ID: 927946015

View in Genome Browser
Species Human (GRCh38)
Location 2:27135690-27135712
Sequence GCCTATCGCCCACTTTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927946012_927946015 9 Left 927946012 2:27135658-27135680 CCTCGTATGAGGACACGTCTGTC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 927946015 2:27135690-27135712 GCCTATCGCCCACTTTTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 110
927946011_927946015 18 Left 927946011 2:27135649-27135671 CCATTGCTTCCTCGTATGAGGAC 0: 1
1: 0
2: 0
3: 10
4: 100
Right 927946015 2:27135690-27135712 GCCTATCGCCCACTTTTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927946015 Original CRISPR GCCTATCGCCCACTTTTGGC AGG Intergenic
907074784 1:51568309-51568331 TACTATCCCCCACTTTTAGCTGG + Intergenic
907882400 1:58563417-58563439 TCATATCGCCCACTTTTTGATGG - Intergenic
908417314 1:63925834-63925856 GTCCATCGCCCACTTTTTGATGG + Intronic
916691864 1:167197703-167197725 GCCTAATGCCCACTTTTGGGCGG + Intergenic
921844961 1:219868750-219868772 GTCCTTCGCCCACTTTTGGATGG - Intronic
923740597 1:236651403-236651425 GCCTTTGGCCCACATTTGGCAGG + Intergenic
1067019461 10:42782312-42782334 CCCTAAAGCCCTCTTTTGGCAGG - Intergenic
1067951137 10:50739467-50739489 CCCTAAAGCCCTCTTTTGGCAGG - Intronic
1070886466 10:79904531-79904553 CCCTAAAGCCCTCTTTTGGCCGG - Intergenic
1073448242 10:103593529-103593551 GCCTCTTCCCCACTTTTGGGAGG - Intergenic
1073853354 10:107646678-107646700 GACTATCTCCTACTTTTGGATGG - Intergenic
1076328288 10:129645419-129645441 GCCAAAAGCCCACGTTTGGCAGG + Intronic
1077722154 11:4639889-4639911 GCCTACCATACACTTTTGGCTGG + Exonic
1077789027 11:5417594-5417616 GTCCTTCGCCCACTTTTGGATGG - Intronic
1081042852 11:38233573-38233595 GTCCTTCGCCCACTTTTGGATGG - Intergenic
1083138658 11:60703604-60703626 TCCTATCCCCCACATTTGGGTGG - Intronic
1083542064 11:63518612-63518634 GCCTTTTGTCCACTTTTGGATGG - Intergenic
1085190196 11:74613877-74613899 ACTTATCTCCCACTTTTGGATGG + Intronic
1088951572 11:114576517-114576539 GTCTATAGCCCACTTTTTGATGG - Intronic
1095069563 12:37824194-37824216 GTCTTTCGCCCACTTTTTGATGG + Intergenic
1096340127 12:50790952-50790974 GCCTATAGTCAAGTTTTGGCTGG + Intronic
1098845560 12:75530934-75530956 GCCTTTTGCCCACTTTTGAATGG + Intergenic
1104217535 12:126748803-126748825 GCCTGTCACCCACTGATGGCAGG + Intergenic
1108525375 13:51281383-51281405 GCCTACCACCCACTCTTAGCTGG + Exonic
1110766061 13:79280387-79280409 GCTTTTCCTCCACTTTTGGCAGG - Intergenic
1117062570 14:51978233-51978255 GCCTATGGGCCAAATTTGGCTGG + Intronic
1124632751 15:31346793-31346815 GCCAATAGCCCACCTATGGCCGG - Intronic
1124701055 15:31912445-31912467 GTCCTTCGCCCACTTTTGGATGG + Intergenic
1134376257 16:13677410-13677432 GTCTTTTGCCCACTTTTTGCTGG + Intergenic
1135504497 16:23024677-23024699 GGCTCTCGCCCACTTTTGTAAGG + Intergenic
1138951743 16:61920424-61920446 GCCCTTCGCCCACTTTTTGATGG - Intronic
1144957606 17:19027072-19027094 CACTATCGCCCACATTTGGCAGG - Intronic
1144977550 17:19147444-19147466 CACTATCGCCCACATTTGGCAGG + Intronic
1145285014 17:21498914-21498936 GCCTCTGGACCAGTTTTGGCTGG + Intergenic
1145392510 17:22466833-22466855 GCCTCTGGACCAGTTTTGGCTGG - Intergenic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1157914500 18:51651643-51651665 GCCAGACGCCCACTTTGGGCTGG - Intergenic
1164361659 19:27519257-27519279 ACCTTTCGCCCACTTTTTGGCGG - Intergenic
1164561577 19:29295931-29295953 GCCAATAGTCCACTATTGGCTGG + Intergenic
1166167135 19:40999245-40999267 GTCTTTCGCCCACTTTTTGATGG + Intronic
1167393810 19:49214011-49214033 GTCTAGCGCCCTCTTTAGGCCGG - Intergenic
925037553 2:702392-702414 GCCAATAGCCCACTTTTAGATGG - Intergenic
925383626 2:3446506-3446528 GCCTGTCCGCCACCTTTGGCAGG + Intronic
927946015 2:27135690-27135712 GCCTATCGCCCACTTTTGGCAGG + Intergenic
928758769 2:34557227-34557249 GTCCTTCGCCCACTTTTGGATGG + Intergenic
934602424 2:95667821-95667843 GCCTGTCCCCCACATTTGGCTGG - Intergenic
936535793 2:113309975-113309997 GCCTGTCCCCCACATTTGGCTGG - Intergenic
936654788 2:114472440-114472462 GCCTATCACCAGGTTTTGGCTGG + Intronic
937186281 2:120046477-120046499 ACCTTTCGCCCACTTTTTGATGG + Intronic
939865135 2:147464236-147464258 GACTAGCACCCACTCTTGGCAGG + Intergenic
941281410 2:163556262-163556284 GCCTATTGCACACTTTTTACAGG + Intergenic
942534775 2:176951405-176951427 GTCTTTCGCCCACTTTTTGATGG - Intergenic
943379858 2:187131395-187131417 CCGTATCGCCCACTTTTTGATGG + Intergenic
1173128340 20:40362029-40362051 GCCTCTCGCCCACATTGGGGAGG - Intergenic
1178887246 21:36493946-36493968 GCCAAGAGCCCACTTTTGCCAGG + Intronic
1178943377 21:36926026-36926048 GCCTGTCACCCACTGGTGGCGGG + Intronic
1180990663 22:19933837-19933859 GCCTTTCACCCACTTTAGCCAGG + Intronic
1181094924 22:20498194-20498216 GCTCATCCCCCACTTTTGCCAGG + Intronic
1183478601 22:38050644-38050666 GCCCACCTCCCACCTTTGGCTGG + Intergenic
954034063 3:47841049-47841071 GCCTATCCCGCTCTTTAGGCCGG + Exonic
954183383 3:48898876-48898898 ACCTTTCACCCACTTTTGGGTGG + Exonic
957485829 3:80861547-80861569 GCCCTTCGCCCACTTTTTGATGG - Intergenic
958214478 3:90544706-90544728 GTCCTTCGCCCACTTTTTGCTGG - Intergenic
959375870 3:105588161-105588183 GTCTTTCGCCCACTTTTTGATGG + Intergenic
961190321 3:124955179-124955201 GCCTTTTGCCCACTTTTTGATGG + Intergenic
961447328 3:126987014-126987036 GCCTCTCACCCACTCCTGGCTGG - Intergenic
961966711 3:130912423-130912445 GTCTTTCGCCCACTTTTTGATGG - Intronic
962594132 3:136922423-136922445 GCCTATCACCAGGTTTTGGCTGG + Intronic
963744703 3:149114689-149114711 GCTGACCGCCCAATTTTGGCTGG - Intergenic
965975010 3:174610486-174610508 GTCTTTCGCCCACTTTTTGATGG - Intronic
966154809 3:176904019-176904041 GCCTATCACCCACTTTTAGAAGG + Intergenic
967833699 3:193943344-193943366 GCCTGTGGGCCACTTTGGGCCGG + Intergenic
971115603 4:23642566-23642588 GTCTTTCGCCCACTTTTTGATGG + Intergenic
976038645 4:80856227-80856249 GTCTTTCGCCCACTTTTTGATGG + Intronic
976649560 4:87420436-87420458 GCCTATCATCAAGTTTTGGCTGG + Intergenic
976791671 4:88885834-88885856 GCCTTTAGCCCACTTTTTGATGG - Intronic
981192266 4:141878167-141878189 GTCCTTCGCCCACTTTTTGCTGG + Intergenic
983879543 4:172917569-172917591 GTCTTTCGCCCACTTTTTGATGG - Intronic
988660535 5:33262559-33262581 GCCCTTCGCCCACTTTTTGATGG - Intergenic
989964686 5:50453808-50453830 GCCCTTCGCCCACTTTTTGATGG + Intergenic
992054195 5:72971521-72971543 GTCCTTCGCCCACTTTTGGATGG + Intronic
992756110 5:79907611-79907633 GTCTTTCGCCCACTTTTTGATGG - Intergenic
992849660 5:80794230-80794252 GCCTGTCACCAAATTTTGGCTGG + Intronic
995316259 5:110777885-110777907 GTCCATCGCCCACTTTTTGATGG - Intergenic
1002180225 5:177427279-177427301 ACCTATCGCCAACTTTGCGCGGG - Intronic
1003478360 6:6506204-6506226 GCCTGTAACACACTTTTGGCAGG - Intergenic
1003936983 6:10985185-10985207 GTCTTTCGCCCACTTTTTGATGG + Intronic
1009799571 6:68518317-68518339 GTCCATCGCCCACTTTTTGATGG + Intergenic
1010624053 6:78114120-78114142 GTCTTTTGCCCACTTTTTGCTGG - Intergenic
1010657272 6:78526185-78526207 GTCTAGTGCCCAATTTTGGCAGG - Intergenic
1010873763 6:81075149-81075171 GCCTGTTCCCTACTTTTGGCAGG - Intergenic
1013681866 6:112533115-112533137 GTCTTTCGCCCACTTTTTGATGG + Intergenic
1017342915 6:153347162-153347184 GTCTTTCGCCCACTTTTTGATGG - Intergenic
1017347131 6:153397145-153397167 GTCTTTCGCCCACTTTTTGACGG + Intergenic
1020658377 7:10953957-10953979 GCCTATTGCCCACTTTTTAATGG + Intergenic
1021525614 7:21583750-21583772 GTCTTTCGCCCACTTTTTGATGG - Intronic
1027979797 7:85202662-85202684 GTCTTTCGCCCACTTTTTGATGG - Intergenic
1040702964 8:50089577-50089599 GTCTTTCGCCCACTTTTTGATGG - Intronic
1042601005 8:70499535-70499557 GCATTTAGCCCATTTTTGGCAGG - Intergenic
1051597501 9:18839855-18839877 GTCCTTCGCCCACTTTTGGATGG + Intronic
1051853968 9:21541107-21541129 GTCCTTCGCCCACTTTTGGATGG - Intergenic
1052302102 9:26963779-26963801 GTCTTTCGCCCACTTTTTGATGG + Intronic
1052429981 9:28353323-28353345 GTCCTTCGCCCACTTTTGGATGG - Intronic
1056201802 9:84284184-84284206 GCCTATTGTTTACTTTTGGCAGG + Intronic
1188267466 X:28095188-28095210 GTCCTTCGCCCACTTTTGGATGG + Intergenic
1188291154 X:28390561-28390583 GTCCTTCGCCCACTTTTGGATGG - Intergenic
1188583944 X:31749964-31749986 GTCCTTCGCCCACTTTTGGATGG + Intronic
1188639837 X:32487171-32487193 GCCCTTCGCCCACTTTTTGATGG - Intronic
1188826886 X:34846136-34846158 CCCTATTGCTTACTTTTGGCAGG + Intergenic
1191748555 X:64516236-64516258 GCCCCTCGCCCACTTTTCGATGG + Intergenic
1191807742 X:65153400-65153422 GTCTTTCGCCCACTTTTTGATGG - Intergenic
1193014831 X:76720851-76720873 GTCCTTCGCCCACTTTTGGATGG + Intergenic
1195444933 X:104941520-104941542 GCCCTTCGCCCACTTTTTGATGG + Intronic
1198878164 X:141249644-141249666 GCCTGTCGCACACTTTTTGATGG + Intergenic
1198879818 X:141267515-141267537 GTCTTTCGCCCACTTTTTGATGG + Intergenic
1199906400 X:152236815-152236837 GTCTTTCGCCCACTTTTTGATGG + Intronic
1201069560 Y:10132873-10132895 GTCCTTCGCCCACTTTTGGATGG + Intergenic
1201079320 Y:10220920-10220942 GTCCTTCGCCCACTTTTGGATGG - Intergenic