intronic
918677821 1:187310401-187310423 CACCCAGTTCTGTTCAATAATGG + Intergenic
920549981 1:206851483-206851505 CAAACTATTCTGAAAAATAGAGG + Intergenic
920644269 1:207787490-207787512 GACCCTATGCTGTAAAATATGGG - Intronic
921179744 1:212622679-212622701 CTCCCTCATCTGTAAAATGGGGG - Intergenic
921237501 1:213148718-213148740 CAAACTATTCTGAAAAATAGAGG - Intronic
923028984 1:230231760-230231782 CTTCCTGTTCGGTAAAATGGAGG - Intronic
1062931460 10:1355240-1355262 AACACTGTTCATTAAAATAGAGG - Intronic
1068451182 10:57191068-57191090 CAAGCTATTCTGAAAAATAGAGG - Intergenic
1069700473 10:70421156-70421178 AACGCAGTTCTGGAAAATAGAGG - Intronic
1071007986 10:80905184-80905206 CAAACTATTCTGAAAAATAGAGG - Intergenic
1071221182 10:83466370-83466392 CAAATTGTTCTGAAAAATAGAGG + Intergenic
1072225448 10:93364483-93364505 CACTCTGTTTTAAAAAATAGTGG - Intronic
1072793568 10:98337096-98337118 GTCCCTATTCTGTAAAATGGAGG + Intergenic
1072843423 10:98800824-98800846 CAAACTATTCTGAAAAATAGAGG + Intronic
1074637779 10:115340569-115340591 CAAACTATTCTGAAAAATAGAGG - Intronic
1075759978 10:124848401-124848423 GACCCTGTTTTGTAAAAACGGGG + Intergenic
1078434594 11:11314019-11314041 CTCCCTGATCAGTAAAATGGGGG - Intronic
1079415666 11:20233563-20233585 CAAACTGTTCTGAAAAATAGAGG - Intergenic
1080351537 11:31390814-31390836 TACACTATTCTGAAAAATAGAGG + Intronic
1082971206 11:59023260-59023282 CAAACTCTTCTGAAAAATAGAGG + Intronic
1083376760 11:62229827-62229849 CACCCTGTTCTGTCTAGTGGAGG - Intergenic
1084646327 11:70460779-70460801 CCTCCTCTTCTGTAAACTAGGGG + Intergenic
1084711516 11:70846799-70846821 CACCCTTCTCTGAAAAATGGGGG + Intronic
1085007799 11:73110232-73110254 CAAACTATTCTGAAAAATAGAGG - Intronic
1085147691 11:74217067-74217089 CAAACTATTCTGAAAAATAGAGG + Intronic
1085178867 11:74515565-74515587 TACTCTGTTCTGACAAATAGAGG + Intronic
1085309547 11:75508048-75508070 CTCCCTGTCCTATAAAATGGAGG - Intronic
1085501633 11:77029978-77030000 CACCCTAGTCTGAAAAACAGGGG - Intergenic
1086069083 11:82779847-82779869 CAAACTCTTCTGAAAAATAGAGG + Intergenic
1086569933 11:88270797-88270819 CAAACTATTCTGAAAAATAGAGG + Intergenic
1089937635 11:122381555-122381577 CAAACTGTTCTGAAAAAGAGAGG + Intergenic
1090111502 11:123914993-123915015 CAAACTGTTCTGAAAAATAGAGG + Intergenic
1091052877 11:132389635-132389657 CAAACTATTCTGAAAAATAGAGG + Intergenic
1091465310 12:678808-678830 CAGCCTGGTCTGTGAAATAAAGG - Intergenic
1092324955 12:7521155-7521177 CAAACTATTCTGAAAAATAGAGG - Intergenic
1094420106 12:30262321-30262343 CAAACTCTTCTGAAAAATAGAGG + Intergenic
1094717503 12:33027765-33027787 CTCTCTGCTCTGTAAAATTGAGG - Intergenic
1094786721 12:33857569-33857591 CAAACTATTCTGAAAAATAGAGG - Intergenic
1095964327 12:47856956-47856978 CACCCCTTTCTGTAACAGAGGGG + Intronic
1096585114 12:52614882-52614904 CACCCTTCTCTGAGAAATAGAGG - Intronic
1096930396 12:55201770-55201792 CAAACTATTCTGAAAAATAGAGG + Intergenic
1097466542 12:59932587-59932609 CAAACTATTCTGAAAAATAGAGG + Intergenic
1097733920 12:63160360-63160382 CATCCTTATGTGTAAAATAGTGG - Intergenic
1098649392 12:72945118-72945140 CAAACTATTCTGAAAAATAGAGG + Intergenic
1100360466 12:93873986-93874008 CAAACTATTCTGAAAAATAGAGG - Intronic
1100946705 12:99792340-99792362 CAAACTGTTCTGAAAAATAGGGG + Intronic
1101377277 12:104182164-104182186 CACCCTTCTCTGTAGATTAGTGG + Intergenic
1102045172 12:109825418-109825440 CATCCTTATCTGTAAAATGGGGG - Intronic
1104387897 12:128366570-128366592 CACCCTGTTCAGTAAGTTTGAGG + Intronic
1106963764 13:35034589-35034611 CAAACTATTCTGAAAAATAGAGG - Intronic
1106976967 13:35230320-35230342 CACCGAAATCTGTAAAATAGGGG + Intronic
1107287432 13:38810850-38810872 AAAACTGTTCTGAAAAATAGGGG - Intronic
1107551776 13:41483022-41483044 CAAACTATTCTGAAAAATAGAGG - Intergenic
1110078661 13:71283181-71283203 CAAACTATTCTGAAAAATAGAGG - Intergenic
1110379864 13:74838262-74838284 CACCCTGTGGTTTATAATAGAGG + Intergenic
1110443558 13:75550831-75550853 CACCGTGTTCTTAAAAATATTGG + Intronic
1112778573 13:102872184-102872206 CACCATTCTCTGTAAAATAAAGG - Exonic
1114506834 14:23222581-23222603 CAAACTGTTCTGAAAAGTAGAGG + Intronic
1115276082 14:31610513-31610535 CAAACTGTTCTGAAAAACAGAGG + Intronic
1115892530 14:38047313-38047335 CTTTCTGTTCTGTATAATAGTGG - Intergenic
1116058235 14:39890150-39890172 CAAACTATTCTGAAAAATAGAGG + Intergenic
1116149231 14:41117385-41117407 CAAACTGTTCTGAAAAACAGAGG + Intergenic
1116809903 14:49529475-49529497 CAACCTATTCTAAAAAATAGAGG + Intergenic
1117208095 14:53465842-53465864 CAAACTATTCTGAAAAATAGAGG - Intergenic
1117633641 14:57720373-57720395 CAAACAGTTCTGAAAAATAGAGG - Intronic
1120352629 14:83382410-83382432 CAAACTATTCTGAAAAATAGAGG + Intergenic
1120390947 14:83908201-83908223 CAATCTGTTTTGTAAAATAGAGG - Intergenic
1121267982 14:92616657-92616679 CACCCTGCTCTGTATAGTGGAGG + Intronic
1121661987 14:95641882-95641904 CACGCTGTTCTGTAGAGTTGTGG - Intergenic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1124367671 15:29084878-29084900 CTCTGTGTCCTGTAAAATAGTGG + Intronic
1126052696 15:44701339-44701361 CAAACTATTCTGAAAAATAGAGG - Intronic
1126202579 15:46004121-46004143 CACCCTGTTATGCTAAATAGTGG + Intergenic
1126709029 15:51436688-51436710 CAAACTATTCTGGAAAATAGAGG - Intergenic
1126784046 15:52162190-52162212 CACCCTGCTCTGTAAAATGAGGG + Intronic
1126901914 15:53323248-53323270 CATCTTGTTCTGTGTAATAGAGG + Intergenic
1128734657 15:70046435-70046457 CACCCTGTTAAGTAAAAAGGGGG + Intergenic
1131323199 15:91416817-91416839 CAAACTGTTCTGAAAAATAGAGG - Intergenic
1131658014 15:94482322-94482344 CACCCTGGACTTTCAAATAGTGG + Exonic
1133773478 16:8881239-8881261 CTGCCTCATCTGTAAAATAGGGG - Intergenic
1133844645 16:9442586-9442608 TACACTTTTCTGTAAAATGGGGG + Intergenic
1133974895 16:10593673-10593695 CTCCCTCATCTGTAAAACAGGGG - Intergenic
1134763120 16:16731697-16731719 CTCCCTCATCTGTAAAATGGGGG + Intergenic
1134982932 16:18627452-18627474 CTCCCTCATCTGTAAAATGGGGG - Intergenic
1135544817 16:23358464-23358486 TTCCCTCCTCTGTAAAATAGGGG + Intronic
1135768278 16:25196823-25196845 CTCCCTTGTCTGTAAAATGGGGG + Intergenic
1137018837 16:35402304-35402326 CACCATGTTCTGTCAGATACAGG - Intergenic
1142178000 16:88653794-88653816 CACCGTGTTCTGCAGAACAGCGG + Intronic
1142221879 16:88859273-88859295 CACATTATTTTGTAAAATAGTGG - Intronic
1144243851 17:13342566-13342588 TACTCTGTACTGTAAAATATGGG + Intergenic
1145216306 17:21055084-21055106 AACCTTGTTCTGTAAAATCACGG + Intergenic
1146798025 17:35796169-35796191 CACCCTGTTCAGTAATTTACAGG - Intronic
1148525491 17:48329156-48329178 CCCCCTTTTCTCTACAATAGTGG + Intronic
1150864310 17:68833565-68833587 CTTCCTGATCTGTAAAATGGAGG + Intergenic
1151503441 17:74508568-74508590 CAAACTATTCTGGAAAATAGAGG - Intergenic
1153099919 18:1455575-1455597 CAAACTATTCTGAAAAATAGAGG + Intergenic
1153268048 18:3290839-3290861 CAAACTATTCTGAAAAATAGGGG - Intergenic
1153794711 18:8610780-8610802 AACCCCGTTCTTTAAAATAAAGG + Intronic
1154386906 18:13901831-13901853 CAAACTGTTTTGAAAAATAGAGG + Intronic
1156150069 18:34230844-34230866 CACCAGAATCTGTAAAATAGTGG + Intergenic
1156399637 18:36728800-36728822 CACCTTGTTCTCTAAAGCAGGGG - Intronic
1157497016 18:48163304-48163326 TTCCCTCATCTGTAAAATAGTGG + Intronic
1157548668 18:48565615-48565637 TTCCCTGATCTGTAAAATAAGGG + Intronic
1157879679 18:51308884-51308906 CAAACTATTCTGAAAAATAGAGG + Intergenic
1160177395 18:76606831-76606853 CCCCCTGGTCTATAAAAGAGGGG - Intergenic
1163396691 19:17067541-17067563 CACCCTGATTTTTAAAATGGGGG + Intronic
1165870858 19:38972146-38972168 CAGTCTGTTTTGTAAAATGGAGG - Intronic
1166732121 19:45064855-45064877 CACCCTGTCGTGGAAAACAGCGG - Intronic
1167133199 19:47600856-47600878 CTCCAGGTTCTGTTAAATAGGGG - Intergenic
1168097496 19:54123983-54124005 CATCCTTTTCTGTAGAATGGGGG + Intronic
925526586 2:4809542-4809564 ATCCCTGTTCTGAATAATAGAGG + Intergenic
926368820 2:12160148-12160170 CAAACTTTTCTGAAAAATAGAGG - Intergenic
926833659 2:16993267-16993289 CAAGCTGTTCTAAAAAATAGAGG - Intergenic
927945676 2:27133901-27133923 CACCCTGTTCTGTAAAATAGAGG - Intronic
928115405 2:28542432-28542454 AACTCTGTTCTGTAAAATCAGGG + Intronic
928783954 2:34858806-34858828 CAAACTATTCTGAAAAATAGAGG + Intergenic
929388333 2:41438526-41438548 CAAACTATTCTGGAAAATAGAGG - Intergenic
929536853 2:42789158-42789180 TAACCTTATCTGTAAAATAGAGG + Intronic
932517824 2:72371293-72371315 CAAACTGTTCTGAAAAATTGAGG + Intronic
932731990 2:74227931-74227953 CACCCTGTTCTGGATGACAGTGG + Intronic
933277163 2:80296197-80296219 CACACTGATTTTTAAAATAGAGG + Intronic
933581602 2:84132960-84132982 TACCCTGTTCTATAAAAAATTGG + Intergenic
933758498 2:85659329-85659351 CCCCCTGTCCTGTAAAGCAGTGG + Intronic
934091947 2:88558816-88558838 CTTCCTCATCTGTAAAATAGGGG + Intronic
935611126 2:105026536-105026558 CACACTGTTATTTCAAATAGAGG + Intergenic
938944694 2:136201507-136201529 CAAACTATTCTGAAAAATAGAGG - Intergenic
939707564 2:145474345-145474367 CAAACTATTCTGAAAAATAGAGG - Intergenic
939836281 2:147133360-147133382 CATCTTATTCTGTAAAATACTGG - Intergenic
940258468 2:151757067-151757089 CACGCTGTTCTCTAGGATAGTGG + Intergenic
940400145 2:153239860-153239882 CAAACTATTCTGAAAAATAGAGG - Intergenic
940503421 2:154523323-154523345 CAAACTATTCTGAAAAATAGAGG - Intergenic
941672172 2:168306168-168306190 CAAACTATTCTGAAAAATAGAGG - Intergenic
941851446 2:170186664-170186686 CAAGCTATTCTGAAAAATAGAGG - Intronic
942143999 2:173007925-173007947 AAGCCCCTTCTGTAAAATAGGGG + Intronic
943170396 2:184390187-184390209 CAAACTATTCTGAAAAATAGAGG + Intergenic
943430508 2:187794952-187794974 CAGACTGTTCTGCAAAATAGAGG + Intergenic
944377317 2:199061767-199061789 CAAACTATTCTGAAAAATAGAGG + Intergenic
946508705 2:220330727-220330749 CAAACTGTTCTGAAAAATAGAGG - Intergenic
946676424 2:222164571-222164593 CTCCCTGTTCTGTCTAATAATGG - Intergenic
946985024 2:225262281-225262303 CAAACTATTCTGAAAAATAGAGG + Intergenic
947297103 2:228643399-228643421 CCACCAGTTCTGAAAAATAGGGG + Intergenic
1168899538 20:1350729-1350751 CAAACTATTCTGAAAAATAGAGG - Intronic
1171938253 20:31297302-31297324 CAAACTATTCTGAAAAATAGAGG + Intergenic
1176224157 20:63985855-63985877 CAGACTATTCTGAAAAATAGAGG + Intronic
1177192950 21:17872004-17872026 TTCCCTGATCTGTAAAATAATGG - Intergenic
1177964343 21:27708652-27708674 CAAACTATTCTGAAAAATAGAGG - Intergenic
1178849986 21:36205048-36205070 CACCCTGTACTGTAAACTGCAGG - Intronic
1179019106 21:37622069-37622091 CACTTTGTTCTGTCAAATTGGGG + Exonic
1185294469 22:50046459-50046481 CACCCTGTTAAGGAAAAAAGTGG + Intronic
949791734 3:7800170-7800192 CAGCCTGTTCTGTGCACTAGGGG + Intergenic
950695154 3:14694234-14694256 CAAACTTTTCTGAAAAATAGAGG - Intronic
951070613 3:18324620-18324642 CACCCTATTGTGAAAAATAGAGG + Intronic
951255324 3:20442600-20442622 CAAACTGTTCTGAAAATTAGAGG + Intergenic
955129162 3:56146694-56146716 CACATTCTTCTATAAAATAGGGG - Intronic
955366997 3:58319317-58319339 CGGTCTGATCTGTAAAATAGTGG + Intergenic
956912454 3:73832759-73832781 CAAGCTGTTCTGTTAAAGAGTGG + Intergenic
958617852 3:96518686-96518708 CAAACTATTCTGAAAAATAGAGG + Intergenic
961625400 3:128259037-128259059 GACCCTCTTCTATGAAATAGGGG + Intronic
962638515 3:137357689-137357711 CAAGCTATTCTGAAAAATAGAGG - Intergenic
962689005 3:137874317-137874339 CAAACTGTTCCATAAAATAGAGG + Intergenic
963310407 3:143704170-143704192 CAAACTATTCTGAAAAATAGAGG + Intronic
963692613 3:148523596-148523618 CAAACTGTTCTGAAAAATAGAGG + Intergenic
964079812 3:152740721-152740743 CAGCATTTTCAGTAAAATAGAGG + Intergenic
964258533 3:154807193-154807215 CACACTATTCTAAAAAATAGAGG - Intergenic
964961326 3:162431169-162431191 CAAACTATTCTGAAAAATAGAGG + Intergenic
965016518 3:163165513-163165535 CAATCTATTCTGAAAAATAGGGG - Intergenic
965535201 3:169816201-169816223 CAAGCTGTTCTGAAAAATAGAGG - Intergenic
965860933 3:173149254-173149276 CAAACTATTCTGAAAAATAGAGG + Intergenic
967517252 3:190384708-190384730 CTCCCTCTTCTGTAAAATGTGGG + Intronic
968004553 3:195231932-195231954 CAAACTATTCTGAAAAATAGGGG - Intronic
968695570 4:2024369-2024391 CACCCTGTCCTGGAAAACAAAGG - Intronic
970385599 4:15553586-15553608 CTCCCCCATCTGTAAAATAGGGG - Intronic
971213344 4:24640726-24640748 CACCCTGTTCTGTCTAGTGGAGG + Intergenic
971711120 4:30113950-30113972 CAACCTCTTCAGTAAAATATGGG - Intergenic
972103856 4:35457799-35457821 CAAACTATTCTGAAAAATAGAGG - Intergenic
974189706 4:58488883-58488905 CACCCTGTTCTGTCTAGTGGAGG + Intergenic
975463250 4:74679447-74679469 AAAACTGTTCTGGAAAATAGAGG - Intergenic
976109704 4:81658325-81658347 CAAACTATTCTGAAAAATAGAGG - Intronic
976658736 4:87517017-87517039 CACCCTGTCCTGTGTTATAGTGG + Intronic
977054844 4:92179203-92179225 CAAACTCTTCTGAAAAATAGAGG + Intergenic
977855042 4:101879545-101879567 CAAACTATTCTGAAAAATAGAGG + Intronic
978212325 4:106152623-106152645 CAGACTATTCTGAAAAATAGTGG - Intronic
978221562 4:106281946-106281968 CAAACTGTTCTGAAAAATAAAGG - Intronic
978406264 4:108382286-108382308 CACCCTTTTCACTTAAATAGTGG - Intergenic
978922124 4:114197034-114197056 CAAACTATTCTGAAAAATAGGGG - Intergenic
978980881 4:114944132-114944154 CACCCTGCTCTATAATTTAGGGG + Intronic
979192492 4:117879138-117879160 CACCCAGTTCTTTAAACTTGGGG - Intergenic
979293929 4:119009597-119009619 CACCATGTTCTGTCAAATAATGG + Intronic
979422290 4:120520159-120520181 CAAACTATTCTGAAAAATAGAGG + Intergenic
979727207 4:123976751-123976773 GAGGCTGTCCTGTAAAATAGTGG + Intergenic
980301927 4:131006975-131006997 CACCCTGTTCTGTGTAGTGGAGG + Intergenic
981849752 4:149216389-149216411 GACCCTGTTCTAGAAATTAGCGG - Intergenic
982055828 4:151548015-151548037 AAGCCTCATCTGTAAAATAGAGG - Intronic
985690216 5:1305030-1305052 CAAACTATTCTGAAAAATAGAGG - Intergenic
986884923 5:12222177-12222199 CAAACTATTCTGAAAAATAGAGG - Intergenic
987946642 5:24617949-24617971 GACACTGATATGTAAAATAGAGG - Intronic
988625708 5:32872199-32872221 TAGCCATTTCTGTAAAATAGAGG - Intergenic
988939891 5:36133422-36133444 CACCCTGTTCTATCAAATACTGG - Intronic
989553572 5:42764371-42764393 CAAACTGTTCTGAAAAACAGAGG + Intronic
990095884 5:52112075-52112097 CACACTATTCTGAAAAATAGAGG - Intergenic
990750279 5:59007524-59007546 CATTCTGTTATGTAAAATATTGG - Intronic
990784641 5:59406072-59406094 CAAACTATTCTGAAAAATAGAGG - Intronic
991672231 5:69059789-69059811 CAAGCTATTCTGAAAAATAGAGG - Intergenic
992751426 5:79866342-79866364 CACACTGTACTATAAAATAATGG + Intergenic
993580754 5:89658272-89658294 CAAACTATTCTGAAAAATAGAGG + Intergenic
994265239 5:97708098-97708120 CAAACTTTTCTGAAAAATAGAGG + Intergenic
994349516 5:98728470-98728492 TACCATGTTCTTTTAAATAGTGG - Intergenic
994530282 5:100960499-100960521 CAAACTATTCTGAAAAATAGAGG + Intergenic
994596890 5:101849991-101850013 CAAAATGTTCTGAAAAATAGAGG - Intergenic
995419902 5:111952657-111952679 CAGCCTTTACTGTAAAACAGAGG - Intronic
996653347 5:125909658-125909680 CAAACTATTCTGAAAAATAGAGG - Intergenic
997180246 5:131820564-131820586 CAAACTGTTCTGAAAAATGGAGG - Intronic
997284582 5:132669036-132669058 CAGCCTCATCTGTGAAATAGGGG - Intergenic
1002542944 5:179918139-179918161 CACCCTTTTCTGGAAAATTGGGG - Intronic
1003629287 6:7772157-7772179 CAGAGTGGTCTGTAAAATAGAGG - Intronic
1005156771 6:22816004-22816026 CAAACTGTTCTGAAAAACAGAGG - Intergenic
1006059301 6:31408388-31408410 CAAACTGTTCTGAAAAATAGAGG - Intronic
1006114028 6:31765852-31765874 CACCCTGTGATGGAAAGTAGTGG + Intronic
1006499994 6:34452248-34452270 CATCCTCCTCTGTAAAGTAGGGG + Intergenic
1006938453 6:37735047-37735069 ATCCCTGTTCTCTAATATAGAGG - Intergenic
1008100634 6:47387153-47387175 CAAACTGTTCTGAAAAATAAAGG - Intergenic
1008177304 6:48284498-48284520 CAAACTGTTCTGAAAAATAGAGG - Intergenic
1008847845 6:55989780-55989802 CAAACTCTTCTGAAAAATAGAGG - Intergenic
1008858345 6:56118528-56118550 CAAACTATTCTGAAAAATAGAGG + Intronic
1010061829 6:71631760-71631782 CAAACTGTTCTAAAAAATAGAGG - Intergenic
1011290767 6:85774271-85774293 CAAACTGTTCTGAAAAACAGAGG - Intergenic
1012224899 6:96693126-96693148 CAACCTATTCTAAAAAATAGAGG + Intergenic
1012288100 6:97417892-97417914 CAAACTATTCTGAAAAATAGAGG - Intergenic
1012512466 6:100019296-100019318 CAAACTATTCTGAAAAATAGTGG + Intergenic
1013083709 6:106836284-106836306 CAAACTCTTCTGAAAAATAGAGG - Intergenic
1013731582 6:113174221-113174243 CACTCTGTTCTATAAAAAAAGGG + Intergenic
1013812417 6:114059839-114059861 CAGCCTGTTCTGCAGAATTGAGG + Intronic
1016824470 6:148375793-148375815 CACTCTGATCTGTAATATACAGG - Intronic
1017242953 6:152191323-152191345 CAATCTATTCTGAAAAATAGAGG - Intronic
1017318975 6:153066450-153066472 CAAACTATTCTGAAAAATAGAGG + Intronic
1017450314 6:154548742-154548764 GAGCCTTTTCTGTAAAACAGAGG - Intergenic
1017998086 6:159551632-159551654 CAAACTATTCTGAAAAATAGAGG - Intergenic
1018610025 6:165639155-165639177 CTCCCTAATCTGTAAAATGGTGG - Intronic
1022223280 7:28336237-28336259 TAAACTGTTCTGAAAAATAGAGG - Intronic
1022757266 7:33305453-33305475 CAAACTATTCTGAAAAATAGAGG - Intronic
1022898324 7:34775381-34775403 CAAACTATTCTGAAAAATAGAGG - Intronic
1023208620 7:37778270-37778292 CAAACTATTCTGAAAAATAGAGG - Intronic
1023467392 7:40471223-40471245 CATTCTGTTATCTAAAATAGAGG + Intronic
1023716500 7:43049632-43049654 CAAACTGTTCTGAAAAATAGAGG + Intergenic
1024929402 7:54654076-54654098 TTCCCTGTTCTGTAGAATAAGGG + Intergenic
1027398801 7:77786449-77786471 AACCCTGTACTGTAAAGCAGGGG - Intergenic
1027523523 7:79239093-79239115 CACCATGTTTTTTAAAATAATGG + Intronic
1027863266 7:83612668-83612690 CACTCTGTTCTTTAAAATCCAGG - Intronic
1028340189 7:89709058-89709080 CAACGTCTTCTGTAAAATAAGGG + Intergenic
1028501753 7:91527118-91527140 CCCCCTGTTCTGTATCATAGTGG + Intergenic
1030431127 7:109450591-109450613 CAAACTGTTCTGTAAAATAGAGG - Intergenic
1031559723 7:123223995-123224017 TAAACTGTTCTGTAAAATAGAGG - Intergenic
1032939515 7:136772545-136772567 CAAACTGTTCTGAAACATAGAGG + Intergenic
1033072258 7:138214856-138214878 CACCCTGTGCTGTCTAATGGAGG + Intergenic
1035465856 7:159076033-159076055 CACCCTGTTCTGTACAGAAGTGG + Intronic
1040792448 8:51248481-51248503 TACACTGTTCAGTAAAATACAGG - Intergenic
1042546290 8:69954358-69954380 CTCCCTCATCTGTAAAATTGGGG + Intergenic
1042898763 8:73699768-73699790 CAAACTATTCTGAAAAATAGAGG + Intronic
1043600569 8:81932442-81932464 CAAACTGTTACGTAAAATAGAGG + Intergenic
1044852623 8:96444017-96444039 CTCCCTTATCTGTAAAACAGGGG + Intergenic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1045777143 8:105818337-105818359 CAAACTATTCTGAAAAATAGAGG - Intergenic
1045857595 8:106781990-106782012 CTTCCTTTTCTGTAGAATAGGGG + Intergenic
1046267973 8:111857004-111857026 CAAACTATTCTGAAAAATAGAGG + Intergenic
1047014057 8:120703562-120703584 CACTCTATCCTGTAAAATGGAGG + Intronic
1047841549 8:128759269-128759291 CAAACTCTTCTGAAAAATAGAGG + Intergenic
1048991900 8:139765464-139765486 CACCCTGTCCTTTAAGATATTGG - Intronic
1049258355 8:141625665-141625687 CACCCTGGTGGGTAAAATGGTGG + Intergenic
1050316377 9:4405672-4405694 CAAACTGTTCTGAAAAATAGAGG + Intergenic
1050726211 9:8652100-8652122 TACCCTGAGCTGTAAATTAGAGG - Intronic
1050906127 9:11008893-11008915 CAAACTATTCTGAAAAATAGAGG - Intergenic
1051980037 9:23002741-23002763 TACCCTGTTGTGTAAAAAAGGGG + Intergenic
1052420643 9:28239236-28239258 CAGACTGTTCTGAAAAATAGAGG + Intronic
1053028474 9:34752635-34752657 CAAACTATTCTGAAAAATAGAGG + Intergenic
1053586922 9:39468392-39468414 CAATCTTTTCAGTAAAATAGAGG - Intergenic
1054579385 9:66896839-66896861 CAATCTTTTCAGTAAAATAGAGG + Intronic
1055016602 9:71625239-71625261 CACGCTTTCCTGTACAATAGAGG + Intergenic
1055037431 9:71832744-71832766 CAAACTATTCTGAAAAATAGAGG + Intergenic
1056155049 9:83825910-83825932 TACCATGTTATGTAAGATAGGGG - Intronic
1057497634 9:95573432-95573454 TTCCCTCTTCTGTAAAATATGGG - Intergenic
1057970234 9:99548620-99548642 CACACTATTCTGAAAAATAGAGG - Intergenic
1058133508 9:101280387-101280409 CAAACTATTCTGCAAAATAGAGG + Intronic
1059164552 9:112065746-112065768 CAGCCTCATCTGTTAAATAGGGG + Intronic
1060058986 9:120442146-120442168 CTTCCTCTTCTGTAAAATGGGGG - Intronic
1187594119 X:20752396-20752418 CAAACTATTCTGAAAAATAGAGG - Intergenic
1187600452 X:20823688-20823710 CACCCTGTTTGTTAAAATTGTGG - Intergenic
1188404472 X:29790807-29790829 CACCATTTACTGTAAAGTAGTGG - Intronic
1188866730 X:35322213-35322235 CAAACTATTCTGAAAAATAGAGG + Intergenic
1188996413 X:36891626-36891648 CAAACTATTCTGAAAAATAGTGG + Intergenic
1189643761 X:43103963-43103985 CACCCACTTCTGTTAAAAAGAGG + Intergenic
1189657657 X:43263028-43263050 CAAACTATTCTGAAAAATAGAGG - Intergenic
1189844796 X:45125128-45125150 CAGACTGTTCTGACAAATAGAGG - Intergenic
1190580917 X:51892866-51892888 CTTCCTGATCTGCAAAATAGGGG + Intronic
1191972808 X:66836318-66836340 CAAACTATTCTGAAAAATAGAGG + Intergenic
1192069862 X:67926573-67926595 CAAACTATTCTGAAAAATAGAGG + Intergenic
1192100322 X:68257488-68257510 TTTCCTGTTCTGTAAAATGGGGG + Intronic
1192351796 X:70362023-70362045 GGCCATGTTTTGTAAAATAGTGG + Intronic
1192394459 X:70764920-70764942 CAAACTGTTCTGAAAAATAGAGG + Intronic
1192521578 X:71806087-71806109 CAAACTGTTCTGAAAAACAGCGG + Intergenic
1192927722 X:75774116-75774138 CAAACTGTTCTGAAAAATAGGGG + Intergenic
1192975875 X:76284748-76284770 CAAACTTTTCTGAAAAATAGAGG - Intergenic
1192990261 X:76445328-76445350 CAAACTATTCTGAAAAATAGAGG - Intergenic
1193528926 X:82629838-82629860 CAAACTATTCTGAAAAATAGAGG + Intergenic
1193610468 X:83625666-83625688 CAAACTATTCTGAAAAATAGAGG - Intergenic
1193742644 X:85236280-85236302 CAAGCTATTCTGAAAAATAGAGG + Intergenic
1193761448 X:85471584-85471606 CAAACTATTCTGAAAAATAGAGG - Intergenic
1194478984 X:94396767-94396789 CAAACTATTCTGTAAAATAGAGG - Intergenic
1194546674 X:95243765-95243787 CTCCATATTCTGAAAAATAGAGG + Intergenic
1194640049 X:96392882-96392904 TATCCTGTTTTGTAAAATAGAGG + Intergenic
1195455205 X:105060677-105060699 CAAACTATTCTGAAAAATAGAGG - Intronic
1195820114 X:108935509-108935531 CAAACTATTCTGAAAAATAGAGG - Intergenic
1195873781 X:109516340-109516362 CAAACTATTCTGAAAAATAGAGG + Intergenic
1195975915 X:110526615-110526637 CACCCTCTTTTTTAAAATAAAGG + Intergenic
1195982995 X:110600417-110600439 CAAACTATTCTGAAAAATAGGGG - Intergenic
1196975133 X:121150949-121150971 CATCCTCATCTGTAAAATGGGGG + Intergenic
1197429707 X:126346424-126346446 CAAGCTATTCTGAAAAATAGAGG + Intergenic
1197458268 X:126705670-126705692 CAAACTGTTTTGAAAAATAGAGG + Intergenic
1198595288 X:138229396-138229418 TGACCTGGTCTGTAAAATAGTGG + Intergenic
1198612302 X:138415582-138415604 CAAACTATTCTGAAAAATAGAGG + Intergenic
1198642969 X:138777044-138777066 CACCTTGTTCTGTTGGATAGGGG - Intronic
1198795967 X:140395029-140395051 CAAACTATTCTGAAAAATAGAGG + Intergenic
1199210848 X:145208314-145208336 CAAACTATTCTGAAAAATAGAGG + Intergenic
1199358554 X:146889738-146889760 CAAACTATTCTGAAAAATAGAGG + Intergenic
1199732417 X:150649145-150649167 CATCCTCTCCTGTAAAATAGGGG - Intronic
1200909947 Y:8523205-8523227 ATCACTGTTCTGTAAAAGAGAGG + Intergenic