ID: 927945851

View in Genome Browser
Species Human (GRCh38)
Location 2:27134709-27134731
Sequence CCGCGGGGCCGCGTTTCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927945841_927945851 20 Left 927945841 2:27134666-27134688 CCGCGCAGGCGCAGGAGCGCCGA 0: 1
1: 0
2: 0
3: 6
4: 73
Right 927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG 0: 1
1: 0
2: 2
3: 7
4: 90
927945840_927945851 23 Left 927945840 2:27134663-27134685 CCTCCGCGCAGGCGCAGGAGCGC 0: 1
1: 0
2: 5
3: 25
4: 128
Right 927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG 0: 1
1: 0
2: 2
3: 7
4: 90
927945839_927945851 24 Left 927945839 2:27134662-27134684 CCCTCCGCGCAGGCGCAGGAGCG 0: 1
1: 0
2: 1
3: 5
4: 90
Right 927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG 0: 1
1: 0
2: 2
3: 7
4: 90
927945842_927945851 1 Left 927945842 2:27134685-27134707 CCGACACGCGTCAGCACTAGCCG 0: 1
1: 0
2: 0
3: 2
4: 11
Right 927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG 0: 1
1: 0
2: 2
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927945851 Original CRISPR CCGCGGGGCCGCGTTTCCCG GGG Intergenic
900134793 1:1111754-1111776 CCTCGGGGCTGTGTTTACCGAGG - Intronic
900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG + Intronic
900427167 1:2586164-2586186 CCGCGGGCCGGGGTCTCCCGCGG - Intergenic
900677930 1:3900218-3900240 CCGCCGGGACGCGTTGGCCGGGG - Exonic
901696699 1:11012950-11012972 CCGCGGTGCCGCGTAGCCTGAGG + Intronic
905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG + Exonic
906678491 1:47709647-47709669 CCGCGGGGCCGCCCCTCCCCCGG + Intergenic
910773417 1:90851688-90851710 GGGCGGGGCAGCGTCTCCCGCGG - Intergenic
914702884 1:150150170-150150192 CCGCGGGGGCTCCTTCCCCGCGG - Exonic
916819825 1:168387296-168387318 CCACGCGGCCGCGCCTCCCGCGG - Intergenic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
924527077 1:244863060-244863082 CCGCGGGCCCGCGCTCCCCGCGG + Intronic
1063407937 10:5813892-5813914 CCGCGGGGCTGGGCTTGCCGGGG + Intronic
1076722076 10:132397133-132397155 CCGCGGGGCGGCGTCACGCGCGG + Intergenic
1076722641 10:132399386-132399408 GAGCGGGGCCGCCATTCCCGTGG - Intronic
1079591978 11:22192829-22192851 CCGGGGGGCGGCGGGTCCCGAGG + Intergenic
1084361426 11:68670538-68670560 CCCAGAGGCCGCGTCTCCCGTGG - Intergenic
1095261715 12:40105829-40105851 CCGCGGAGCCGCGTCCCCCCGGG - Exonic
1105492530 13:20902624-20902646 CCGGGGGCCCGCGAATCCCGGGG + Intronic
1110195249 13:72781565-72781587 CCGTGGGGCCGCGCTGTCCGCGG + Intronic
1111397053 13:87677587-87677609 CCGCGGGCCCGCGCTGCCCAAGG + Exonic
1112507507 13:99983811-99983833 CCGCGGGGCCGCGCTGCCTGGGG - Intronic
1113201072 13:107867609-107867631 CGGCGGGGCCGCGGGGCCCGGGG + Intergenic
1115545455 14:34462026-34462048 CCGCGGGGCCGCATTTCCCCAGG - Intronic
1121645718 14:95516272-95516294 CCGCTGGGGCGCGCTGCCCGGGG + Intronic
1124121438 15:26892353-26892375 CCACGGGGCTGCATTTCCCCGGG - Intronic
1124249320 15:28096843-28096865 CCGCGGGGCCGCCAGTCCCGGGG - Intronic
1128161031 15:65422950-65422972 CCGCGGCGCCGCGCCTCCCCGGG - Exonic
1130935579 15:88467734-88467756 ACGCGGGGTCGCGGTTCCTGCGG + Exonic
1133271886 16:4614434-4614456 CCGCGGGGCCGCGAGTCCCCCGG - Intronic
1135988738 16:27204098-27204120 CCCCGGGGCTGCATTTCTCGCGG - Exonic
1139548357 16:67660245-67660267 CAACGGGCCCGGGTTTCCCGCGG + Exonic
1142474301 17:180519-180541 CCGCGGGGCCGCTTGTCCTTTGG - Intronic
1148782609 17:50130143-50130165 CCGGTGCGCCGCGTCTCCCGCGG - Intergenic
1152072526 17:78140979-78141001 CCGCGGGGCCTGGTGGCCCGGGG - Exonic
1156350480 18:36297801-36297823 CCGCGGGGGCGCGGGCCCCGGGG - Intronic
1156411090 18:36828930-36828952 CCGTGGGGCGCCGGTTCCCGCGG + Intronic
1157248207 18:46071904-46071926 CCGCGTGCCCGCGAGTCCCGGGG - Intronic
1160845417 19:1164053-1164075 CCGCGGGCCTGAGTTTCCAGAGG - Intronic
1161265265 19:3360783-3360805 CCGCGGAGCCGCGTGTCCCTGGG + Intronic
1165782052 19:38440714-38440736 CCGAGGGGCAGCGTCTCCAGGGG - Intronic
927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG + Intergenic
929857742 2:45650806-45650828 CCGCCGGGCCGCGTATCTCTCGG - Intergenic
930485535 2:52007033-52007055 CCGCGGGGCAGGCCTTCCCGCGG + Intergenic
937369075 2:121285267-121285289 CCTCCGGGCCGCGCTTCCTGGGG - Intergenic
946843087 2:223837229-223837251 CCGCGGCGCCGCGTTGCCGCAGG + Intronic
948835218 2:240623101-240623123 CCGCGGGGCTGCGAGTGCCGGGG - Intronic
1173821149 20:46021630-46021652 GCGCGGCGCCGCGTCTCGCGGGG + Intergenic
1173891385 20:46513615-46513637 CCCCCGGGCCGCCTTTCCCGGGG + Intergenic
1176156784 20:63626349-63626371 CCGCAGGGACGCGATTCCCAGGG - Intronic
1176381695 21:6117047-6117069 TCCCGAGGCCGCGTTCCCCGAGG + Intronic
1179457361 21:41508406-41508428 CCGCGGCGCAGCGCTGCCCGAGG + Intronic
1179741777 21:43421192-43421214 TCCCGAGGCCGCGTTCCCCGAGG - Intronic
1183942087 22:41301748-41301770 CCGCCGGGCTGCGCTCCCCGCGG - Exonic
1184178811 22:42805657-42805679 CAGAGGGGCCTCGTTTCCCTTGG - Intronic
1184333066 22:43838146-43838168 CCGCTGGGCCACCTTTCCCTTGG - Intronic
1185302656 22:50090527-50090549 CTGCGGGGCCGCGTTTTTCGGGG - Intronic
1185409625 22:50674864-50674886 CCCAGGGGCCGGGCTTCCCGGGG - Intergenic
950420961 3:12899281-12899303 CCGCGGGGCCGCGTTCCCAGTGG - Exonic
955971935 3:64445206-64445228 CCGCGGGGCCGGCTTACCTGGGG + Intronic
968668161 4:1832973-1832995 CCGGGTGGGCGCGTGTCCCGGGG - Intronic
969714408 4:8861345-8861367 CCCGGAGGCCGCGCTTCCCGCGG + Intronic
971207382 4:24583979-24584001 CCTCGTGGCCTCGGTTCCCGAGG - Intronic
984972559 4:185203971-185203993 CCGCGCGCCCGCGCTTCCGGAGG + Exonic
985414483 4:189722351-189722373 TGGCGGGGGAGCGTTTCCCGTGG - Intergenic
985414499 4:189722412-189722434 TGGCGGGGAAGCGTTTCCCGTGG - Intergenic
985548942 5:523767-523789 CCCCGGGGCCGGGTTTCCTTCGG - Intronic
985765904 5:1779498-1779520 CCGCAGGGCCGAGGTTCCGGAGG + Intergenic
986330770 5:6714481-6714503 GCGCGGGGCCGCGCGGCCCGGGG - Intergenic
992866296 5:80960448-80960470 TCGCGGGGCCGCGCTCCACGCGG + Intergenic
997453837 5:134003982-134004004 CCGTGGGGCCTCCTTTTCCGAGG + Intronic
999188914 5:149731917-149731939 CCGCGGGGCCGCGTGGTCGGTGG + Intronic
1001773440 5:174312102-174312124 CCGCTGGGCCGCCTTTGTCGCGG - Intergenic
1002158932 5:177303684-177303706 CCGCAGCGCCGCGACTCCCGCGG + Exonic
1002433654 5:179218738-179218760 CCGCGGGGCAGCCCATCCCGTGG - Intronic
1003623845 6:7726044-7726066 CCGCGGGGCGGGGAGTCCCGGGG + Intergenic
1004216784 6:13711257-13711279 CGGCGGGGCCGCGGTGGCCGGGG + Exonic
1007633602 6:43285561-43285583 GCGCGGGGCCGCGTCCCCCACGG - Exonic
1015904959 6:138107458-138107480 CCGCGGGGAGGCGGCTCCCGAGG + Exonic
1018905829 6:168075395-168075417 CCGCTGGGCCTCGTTTGCTGAGG - Intronic
1019386565 7:760055-760077 CCGCGCGGCCCCGTCTCCCTCGG - Intronic
1020140301 7:5608033-5608055 CCACGTGGCCGAGATTCCCGAGG + Intergenic
1027152053 7:75739566-75739588 CCGCGGGGCTGCGCTTTCCCGGG - Intergenic
1032011691 7:128351612-128351634 CAGCGGAGCCGCGTGGCCCGGGG + Exonic
1033477219 7:141702274-141702296 CCGCGGAGGCGCCTTTCCCACGG + Intergenic
1038404570 8:27311625-27311647 CCGCGGGCCTGAGGTTCCCGGGG - Exonic
1039064858 8:33599318-33599340 CCGTGGGGCTGTTTTTCCCGGGG + Intronic
1057211290 9:93202454-93202476 CCGAGGGGCCACCTGTCCCGTGG + Intronic
1060296538 9:122347169-122347191 GCACGGGGCCGCGCTTCCCCCGG - Intergenic
1060514696 9:124258280-124258302 CGGCGTGTCCGCGTGTCCCGGGG + Intronic
1190024569 X:46912216-46912238 CCGCGGCGCCGCGTTCCAGGTGG - Intergenic
1198341087 X:135713871-135713893 CCGCGGGGGAGCGTTTTCCTTGG + Intronic
1198346841 X:135767751-135767773 CCGCGGGGGAGCGTTTTCCTTGG - Intronic
1198348748 X:135785035-135785057 CCGCGGGGGAGCGTTTTCCTTGG - Intergenic
1198350653 X:135802309-135802331 CCGCGGGGGAGCGTTTTCCTTGG - Intronic
1198352560 X:135819572-135819594 CCGCGGGGGAGCGTTTTCCTTGG - Intronic
1198354469 X:135836840-135836862 CCGCGGGGGAGCGTTTTCCTTGG - Intronic
1198356379 X:135854098-135854120 CCGCGGGGGAGCGTTTTCCTTGG - Intronic
1198358292 X:135871372-135871394 CCGCGGGGGAGCGTTTTCCTTGG - Intergenic
1198360206 X:135888646-135888668 CCGCGGGGGAGCGTTTTCCTTGG - Intronic