ID: 927945851

View in Genome Browser
Species Human (GRCh38)
Location 2:27134709-27134731
Sequence CCGCGGGGCCGCGTTTCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927945841_927945851 20 Left 927945841 2:27134666-27134688 CCGCGCAGGCGCAGGAGCGCCGA 0: 1
1: 0
2: 0
3: 6
4: 73
Right 927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG No data
927945840_927945851 23 Left 927945840 2:27134663-27134685 CCTCCGCGCAGGCGCAGGAGCGC 0: 1
1: 0
2: 5
3: 25
4: 128
Right 927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG No data
927945839_927945851 24 Left 927945839 2:27134662-27134684 CCCTCCGCGCAGGCGCAGGAGCG 0: 1
1: 0
2: 1
3: 5
4: 90
Right 927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG No data
927945842_927945851 1 Left 927945842 2:27134685-27134707 CCGACACGCGTCAGCACTAGCCG No data
Right 927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927945851 Original CRISPR CCGCGGGGCCGCGTTTCCCG GGG Intergenic