ID: 927945840

View in Genome Browser
Species Human (GRCh38)
Location 2:27134663-27134685
Sequence GCGCTCCTGCGCCTGCGCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 128}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927945840_927945848 21 Left 927945840 2:27134663-27134685 CCTCCGCGCAGGCGCAGGAGCGC 0: 1
1: 0
2: 5
3: 25
4: 128
Right 927945848 2:27134707-27134729 GGCCGCGGGGCCGCGTTTCCCGG No data
927945840_927945843 0 Left 927945840 2:27134663-27134685 CCTCCGCGCAGGCGCAGGAGCGC 0: 1
1: 0
2: 5
3: 25
4: 128
Right 927945843 2:27134686-27134708 CGACACGCGTCAGCACTAGCCGG No data
927945840_927945845 7 Left 927945840 2:27134663-27134685 CCTCCGCGCAGGCGCAGGAGCGC 0: 1
1: 0
2: 5
3: 25
4: 128
Right 927945845 2:27134693-27134715 CGTCAGCACTAGCCGGCCGCGGG No data
927945840_927945849 22 Left 927945840 2:27134663-27134685 CCTCCGCGCAGGCGCAGGAGCGC 0: 1
1: 0
2: 5
3: 25
4: 128
Right 927945849 2:27134708-27134730 GCCGCGGGGCCGCGTTTCCCGGG No data
927945840_927945844 6 Left 927945840 2:27134663-27134685 CCTCCGCGCAGGCGCAGGAGCGC 0: 1
1: 0
2: 5
3: 25
4: 128
Right 927945844 2:27134692-27134714 GCGTCAGCACTAGCCGGCCGCGG No data
927945840_927945846 8 Left 927945840 2:27134663-27134685 CCTCCGCGCAGGCGCAGGAGCGC 0: 1
1: 0
2: 5
3: 25
4: 128
Right 927945846 2:27134694-27134716 GTCAGCACTAGCCGGCCGCGGGG No data
927945840_927945853 27 Left 927945840 2:27134663-27134685 CCTCCGCGCAGGCGCAGGAGCGC 0: 1
1: 0
2: 5
3: 25
4: 128
Right 927945853 2:27134713-27134735 GGGGCCGCGTTTCCCGGGGCGGG No data
927945840_927945851 23 Left 927945840 2:27134663-27134685 CCTCCGCGCAGGCGCAGGAGCGC 0: 1
1: 0
2: 5
3: 25
4: 128
Right 927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG No data
927945840_927945852 26 Left 927945840 2:27134663-27134685 CCTCCGCGCAGGCGCAGGAGCGC 0: 1
1: 0
2: 5
3: 25
4: 128
Right 927945852 2:27134712-27134734 CGGGGCCGCGTTTCCCGGGGCGG No data
927945840_927945854 28 Left 927945840 2:27134663-27134685 CCTCCGCGCAGGCGCAGGAGCGC 0: 1
1: 0
2: 5
3: 25
4: 128
Right 927945854 2:27134714-27134736 GGGCCGCGTTTCCCGGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927945840 Original CRISPR GCGCTCCTGCGCCTGCGCGG AGG (reversed) Exonic