ID: 927946491

View in Genome Browser
Species Human (GRCh38)
Location 2:27137934-27137956
Sequence CTGGGAGGGAGAAAAGGAAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1703
Summary {0: 1, 1: 0, 2: 14, 3: 190, 4: 1498}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927946491 Original CRISPR CTGGGAGGGAGAAAAGGAAG GGG Exonic
900124129 1:1062091-1062113 GAGGGAGGGAGGGAAGGAAGGGG - Intergenic
900124154 1:1062150-1062172 GTGAGAGGGAGGGAAGGAAGAGG - Intergenic
900186766 1:1336516-1336538 CTGGGAGTGAGAACAGGATGGGG + Intronic
900346885 1:2214387-2214409 CTGGGAGGGAGCGAAGGCCGTGG + Intergenic
900391719 1:2436584-2436606 CTTGGAGGGAGGAAGGGAGGAGG - Intronic
900738682 1:4317029-4317051 CAGGGAGGAAGAAATGGAAACGG + Intergenic
900875685 1:5340935-5340957 CTGGAGGAGAAAAAAGGAAGTGG - Intergenic
900932864 1:5747744-5747766 AAGGGAGGGAGAAAGGGAGGAGG + Intergenic
901082728 1:6592749-6592771 CTTGGAGGGTGAAGAGGATGTGG - Exonic
901173314 1:7279929-7279951 TTGGAAGGGAGAGCAGGAAGAGG + Intronic
901686190 1:10944840-10944862 CAGGGATGGAGAAAGGGCAGGGG + Intergenic
901724484 1:11230072-11230094 CAGGGAGGGGGAATAGGGAGAGG - Intronic
902064804 1:13676080-13676102 CTGGGAGGCAGAAGTTGAAGTGG - Intergenic
902090930 1:13902538-13902560 CAGGAAGGGAGACAGGGAAGAGG + Intergenic
902098522 1:13966173-13966195 GTAGGAGGGAGGGAAGGAAGAGG - Intergenic
902377353 1:16036123-16036145 CTCGGGCTGAGAAAAGGAAGGGG + Intergenic
902414873 1:16232598-16232620 CAGTGAAGGAGAAGAGGAAGAGG + Exonic
902488532 1:16764018-16764040 GTGGCCGGGAGAAAAGGGAGAGG - Intronic
902785434 1:18730063-18730085 CGGGGAGGTGAAAAAGGAAGGGG + Intronic
902800609 1:18827299-18827321 GTGGGAGGGAGAGTGGGAAGAGG - Intergenic
903221543 1:21872378-21872400 CTGGCAGGGGAAAAAGGAGGGGG + Intronic
903228331 1:21906466-21906488 CTGTAAGGAAGAAGAGGAAGGGG + Intronic
903405364 1:23091147-23091169 AAGGGAGGGAGAAAAGAGAGAGG + Intronic
903799452 1:25955659-25955681 GAGGGAGGGAGGAAGGGAAGAGG + Intergenic
904035231 1:27555484-27555506 CTGGGAGAGAGCAAAGTAGGTGG - Intronic
904261638 1:29291050-29291072 GTGGGAGGGAGAAAAGGAGGTGG - Intronic
904292651 1:29497807-29497829 CTGGGAGGGAGAGAAGGAGGTGG + Intergenic
904463221 1:30692699-30692721 GTGGAAGGGAGAGGAGGAAGAGG + Intergenic
904619978 1:31769509-31769531 ATGGAAGGCTGAAAAGGAAGAGG - Intergenic
904868999 1:33604833-33604855 CAGGGAGGGGGAAGATGAAGAGG + Intronic
905015490 1:34775538-34775560 CAGAGAGGAAGAAAAGGAATAGG + Intronic
905124931 1:35709554-35709576 CAGGGAGGCAGAAAATGAACTGG - Intergenic
905182702 1:36176670-36176692 CAGGGAAGGAGGAACGGAAGAGG - Intronic
905323052 1:37131294-37131316 CATGGAGGGGGGAAAGGAAGTGG - Intergenic
905357874 1:37397285-37397307 CTGGGAGAGAAAAATGGAAGTGG - Intergenic
905481440 1:38264702-38264724 GCGGGAGGGAGAGAAGGGAGGGG + Intergenic
905677481 1:39837851-39837873 ATGGGAAGGGGAAAAGGAACAGG - Intergenic
905754807 1:40500067-40500089 ATGGGAAGGAGAAAAGTAAATGG - Intergenic
905843119 1:41202332-41202354 CTGGGAGGGAAAAAAAAAAAAGG - Intronic
905961113 1:42043292-42043314 TGGGGAGGGAGAAAAGGCAGAGG - Intergenic
906147107 1:43566671-43566693 CTGGATGGGAGAGAAGGAAGAGG + Intronic
906274834 1:44507885-44507907 CTCAAAGGGAGAAAAAGAAGGGG - Intronic
906662490 1:47592989-47593011 CTGGGAGAGAGAGGGGGAAGGGG + Intergenic
906733756 1:48104981-48105003 AAAGCAGGGAGAAAAGGAAGGGG + Intergenic
906858133 1:49330340-49330362 CTGGGAGGCAGAGATGGCAGTGG + Intronic
907217676 1:52879635-52879657 GTGGGAAGGTGAAAAGGAATGGG + Intronic
907340315 1:53730896-53730918 TTGGGAGGGAGAACAGGCTGGGG - Intronic
907368548 1:53982222-53982244 CAGGGAGGGAGAGAAGTAGGGGG - Intergenic
907381193 1:54091716-54091738 CTGGAAGGGAGAAAGTAAAGGGG - Intronic
907473341 1:54688975-54688997 CTGAGAGGCAGAAAAAGCAGAGG + Intronic
907623052 1:56001553-56001575 CAGGGACAGAGAAAAGGAAATGG + Intergenic
907694994 1:56716250-56716272 CTAGGGGGAAGAAATGGAAGAGG - Intergenic
907722445 1:56984404-56984426 TTGGAAGGGAGAAAAGGAGAGGG + Intergenic
907831254 1:58066233-58066255 CTGTGATACAGAAAAGGAAGTGG + Intronic
907943340 1:59109805-59109827 CTAGGAAGAAGAAAAGGAAGAGG + Intergenic
907986079 1:59532153-59532175 CTGGGAAGTAGAAAAAGAAGTGG + Intronic
908060904 1:60347800-60347822 GGGGGAGGGAGGAAAGGAAAGGG + Intergenic
908082753 1:60598465-60598487 AGGGGAGGGGGAAAAGGAAAGGG + Intergenic
908130618 1:61071657-61071679 GAGGGAAGGAGAAAAGGAAAAGG - Intronic
908246984 1:62235196-62235218 ATGTTAGGCAGAAAAGGAAGCGG - Intergenic
908459258 1:64333404-64333426 CAGACAGGGAGACAAGGAAGGGG - Intergenic
908646366 1:66282338-66282360 CTGGCAGGGAAAAGAGGCAGGGG + Intronic
908809501 1:67965337-67965359 CTGGCAGGGAGAAGGGGAAAAGG - Intergenic
909375802 1:74940653-74940675 CCAGGAGGGAGAGGAGGAAGGGG - Intergenic
909483081 1:76146505-76146527 GTGTGAGGGAGAAAAGAAGGAGG - Intronic
909611234 1:77553811-77553833 GGAGGAGGGAGGAAAGGAAGGGG - Intronic
909932639 1:81515196-81515218 CTGGGAGGAGGAAAGGCAAGAGG + Intronic
909987404 1:82178677-82178699 CAGGGAGGGAGGGAAGGAAGGGG - Intergenic
910051304 1:82977514-82977536 AAGGGAGGGAGAGAGGGAAGGGG - Intergenic
910160344 1:84265706-84265728 CTAGAAGGGATAAAAGGGAGGGG - Intergenic
910386496 1:86689049-86689071 CTGGGAGGGAGGTAAGGATGAGG + Intergenic
910448040 1:87318722-87318744 ATGCTAGGAAGAAAAGGAAGCGG - Intergenic
910505726 1:87948300-87948322 GTGGCAGAGAGGAAAGGAAGAGG + Intergenic
910594389 1:88963610-88963632 ATGGTAGTGACAAAAGGAAGAGG - Intronic
910763908 1:90761854-90761876 CAGGGAGGGTGACAAGAAAGGGG - Intergenic
910858064 1:91716129-91716151 CTGTGAGGTAGGACAGGAAGAGG + Intronic
910866738 1:91795351-91795373 CAGTGAGGAAGAAAAGAAAGAGG - Intronic
910939699 1:92520034-92520056 CTGGGGGAGAGAAAAGAAAGGGG + Intronic
911137703 1:94458980-94459002 CAGGAAGGGAGAAAAGGAGAGGG - Intronic
911139787 1:94486786-94486808 CTGGCAGTGAGAAGAGCAAGAGG + Intronic
911141262 1:94504950-94504972 GTGGGAGAGTGAAAGGGAAGAGG + Intronic
911231368 1:95364924-95364946 ATTGGAGGGACAAAGGGAAGAGG - Intergenic
911675779 1:100656634-100656656 CTGGAAGGGAGGAGAGGAATGGG + Intergenic
912219117 1:107651672-107651694 CTGGGAGGTAGAAATGAAGGTGG - Intronic
912257871 1:108079884-108079906 CTGGAAGGCAGGAAATGAAGCGG - Intergenic
913079300 1:115366844-115366866 CTTGGAAGGAAAAATGGAAGAGG + Intergenic
913259650 1:116986778-116986800 CTGGGAGGGAGAGATCAAAGGGG - Intronic
913680569 1:121185139-121185161 CCGGGAGGAAGAAAAGGAAGAGG - Intronic
913986161 1:143568136-143568158 CAGGGAACAAGAAAAGGAAGAGG - Intergenic
914032400 1:143972781-143972803 CCGGGAGGAAGAAAAGGAAGAGG - Intergenic
914157045 1:145095186-145095208 CCGGGAGGAAGAAAAGGAAGAGG + Intronic
914345412 1:146794550-146794572 CTGGGAGGGGGAAGGGGAGGAGG + Intergenic
914474204 1:148009898-148009920 TCGGGAGGGAGGAAAGAAAGGGG + Intergenic
914514569 1:148362886-148362908 ATGGGAGGGAAAAGAGGGAGAGG - Intergenic
914690469 1:150021360-150021382 CTGGGAGGGAACAAAGCCAGAGG + Intergenic
914706239 1:150172237-150172259 CAGGGAGAGAGAAAATAAAGAGG - Intergenic
914712397 1:150226640-150226662 GGGAGAGGGAGAAGAGGAAGTGG - Exonic
914881263 1:151548770-151548792 CTAAGAGGAAGTAAAGGAAGTGG - Intronic
915378749 1:155421958-155421980 CTGGGAGGATGAAAAAGATGTGG - Intronic
915493325 1:156263940-156263962 AAGGGAGGGAGAAAAGCAAGGGG + Intronic
915562127 1:156693456-156693478 CTGGGTGGGAGGAGAGGAAAGGG - Intergenic
916243606 1:162664030-162664052 ACAGGAGTGAGAAAAGGAAGGGG + Intronic
916450892 1:164919406-164919428 GTGGGATGAAGAAAAAGAAGAGG - Intergenic
916649058 1:166817860-166817882 CTGTGAGGGAGAAAAAAAAAGGG + Intergenic
916676783 1:167070671-167070693 CTTGGAAGGAGAAAAGGGACTGG + Intronic
916987969 1:170212043-170212065 ATGGGATGGAGAATGGGAAGAGG + Intergenic
917157355 1:172018961-172018983 GAGGGAGGGAGGGAAGGAAGGGG - Intronic
917474790 1:175359896-175359918 GAGGCAGGGAGAAATGGAAGAGG - Intronic
917547545 1:175986541-175986563 TAGGGAGGGAGAAAAAGAATTGG - Intronic
917910404 1:179638710-179638732 CTGGGAAGGGGAAAAAGAAGTGG + Intronic
918200956 1:182266500-182266522 CAGGGAATGAGAAAAGGAAATGG - Intergenic
918474057 1:184904592-184904614 TTGGGATGGGGAAAAGGAAATGG - Intronic
918494999 1:185125573-185125595 CTGGGAAGGGGAGAAGGGAGAGG + Intronic
918721877 1:187863332-187863354 CTGGGAGGCAGAAAAGAAAGTGG - Intergenic
919030766 1:192238882-192238904 GTGGAAGGGAGAATAAGAAGTGG - Intergenic
919098965 1:193070231-193070253 TGGGGAGGGAAAAAAGGAATGGG - Intronic
919613150 1:199772020-199772042 AGGGGAAGGGGAAAAGGAAGGGG + Intergenic
919679257 1:200418167-200418189 ATGGGAAGGATAAGAGGAAGAGG + Intergenic
919763760 1:201113889-201113911 CTGGGAGTGAGAATAAGAAAGGG + Intergenic
919861064 1:201739861-201739883 GTGGTGGGGAGAAAAGGGAGCGG + Intronic
919969885 1:202568612-202568634 CTGGGAAAGAGAAATGGAACGGG + Intronic
919984986 1:202667195-202667217 CTGGGAGGAAAAAAAGGAGGAGG + Intronic
920112831 1:203599134-203599156 CTGGGAGGGAGAAGTGGACAAGG - Intergenic
920124512 1:203682981-203683003 CTGGCAGCGAGAGGAGGAAGAGG - Exonic
920187781 1:204172370-204172392 AGGGGAGGGGGAAGAGGAAGAGG - Intergenic
920291208 1:204924293-204924315 CAGGGAGGGAGAGAAGGAACAGG + Intronic
920458273 1:206117190-206117212 CTGGGAGGGAAAGAAGGCTGGGG + Exonic
920467878 1:206203665-206203687 CCGGGAGGAAGAAAAGGAAGAGG - Intronic
920776073 1:208938466-208938488 ATTGAAGAGAGAAAAGGAAGAGG + Intergenic
920965131 1:210694978-210695000 CTGAGAATGAGAAAGGGAAGGGG + Intronic
920970881 1:210742970-210742992 CAGGAAGAGAGAAAAGAAAGAGG + Intronic
921213937 1:212921614-212921636 CTCGGAGAGAGAATAGGAAGAGG + Intergenic
921798471 1:219374983-219375005 CTGGGATGCAGCAAAGAAAGAGG - Intergenic
921876302 1:220200306-220200328 ATGGTAGAGAGTAAAGGAAGAGG - Intronic
922391312 1:225146345-225146367 ATGGCAAGGAGGAAAGGAAGTGG - Intronic
922541688 1:226425013-226425035 CTAGGAGGCAGAAAAGGCAGGGG + Intergenic
923099238 1:230799013-230799035 CAGGGAGGGAAAGAAGGAAAAGG - Intronic
923118179 1:230963700-230963722 CTGGGGCAGAGAAAGGGAAGGGG + Intronic
923129375 1:231061870-231061892 ATGGGAGGGAGGAGAGGAAAGGG + Intergenic
923227714 1:231954679-231954701 ATGGTAGGGAAGAAAGGAAGAGG + Intronic
923285045 1:232486117-232486139 CTGGATGGGAGGAGAGGAAGGGG - Intronic
923356832 1:233164871-233164893 CTGGGGAGGGGAGAAGGAAGGGG + Intronic
923461608 1:234214112-234214134 CTGGGAGGAAGACAGGGATGAGG + Intronic
923531905 1:234818498-234818520 GTGGCCGGGAGAAAAGGGAGAGG + Intergenic
923595992 1:235361265-235361287 CTGGGAGGCAGAGGAGGAGGAGG - Intergenic
923677622 1:236093721-236093743 CTGGGATGGAAAAAAGGGATTGG - Intergenic
923774423 1:236965892-236965914 CTGGGAAGGAAGAAAGGAAGGGG - Intergenic
924062010 1:240184949-240184971 ATAGGAGGGAGAAAGAGAAGGGG - Intronic
924062017 1:240184977-240184999 ATAGGAGGGAGAAAGAGAAGGGG - Intronic
924062024 1:240185005-240185027 ATAGGAGGGAGAAAGAGAAGGGG - Intronic
924062032 1:240185034-240185056 ATAGGAGGGAGAAAGAGAAGGGG - Intronic
924062039 1:240185062-240185084 ATAGGAGGGAGAAAGAGAAGGGG - Intronic
924062047 1:240185091-240185113 ATAGGAGGGAGAAAGAGAAGGGG - Intronic
924062055 1:240185120-240185142 ATAGGAGGGAGAAAGAGAAGGGG - Intronic
924062062 1:240185148-240185170 GTAGGAGGGAGAAAGAGAAGGGG - Intronic
924062069 1:240185177-240185199 ATAGGAGGGAGAAAGAGAAGGGG - Intronic
924102208 1:240616497-240616519 CTGGGAAAGAGTTAAGGAAGTGG - Intergenic
924286168 1:242489469-242489491 AAGGGAGAGAGAAGAGGAAGAGG + Intronic
1062791845 10:311670-311692 ATGGGATGGAGAAGAGGGAGGGG + Intronic
1062922903 10:1293226-1293248 CGGGGAGGGAGAGAGGGACGGGG + Intronic
1063044084 10:2373804-2373826 ATGGGAGGAAGAGAAGGAAAAGG - Intergenic
1063044090 10:2373838-2373860 ATGGGAGGAAGAGAAGGAAAAGG - Intergenic
1063079865 10:2756060-2756082 CTGAGAGGGAGAACTGGGAGAGG - Intergenic
1063156401 10:3383274-3383296 GAGGGAGGGAGAGAAGGAGGTGG + Intergenic
1063231456 10:4069446-4069468 CTGGGAGGGAGATAACTCAGAGG - Intergenic
1063298673 10:4831997-4832019 GAGGGAGGGAGAAGAGGAAATGG + Intronic
1063298979 10:4834761-4834783 CTGGGTCGTAGAAAAGGAAAAGG + Intronic
1063413997 10:5858338-5858360 CTGGAAGAGAGGAAAGGATGTGG + Intergenic
1063578586 10:7284312-7284334 GTGGGAGGGAGGAAAGGGAAGGG - Intronic
1063866949 10:10374927-10374949 CAGGAAGGGAGAACAGGTAGCGG + Intergenic
1063998452 10:11642804-11642826 ATGAGTGGGAGAAGAGGAAGTGG - Intergenic
1064273083 10:13882422-13882444 CTTGGAGGAGGAAGAGGAAGAGG + Intronic
1064526339 10:16260469-16260491 GGGGAAGGGAGGAAAGGAAGGGG + Intergenic
1064604000 10:17019377-17019399 CAGGGATGGGGAAAAGGAAGGGG - Intronic
1064641264 10:17417925-17417947 AGGGGAGGGAGTACAGGAAGGGG + Intronic
1064706110 10:18074160-18074182 CCCTGAGGGAGAAAAGGAGGAGG + Intergenic
1064932491 10:20642818-20642840 CTGGAAGGGAATAAAGGAAGCGG + Intergenic
1065111549 10:22444861-22444883 CTGGGAGGGAAAAAAAGAGGTGG + Intronic
1065354746 10:24828941-24828963 CAGGGAGGGATGAAAGGAGGTGG - Intergenic
1065383947 10:25115418-25115440 GAGGGAGGGAGGAAGGGAAGGGG - Intergenic
1065875057 10:29990433-29990455 CTGGGAAGGAGTAGAGGAGGTGG + Intergenic
1065875825 10:29996424-29996446 CTAGGAGGTGGGAAAGGAAGGGG - Intergenic
1066018068 10:31268700-31268722 CTTGGATGGGGAAGAGGAAGAGG + Intergenic
1066068288 10:31778470-31778492 AAGGCAGGGAGAAAAGGAAAGGG + Intergenic
1066136036 10:32446935-32446957 GAGGGAGGGAGGAAGGGAAGAGG - Intronic
1066403907 10:35101061-35101083 CTAGGAGTGAGAAAAGGGAGAGG + Intergenic
1067427735 10:46222225-46222247 CAGGGAGGTAGAGAAGGCAGAGG - Intergenic
1067515872 10:46942706-46942728 GTGGGATGGAGGAAAAGAAGTGG - Intronic
1067557801 10:47284839-47284861 AAGGGAGGGAGAGAGGGAAGAGG + Intergenic
1067583152 10:47458114-47458136 CAGGGAGGTAGAGAAGGCAGAGG - Intergenic
1067646378 10:48109104-48109126 GTGGGATGGAGGAAAAGAAGTGG + Intergenic
1068018925 10:51555964-51555986 CAGGAAGGGAGAAAAGAAAGGGG + Intronic
1068886742 10:62105418-62105440 CTGAGAGAGAGGAAAGGCAGTGG + Intergenic
1068889305 10:62132297-62132319 GAGGAAGGGAGAAAAGGCAGAGG - Intergenic
1069170875 10:65227128-65227150 CTGGGAAAGAAAAAAGGAGGGGG + Intergenic
1069291977 10:66791026-66791048 CTGGGAGGGTAAAAAGTAACAGG - Intronic
1069622028 10:69843262-69843284 CTAGGAGCGAGAAGAGGAGGAGG + Intronic
1069649607 10:70035867-70035889 GTGGGAGACAGAAAAGGGAGAGG + Intergenic
1069908741 10:71747278-71747300 TTGGCAGGCAGAAAAGGGAGTGG + Intronic
1069917411 10:71796027-71796049 CAGGGAGCGAGAGTAGGAAGAGG + Exonic
1070329063 10:75405118-75405140 GTGGGAGGAGGAGAAGGAAGGGG + Intergenic
1070602789 10:77877564-77877586 CAGGGAGGGAGGGAAGGCAGTGG + Intronic
1070729632 10:78817453-78817475 ATGGGAGGGAGAGAGGGAAGGGG + Intergenic
1070826157 10:79391654-79391676 CTGGGAGGGAGCAGGGGAGGAGG - Intronic
1071324649 10:84501102-84501124 GTGGGAGATAGAAAAGGAGGAGG - Intronic
1071414665 10:85429815-85429837 CAGGGAGGGCTTAAAGGAAGAGG + Intergenic
1071583329 10:86793926-86793948 CTGTGAAGGTGAACAGGAAGGGG - Intronic
1072010267 10:91297173-91297195 CTGGGAGGGGCAGTAGGAAGTGG + Intergenic
1072317076 10:94213537-94213559 GTGGGAAGCAGAAGAGGAAGAGG - Intronic
1072525732 10:96269872-96269894 CTGGGAGGGAGGAAATACAGAGG - Intronic
1072645456 10:97251088-97251110 AGGGGAAGGGGAAAAGGAAGGGG + Intronic
1072727208 10:97822018-97822040 TTGGGAGGGGGAAGGGGAAGGGG + Intergenic
1072914590 10:99530249-99530271 CTGGGTATGAGGAAAGGAAGCGG + Intergenic
1073112115 10:101068688-101068710 AAGGGAGGGTGAGAAGGAAGGGG + Intergenic
1073112424 10:101070552-101070574 AAGGGAGGGTGAGAAGGAAGGGG - Intergenic
1073798515 10:107014860-107014882 CTTAGAGGGAGAAAAGAATGTGG - Intronic
1073825945 10:107321577-107321599 CTGGGAGGAAGGGAAGAAAGAGG + Intergenic
1073996765 10:109324558-109324580 CTGGGAGGGCGGAAGGGATGGGG - Intergenic
1074154437 10:110786152-110786174 CTGGGCAGGAGAAAGGGGAGTGG + Intronic
1074163924 10:110858351-110858373 CTGGGAGGGAGCTAAAGATGTGG - Intergenic
1074423160 10:113327291-113327313 CTGTAAGGCAGAAGAGGAAGAGG - Intergenic
1074736456 10:116439468-116439490 CGGGGAGGAAGAATAGGAGGAGG - Intronic
1074875262 10:117608622-117608644 CTGGAAGAAAAAAAAGGAAGGGG - Intergenic
1075010720 10:118867552-118867574 CTGGGAAGGCGAAGGGGAAGGGG + Intergenic
1075065631 10:119287274-119287296 AAGGGAGGGAGAGAAGAAAGAGG + Intronic
1075122808 10:119676662-119676684 CTGGGAGGAGGACAAGGAACTGG - Exonic
1075264823 10:120991167-120991189 ATGTGAGGGAGAGAAAGAAGAGG - Intergenic
1075650869 10:124127883-124127905 CTGGGAGGGAGAAATGAACTGGG + Intergenic
1075741526 10:124699099-124699121 ATGGGAGAGAGAAAAGCAGGTGG - Intronic
1075780154 10:125012219-125012241 CCGGGAGGGAGGACAGGATGTGG + Intronic
1075847599 10:125557526-125557548 CTTGGAGGGAGAAAATCCAGGGG - Intergenic
1075929693 10:126285182-126285204 CTGGGTAGGAGAGAAGGAAAGGG + Intronic
1075941777 10:126396148-126396170 CTGGCAGGGAGAAGATGAAATGG - Intergenic
1076067896 10:127463705-127463727 CAGGAAGGGAGAAAAGGACATGG - Intergenic
1076076444 10:127537494-127537516 CTGAGAGGCACAGAAGGAAGAGG + Intergenic
1076191326 10:128485497-128485519 CTGGGAGGAGGAGAGGGAAGAGG + Intergenic
1076446460 10:130517709-130517731 CTGGGGTAGAGAAAAGGAACAGG - Intergenic
1076726997 10:132418690-132418712 CGGGGAGGGAGGAGGGGAAGGGG - Intergenic
1076738301 10:132468425-132468447 CGGGGAGGGAGAAGGGGAGGAGG + Intergenic
1076764375 10:132625093-132625115 GGGGGAGGGAGAGAGGGAAGGGG - Intronic
1077010467 11:377043-377065 CGGGGAGGGCGAAGAGGAGGAGG + Exonic
1077362821 11:2148209-2148231 CTTGGAAGGAGATAAGGAGGGGG + Intronic
1077597783 11:3548897-3548919 CTGGGGTGGAGGAAAGGTAGGGG + Intergenic
1077718788 11:4606933-4606955 GTGGGAGGAAGAAAAGCAGGAGG - Intronic
1077751623 11:4977255-4977277 CTATGAGGGAAAAAAGGAAATGG + Intronic
1077795635 11:5488901-5488923 CTGTGAGTGAGAGAAGGCAGAGG - Exonic
1077922720 11:6653981-6654003 CTGGGAGGGAGGAAGGTAACAGG + Intronic
1077955381 11:7013653-7013675 CAGTGAGAGAGAAAAGGAGGTGG - Intronic
1078002426 11:7508184-7508206 CTGAGAAGGAGGAAAAGAAGGGG + Intronic
1078254325 11:9644572-9644594 GTGGAAGGAAGAAAAGAAAGTGG - Intergenic
1078267297 11:9764980-9765002 TTGGGAGGGAGAAAAGTAGATGG - Intergenic
1078354611 11:10624614-10624636 CGAGAAGGGAGGAAAGGAAGGGG + Intronic
1078617253 11:12877748-12877770 GTGGGAGGGAGAAAAGGGGAAGG - Intronic
1078763495 11:14271595-14271617 ATGGGAGGTAGAAGATGAAGAGG - Intergenic
1078891944 11:15565555-15565577 CTGGGAAGGAGAAAGCAAAGGGG + Intergenic
1079054960 11:17197586-17197608 GTGGGAGGGGGACAAGGAAAGGG + Intronic
1079418571 11:20264185-20264207 CTGGGAAGTGGAAGAGGAAGAGG + Intergenic
1079566659 11:21891093-21891115 GAAGGAGGAAGAAAAGGAAGGGG - Intergenic
1079597739 11:22271859-22271881 CTACGAGGTAGAAAATGAAGAGG - Intronic
1079807185 11:24947352-24947374 CTGAGAGGCAGATATGGAAGAGG + Intronic
1079948863 11:26777089-26777111 ATTAGAGGGAGAATAGGAAGTGG + Intergenic
1080021314 11:27563172-27563194 ATGGGAAGAAGAAAAGGAAAAGG - Intergenic
1080142301 11:28936889-28936911 AAGGGAGGGAGAGAGGGAAGGGG + Intergenic
1080168437 11:29269246-29269268 GGGGAAGGGAGAAAAGGAAAAGG + Intergenic
1080573574 11:33578427-33578449 ATGGGATGGACAAAAGGAAATGG - Intronic
1080661066 11:34296317-34296339 AGGGGAGGGAGACAAGGAGGAGG + Intronic
1080839501 11:35971094-35971116 CTGGAAGGGAGATAATGAAAGGG + Intronic
1080886022 11:36369107-36369129 CTGGGATGGATAAAAGCACGTGG + Intronic
1081102642 11:39024382-39024404 CAGGGAGGGAGGAAGGGAGGAGG - Intergenic
1081102661 11:39024437-39024459 CAGGGAGGGAGGAAGGGAGGAGG - Intergenic
1081332181 11:41817217-41817239 CGGGGAGGCAGAAAAGGCAAAGG + Intergenic
1081483261 11:43508015-43508037 CTGGGAGGCAGAAAAGGTTTTGG + Intergenic
1081618129 11:44602629-44602651 CTAGAAGGGACCAAAGGAAGCGG - Intronic
1081785616 11:45744776-45744798 AAGGGAGGGAGTAAAGGCAGAGG + Intergenic
1082762675 11:57142680-57142702 CTGGGAGCAGGAAAAAGAAGGGG + Intergenic
1082781932 11:57294717-57294739 CTGGGAGGGAGAAGAGGCAGGGG - Intergenic
1082859681 11:57842844-57842866 CTGGGAGTGATCAAGGGAAGAGG + Intergenic
1083213000 11:61200745-61200767 TTGAGAGGGAGGAAAGAAAGAGG + Intergenic
1083236393 11:61353582-61353604 ATGGGAGGGATAAAAGGAACAGG + Intronic
1083475098 11:62910260-62910282 CTGGAAGGAAGAAGAGGAAGAGG - Exonic
1083492974 11:63026790-63026812 GGAGGAGGGAGGAAAGGAAGAGG + Intergenic
1083617946 11:64035729-64035751 CGGGGAGGGAGAGGAGGAGGAGG - Intronic
1083658664 11:64242094-64242116 CTGGGAGGGAGGGAAGGTATGGG + Exonic
1083741764 11:64714954-64714976 GAGGGAGGGAGAGAAGGAGGTGG + Intronic
1084253871 11:67924805-67924827 CTGGGGTGGAGGAAAGGTAGGGG + Intergenic
1084416447 11:69035576-69035598 GTGGGAGGGAAAGAGGGAAGGGG - Intergenic
1084872803 11:72109342-72109364 CTGGGTGGGATCAGAGGAAGTGG + Exonic
1085114812 11:73921491-73921513 TTGGGTGGGAGAAAAGAAAGTGG - Intronic
1085296241 11:75433300-75433322 CTGGGAGGGAGGGAAAGAAAGGG + Intergenic
1085305519 11:75483449-75483471 ATGGGAGGGAGAAAGGGTAGGGG - Intronic
1085331218 11:75652985-75653007 ATGGGTGGGAGAGAAGTAAGAGG - Intronic
1085388845 11:76172018-76172040 GTGGGAGGAGGAAGAGGAAGAGG + Intergenic
1085587890 11:77728551-77728573 AAGGGAAGGGGAAAAGGAAGAGG + Intronic
1085754718 11:79193007-79193029 CTGGGAGGCTGGAGAGGAAGGGG - Intronic
1085998208 11:81947967-81947989 CTGAGAGGGAGGGAGGGAAGCGG + Intergenic
1086064019 11:82728300-82728322 CTGGGAGTGAGAGAAGGGATAGG + Intergenic
1086139810 11:83484229-83484251 CTGTGAAGGAGAAAAGGCATGGG + Intronic
1086263517 11:84970307-84970329 AGGGTAGGGAGAAAAGGAAGAGG - Intronic
1086330530 11:85749494-85749516 CTGGGAGTGGGAAAAAGAGGGGG + Intronic
1086378861 11:86230335-86230357 CTGGGAGGAGGAAGAGCAAGTGG - Intergenic
1086408483 11:86520149-86520171 CTGGGAGGGTCAGAAGGAAAGGG - Intronic
1086582064 11:88410837-88410859 AAGGGAGGGAGAAAAGGAGAAGG - Intergenic
1086747125 11:90442653-90442675 CTGGGATAGAGAAAAAGAAGGGG - Intergenic
1086771023 11:90767698-90767720 AAGAGAGGGAGAATAGGAAGAGG + Intergenic
1086876171 11:92098031-92098053 CTGAGATGGAGAAAACCAAGAGG + Intergenic
1087082840 11:94188283-94188305 TTGGGTGGGAGAAAAGAAAGTGG - Intergenic
1087231900 11:95675611-95675633 TTGGGATGGAGGAAAGGAACTGG + Intergenic
1087359772 11:97143632-97143654 CTAAGGGGGAAAAAAGGAAGTGG - Intergenic
1088022120 11:105132378-105132400 TTGGGAGAGAGAAGAGGAAGGGG - Intergenic
1088108348 11:106230282-106230304 GAGAGAGGGAGAAGAGGAAGGGG - Intergenic
1088840978 11:113627383-113627405 CAGGGAGGGAGGGAAGGAAAAGG + Intergenic
1088840993 11:113627429-113627451 CAGGGAGGGAGGGAAGGAAAAGG + Intergenic
1088940588 11:114451353-114451375 CTGAGAAGGAGAAAGGGGAGGGG - Intergenic
1089054873 11:115577422-115577444 CTGGGAGTGAGAAACCCAAGAGG - Intergenic
1089321094 11:117627282-117627304 CTAGGAGGGAGAAGAAGAGGCGG - Intronic
1089335901 11:117723820-117723842 CTGGGAGGGAGGGAATGATGGGG + Intronic
1089365608 11:117919139-117919161 CTAGGAGGGGTTAAAGGAAGAGG + Intronic
1089500691 11:118929672-118929694 CTGTGAGGGAGGGAAGGAGGAGG + Intronic
1089581841 11:119486319-119486341 CAGGAAGGGAGGAAAGGAGGAGG - Intergenic
1089605207 11:119637783-119637805 CTGGGAGTGAGGCCAGGAAGAGG + Intronic
1089635727 11:119810457-119810479 CTGATGGGAAGAAAAGGAAGGGG + Intergenic
1089644895 11:119872435-119872457 CAGAGATGGAGAAAAAGAAGGGG - Intergenic
1089785053 11:120901691-120901713 TTGGGAGGGAGATGGGGAAGTGG + Intronic
1089785250 11:120903003-120903025 CTGTGAGGGAGAGCAGGATGTGG - Intronic
1089938876 11:122394623-122394645 CAGGGAGGGGCAAAAGGAAAGGG + Intergenic
1090126081 11:124086070-124086092 GTGGGAGTGTGAAAAGGTAGAGG + Intergenic
1090357065 11:126147221-126147243 GAGGGAGGGAGGAAAGGAAGGGG - Intergenic
1090609922 11:128461917-128461939 CTGGGAGGGCAAAAAAGAGGTGG - Exonic
1090916613 11:131169939-131169961 CTGGAAAGGAGAGAAGGAAGAGG + Intergenic
1091114900 11:133004045-133004067 CTGGGAAGGAGGAAGCGAAGAGG + Intronic
1091145542 11:133276337-133276359 GAGCAAGGGAGAAAAGGAAGAGG + Intronic
1091228922 11:133975201-133975223 CTGGCAGGGAGAAAGGCAACTGG - Intergenic
1091336603 11:134773558-134773580 GGAGGAGGAAGAAAAGGAAGAGG + Intergenic
1091393438 12:139395-139417 CTGGGAGGGAGGGAAGGAGGAGG + Intronic
1091482151 12:844263-844285 CTGGGAGGGACAATAGGCATGGG + Intronic
1091510883 12:1124927-1124949 TTGGGAGGGAAAAAGGGATGAGG - Intronic
1091618882 12:2070943-2070965 CAGGGAGGGAGGGAGGGAAGGGG - Intronic
1091618909 12:2071043-2071065 GAGGGAGGGAGGAAGGGAAGGGG - Intronic
1092137237 12:6158660-6158682 CTGGGGGGGAGAAAAGGGATCGG - Intergenic
1092157721 12:6295218-6295240 CTGGGAGCCAGAAAAGGAAGAGG + Intergenic
1092241304 12:6837934-6837956 TGGGGAGGGAAAAAAGCAAGAGG - Intronic
1092423941 12:8358194-8358216 CTGGGGTGGAGGAAAGGTAGGGG + Intergenic
1092471315 12:8784480-8784502 CTGTGAGGGATACAAGGGAGAGG + Intergenic
1093094535 12:14957821-14957843 ATGAGAGAGAGAGAAGGAAGAGG + Intronic
1093154047 12:15658958-15658980 CTGGTTGGGAGATAAGGAAATGG + Intronic
1093235369 12:16603957-16603979 TTGGGAGAGGGAAGAGGAAGAGG + Intronic
1093370393 12:18357775-18357797 CTTGGAGATAGAAAAGGAAGAGG - Intronic
1093479206 12:19587185-19587207 ATGGAAGGGAGAAAGAGAAGAGG + Intronic
1094142983 12:27199747-27199769 AGGGGAGGGAGAAATGGAGGAGG - Intergenic
1094496220 12:30990967-30990989 GTGGGAGGGAGGAGAGGAAGAGG + Intronic
1094527832 12:31244330-31244352 CTAGGAAGGAGAATGGGAAGGGG + Intergenic
1095113061 12:38319185-38319207 CTGGGAGGGAGAGGAGTATGTGG + Intronic
1095181592 12:39153369-39153391 CTGGGAGAAAGTAAGGGAAGAGG - Intergenic
1095635943 12:44433743-44433765 TTGAGAGGGAGGAAAGGATGGGG - Intergenic
1095752741 12:45729463-45729485 CGGGGAGGGAGGGAAGGAAGGGG + Intergenic
1095812212 12:46383356-46383378 GAGGGAGGGGGAAAAGGAGGTGG + Intergenic
1095852320 12:46824317-46824339 TTGGAAAGGAGAAAAGGAACAGG - Intronic
1095937020 12:47695457-47695479 CTGGGAGGGAGGCAAGGGACAGG + Intronic
1095970046 12:47895393-47895415 ATGGGAGGGAGAGAAGGAGGAGG + Intronic
1095972483 12:47912093-47912115 GAAGGAGGGAGCAAAGGAAGGGG + Intronic
1095982844 12:47982700-47982722 ATGGGAGGAAGGGAAGGAAGAGG - Intronic
1096208262 12:49741639-49741661 CTGGGAGTGAGAAATGGAAAGGG + Intronic
1096217980 12:49808978-49809000 GGGGGAGGGAGAGAAGGAGGGGG + Intronic
1096266784 12:50129892-50129914 CAGGGAGGGAGCATGGGAAGAGG - Exonic
1096366558 12:51033242-51033264 GGGGGAGGGAAAAAAGGAAACGG - Intergenic
1096409247 12:51365325-51365347 CCGGAAGAGAGAACAGGAAGGGG + Intronic
1096468655 12:51863255-51863277 CTGGAAGGGAGGGAGGGAAGGGG - Intergenic
1096542000 12:52313255-52313277 GTGGGAGGGAGAGAAGGCACTGG + Intergenic
1096673715 12:53215096-53215118 CTGAGAGGGAGAATGGGAAATGG + Intronic
1096748034 12:53741226-53741248 CTGGGAGGGTGATAAAGAGGTGG + Intergenic
1097602204 12:61706845-61706867 AGGGGAGGGAGCAAAGGGAGGGG + Intergenic
1097697330 12:62787210-62787232 CAGGGAAGGGGAAAGGGAAGGGG + Intronic
1098236945 12:68426713-68426735 TGGGGAGGGAGAAAAGGTGGGGG - Intergenic
1098616804 12:72536403-72536425 CAAGGAGAGAGGAAAGGAAGAGG + Intronic
1098908423 12:76185212-76185234 GAGAGAGAGAGAAAAGGAAGGGG - Intergenic
1099068894 12:78020128-78020150 CTGGGTAGTAGAAAAAGAAGTGG - Intronic
1099166812 12:79317210-79317232 CTGGGAAGGATGGAAGGAAGTGG - Intronic
1099173765 12:79397108-79397130 CTGGGAGAGTGAAAGGGATGAGG + Intronic
1100220387 12:92498551-92498573 GTGGGTGGGAGAAAATCAAGGGG + Intergenic
1100286280 12:93169606-93169628 GAGGGAGGGAAGAAAGGAAGGGG + Intergenic
1100286583 12:93172631-93172653 GTTGGAGGGACAGAAGGAAGTGG - Intergenic
1100533902 12:95487615-95487637 CTGGAAGGAAGGAAAAGAAGAGG - Intronic
1100549961 12:95638228-95638250 CTGGGAGGGTGGACAGGAATGGG + Intergenic
1100609884 12:96182853-96182875 CTGAATGGGAGAAAAGGAAGAGG - Intergenic
1100789953 12:98119577-98119599 CTAGAAGGAAGAAAATGAAGGGG + Intergenic
1101181393 12:102222412-102222434 TGGGGAGGGAGAAAAGGAGAGGG - Intergenic
1101439591 12:104693571-104693593 CTGGATGGGAGACAAGAAAGTGG + Intronic
1101746723 12:107547230-107547252 GGGGGAGGAAGAAGAGGAAGAGG + Intronic
1101800602 12:108018660-108018682 CAGGAAAGAAGAAAAGGAAGAGG - Intergenic
1101926818 12:108978664-108978686 CTGGGAAGGAGAAAGGGAGAGGG + Intronic
1102120279 12:110434989-110435011 TTGGGTGGGAGAAAAGAAAGTGG - Exonic
1102161032 12:110769088-110769110 CTGGGAAGGACCAAAGGATGTGG - Intergenic
1102167855 12:110820750-110820772 AGGGGAGGGGGAAAGGGAAGGGG - Intergenic
1102261661 12:111446919-111446941 CTGGCAGGGAGGAAGGGAACAGG - Intronic
1102261888 12:111447999-111448021 GAGGAAGGGAGAAAGGGAAGAGG - Exonic
1102437684 12:112938277-112938299 CTGGGAAGGGGACCAGGAAGTGG + Intergenic
1102507693 12:113394077-113394099 CAGGGAGGGAGAGAAGGAGATGG + Intronic
1102625635 12:114233264-114233286 TTGGAAGGGAGAAGGGGAAGGGG - Intergenic
1102723259 12:115035821-115035843 CCTGGAGGGAGGGAAGGAAGGGG - Intergenic
1102735036 12:115151644-115151666 CTGGGGGTGGGAAAAGAAAGGGG + Intergenic
1102759756 12:115375127-115375149 CTGGGAAGAAGAAGAGGCAGGGG + Intergenic
1103038622 12:117676463-117676485 CTAAGAAGGAGAAAAAGAAGGGG + Intronic
1103271824 12:119679910-119679932 CTGTGAGGGAACAAAGGCAGCGG - Intronic
1103318230 12:120074258-120074280 AAGGGAAGGAGAAAAGGAGGAGG - Intronic
1103453338 12:121045267-121045289 CAGGGAGGGAGAAGAGCCAGTGG + Intergenic
1103528080 12:121580572-121580594 CAGGGAGGGAGGGAAGGAGGAGG + Intronic
1103867571 12:124064885-124064907 TTGGGAGGGAGAAAAGGTAATGG - Intronic
1103988200 12:124780992-124781014 CTGGGAGAGAGGAAAGGAAGGGG + Intronic
1104110609 12:125700755-125700777 ATGGGAGGCAGAAGAGGAGGAGG + Intergenic
1104155638 12:126128724-126128746 CTGGGAAGGAGAAAAATTAGGGG - Intergenic
1104418581 12:128616129-128616151 CTGGAAGAGAGAAAAGAAACTGG - Intronic
1104569144 12:129909711-129909733 CTAGGATGGAGAAAATGAGGTGG + Intergenic
1104570056 12:129917370-129917392 TTTGGAGGAGGAAAAGGAAGGGG - Intergenic
1104743874 12:131198257-131198279 CTGGGAGGGTGAAAAGTCAAGGG + Intergenic
1104790466 12:131478482-131478504 CTGGGAGGGTGAAAAGTTAAGGG - Intergenic
1105627016 13:22122436-22122458 CTGCAAGGGAGAACTGGAAGGGG + Intergenic
1105915006 13:24906327-24906349 TTGGGAACGAGAAAAGGAAAAGG - Exonic
1106195509 13:27490976-27490998 CTGGGAAGGCGAAAACCAAGGGG - Intergenic
1106473835 13:30080500-30080522 CAGGGAGGAAAAAAAGAAAGTGG + Intergenic
1106693658 13:32146699-32146721 CTGGTAGGGACAGAAGCAAGAGG - Intronic
1106828954 13:33557200-33557222 GAAGGAGGGAGAGAAGGAAGAGG - Intergenic
1106861082 13:33909495-33909517 CAAGGAGTGAGAAAAGTAAGAGG - Intronic
1106899244 13:34337606-34337628 GTGGGAAGCAGAAAAGAAAGAGG + Intergenic
1106925781 13:34611601-34611623 AGGGGAAGGAGAGAAGGAAGAGG + Intergenic
1107014842 13:35699976-35699998 CTGGGAAGGAATAAAGGGAGAGG + Intergenic
1107096321 13:36540540-36540562 ATGTTAGGCAGAAAAGGAAGTGG + Intergenic
1107217601 13:37940057-37940079 CTGAGAGGGAGAAGAGGGATAGG + Intergenic
1107903825 13:45044115-45044137 TGTGGAGGGAGAAAAGCAAGTGG - Intergenic
1107931459 13:45311145-45311167 CAGGGAAGGAGAAAAAGAACAGG - Intergenic
1108034544 13:46274986-46275008 CTGGGAAGGGTAAGAGGAAGAGG - Intronic
1108048106 13:46402480-46402502 ATGGGAGGAAGAGAAGCAAGAGG + Intronic
1108291030 13:48961342-48961364 ATGAGAGGGAGAAGAGGAGGAGG + Intergenic
1108492380 13:50994244-50994266 GTGGGAAGGAGAAAGGGAGGAGG - Intergenic
1108952354 13:56111129-56111151 CTCAGAAGGAGAAAAGAAAGGGG - Intergenic
1109505506 13:63296975-63296997 TTGGAAGGGAATAAAGGAAGAGG - Intergenic
1110094753 13:71503120-71503142 GTGGGAAGGAAAAAATGAAGTGG - Intronic
1110145622 13:72186933-72186955 CTCTCAGGGAGAGAAGGAAGAGG - Intergenic
1110419147 13:75285619-75285641 TTGGAAGGGAAAAAAGAAAGTGG - Exonic
1110502637 13:76246700-76246722 AGGGGAAGAAGAAAAGGAAGAGG - Intergenic
1110521779 13:76488012-76488034 CCGGGATGGAGAAATGAAAGTGG - Intergenic
1111077736 13:83260624-83260646 CTGGGGAGGAGAAGGGGAAGGGG + Intergenic
1111330646 13:86759635-86759657 CTGTGAGGCAGTGAAGGAAGAGG + Intergenic
1111497857 13:89076584-89076606 CTGGGAAGGATAACAGAAAGGGG - Intergenic
1111519888 13:89386781-89386803 GGGGAAGGGAGAGAAGGAAGTGG - Intergenic
1111693149 13:91590762-91590784 CTTGGAGGGAGAAGAAAAAGAGG - Intronic
1111734888 13:92125559-92125581 ATGGGAGAGAGAAAGGGAGGGGG + Intronic
1112520381 13:100089357-100089379 CCGGGAGGGAGGAAAGCAAGCGG - Intronic
1112905494 13:104414933-104414955 ATGGGAGGAAGAAAGTGAAGTGG - Intergenic
1113027069 13:105952718-105952740 CTGTGAGGGAGAAAAAGATTGGG + Intergenic
1113201434 13:107870318-107870340 TTGGGAGGGGGTAAGGGAAGAGG + Intergenic
1113613285 13:111663292-111663314 ATGGGAAGGGGAACAGGAAGAGG - Intronic
1113697253 13:112355107-112355129 GTGGAAGTGAGAAAGGGAAGCGG + Intergenic
1113741376 13:112714456-112714478 TGAGGAGGGAGAAAGGGAAGGGG - Intronic
1113757680 13:112824995-112825017 GAGGGAGGGAGGAAAGGAGGGGG - Intronic
1113861771 13:113491315-113491337 CAGGGAGGGAGGGAAGGAAGGGG - Intronic
1113861784 13:113491343-113491365 CGGGGAGGGAGAGAGGGGAGGGG - Intronic
1113905306 13:113816738-113816760 CTAGGAAACAGAAAAGGAAGTGG - Exonic
1114033968 14:18603695-18603717 CTGGAAAGGAGTAAAGAAAGAGG - Intergenic
1114046782 14:18882305-18882327 CTGGGAGGGAGTAAAGGAGAGGG - Intergenic
1114117431 14:19637141-19637163 CTGGGAGGGAGTAAAGGAGAGGG + Intergenic
1114124677 14:19711316-19711338 CTGGAAAGGAGTAAAGAAAGAGG + Intergenic
1114516076 14:23301292-23301314 CGGGGAGGGCGAAAAGGGTGGGG - Exonic
1114532314 14:23403654-23403676 CAGGCAGGGAGAGAAGGCAGAGG + Intronic
1114563893 14:23614150-23614172 CCAGGAGGGAGTAAAGGGAGAGG + Intergenic
1114616483 14:24071449-24071471 TTGGGAGGGAGAAGAGGGAAGGG - Intronic
1114731141 14:24993943-24993965 CTGGGAGGGACAAGAGGGAGTGG - Intronic
1115270127 14:31542134-31542156 AGGGGATGGGGAAAAGGAAGAGG - Intronic
1115373280 14:32643640-32643662 TCAGGAGGGAGAAAAGGAAAAGG - Intronic
1115508036 14:34111354-34111376 GAGGGAGGGAGGAAAGGAGGGGG + Intronic
1115519616 14:34220425-34220447 CTGTAATGGAGAAAGGGAAGGGG + Intronic
1115749322 14:36472847-36472869 TTTGGAGGGAGGGAAGGAAGGGG + Intergenic
1115766470 14:36628229-36628251 TTGGGAGAGAGAAAAAGAAGTGG - Intergenic
1115842161 14:37484290-37484312 CATGGAAGGAGAAATGGAAGAGG - Intronic
1115959940 14:38824364-38824386 CTAGAAGGGAGAAAGGGAGGAGG - Intergenic
1116097933 14:40395895-40395917 CTGGCAGGAAGTAAAGGAGGGGG + Intergenic
1116342299 14:43739386-43739408 CTGGGACGGAGAAAAGAAGTGGG - Intergenic
1116553376 14:46271113-46271135 GTGGGAGGGAGGAAAGAAGGGGG + Intergenic
1116687352 14:48056896-48056918 TTGGGAGGCAGAAAGGGAATGGG - Intergenic
1116855519 14:49949011-49949033 TTCTTAGGGAGAAAAGGAAGAGG + Intergenic
1116872952 14:50084947-50084969 GATGGAGGGAGAAAGGGAAGGGG + Intronic
1116969624 14:51050774-51050796 ATGGGAGGGAGAAAAGGAGAGGG - Intronic
1117706737 14:58477769-58477791 GGGGGAAGGAGAAAAAGAAGAGG - Intronic
1117809592 14:59532683-59532705 AGGGGAGGGAGGAAAGGAACAGG - Intronic
1118102764 14:62624994-62625016 CTGTGAGAGAAAAAAGGAAGAGG - Intergenic
1118221632 14:63859937-63859959 GAGGGAGGGAGGGAAGGAAGGGG - Intronic
1118321831 14:64757900-64757922 CTGGATGGGAGAGCAGGAAGAGG - Intronic
1118381932 14:65224630-65224652 CTGGGACTGAGAATAGGAAGGGG + Intergenic
1118456322 14:65948310-65948332 CTGGGAGGGTGAAGAGGAGCTGG + Intergenic
1118533906 14:66737214-66737236 GAGGAAGGGAGAACAGGAAGAGG - Intronic
1118583171 14:67325246-67325268 TTTGGAGGGTGAAGAGGAAGAGG - Intronic
1118641406 14:67796071-67796093 ATAGGAGGGAGAGAAGGATGGGG + Intronic
1118805826 14:69236212-69236234 TGGGGAGTGAGATAAGGAAGAGG + Intronic
1119039426 14:71259438-71259460 CTGTGAAGGATAAAAGGAAGTGG + Intergenic
1119062033 14:71484985-71485007 CTGGGATGGAGTAAGGGGAGGGG - Intronic
1119320657 14:73728351-73728373 GTGGGAGGTACAAATGGAAGCGG - Intronic
1119381952 14:74234751-74234773 ATGGGAGGGAAGAAAGGAAGGGG - Intergenic
1119583618 14:75811106-75811128 GTGGGAGGGAGAAATAGAGGGGG + Intronic
1119605067 14:76008605-76008627 GGGAGAGGGAGCAAAGGAAGAGG - Intronic
1119830143 14:77694912-77694934 ATGGGTGGGAAAAAAAGAAGAGG + Intronic
1119834561 14:77736743-77736765 ATGGGAGGGACAAGAGGAATAGG - Intronic
1119857135 14:77909081-77909103 CTGGGATGGAAGGAAGGAAGTGG + Intronic
1119964502 14:78899188-78899210 CAGGAAGAGAGAAAAAGAAGAGG + Intronic
1120210760 14:81631282-81631304 TTGGCAGGGAGAAAAGGAGAAGG + Intergenic
1120327643 14:83050672-83050694 GTGGAAGGCAGAAAGGGAAGGGG - Intergenic
1120583350 14:86280731-86280753 GATGGAGGGAGAAAATGAAGGGG - Intergenic
1120803192 14:88716037-88716059 GAGGGAGGGAGAAAAGGTAGGGG + Intronic
1120829158 14:88982797-88982819 CTGGAAGAGAGCCAAGGAAGGGG + Intergenic
1120863562 14:89276407-89276429 TAGTGACGGAGAAAAGGAAGAGG + Intronic
1120873743 14:89360362-89360384 GAGGGAGGGAGAAAGGGAAAGGG + Intronic
1121049619 14:90811984-90812006 CTGGCAGGGAAAAAAGAGAGTGG - Intronic
1121050806 14:90817712-90817734 GTGGGATGGAGAAATGGCAGAGG + Intergenic
1121163858 14:91772646-91772668 CAGGAAAGGAGAAGAGGAAGGGG + Intronic
1121185876 14:91968813-91968835 CTGAGATGGAGAACAGTAAGTGG + Exonic
1121202400 14:92129319-92129341 TTGAGAGGGAGAAGAGGTAGGGG + Intronic
1121237660 14:92404514-92404536 CTGTGTTGGAGAAAAGGAAGAGG - Intronic
1121580597 14:95026861-95026883 AAAGGAGGGAGAAAAGGAAGGGG - Intergenic
1121624697 14:95375269-95375291 GAAGGAGGGAGGAAAGGAAGAGG - Intergenic
1121706446 14:95999057-95999079 CGGTGGGGGAGGAAAGGAAGTGG - Intergenic
1121717045 14:96083848-96083870 CCGGGAGGCAGAGAAGGGAGGGG + Intronic
1121763100 14:96462164-96462186 CTGGGAGGGGGCAGAGGAAGTGG + Intronic
1121828405 14:97029239-97029261 GAGGGAGGGAGAGAGGGAAGAGG - Intergenic
1121875520 14:97447627-97447649 GTGGGAAGGAGAAAGGGCAGGGG - Intergenic
1122096477 14:99376539-99376561 GAGGGAGGGAGGGAAGGAAGGGG + Intergenic
1122109912 14:99491974-99491996 CTGAGTGAAAGAAAAGGAAGAGG + Intronic
1122307701 14:100776273-100776295 ATGGGTGGGAGGAAGGGAAGTGG + Intergenic
1122329998 14:100905395-100905417 CTGGGAGGGAGAGTGGGGAGAGG + Intergenic
1122392499 14:101399825-101399847 AAGGGAGGGAGGGAAGGAAGGGG + Intergenic
1122579198 14:102761143-102761165 CTGGGAGGGAGGGAAGACAGCGG - Intergenic
1122791065 14:104184394-104184416 CTGGGATGGTGAACAGGAGGAGG - Intergenic
1122795294 14:104203082-104203104 CAGGGAGGGAGCCAAGGAGGCGG - Intergenic
1123674257 15:22692752-22692774 ATGGGAGAGAGAAAGGGAGGGGG + Intergenic
1123678638 15:22739459-22739481 AAGGGAGGGAGAGAAAGAAGAGG - Intergenic
1124326269 15:28765741-28765763 ATGGGAGAGAGAAAGGGAGGGGG + Intergenic
1124330844 15:28813740-28813762 GAGGGAGGGAGAGAAAGAAGAGG - Intergenic
1124354570 15:28985158-28985180 CTGGCTGGGAGAAGAGGAGGAGG + Intronic
1124425419 15:29558706-29558728 CAGGGTGGCAGAGAAGGAAGAGG - Intronic
1124994456 15:34709356-34709378 CAGGTAGGGAGAGAAGGAAGTGG - Intergenic
1125049743 15:35283143-35283165 GGGGGAGGGAAAAGAGGAAGAGG - Intronic
1125414131 15:39434946-39434968 GTGGGAGGGAGTCAAGGAAAGGG - Intergenic
1125581559 15:40789338-40789360 CTGTGGGGGAGTGAAGGAAGGGG - Intronic
1125584232 15:40808987-40809009 CTGGGAGGAAGAAGAGGAGTGGG - Intronic
1126897340 15:53273194-53273216 TTGGGAGGTAGGAAAGGCAGGGG - Intergenic
1127400645 15:58582117-58582139 AGAGGAGGGAGAGAAGGAAGAGG + Intergenic
1127580891 15:60338470-60338492 CTGAGGAGGAGAAAATGAAGTGG + Intergenic
1127660771 15:61098170-61098192 CAGGGAGGGAGGCAGGGAAGGGG - Intronic
1127710880 15:61596959-61596981 CTGGGAGGGAGGAGAGGGATCGG - Intergenic
1128090963 15:64918623-64918645 CTACGAGGGAGAACAGTAAGAGG + Intronic
1128290931 15:66477776-66477798 CTGGGTGGGAGGAGTGGAAGAGG + Intronic
1128433691 15:67624408-67624430 CTGGGAGGCAGAAGAGCAAATGG - Intronic
1128462619 15:67882745-67882767 CTGGAAGGAAGGAAGGGAAGGGG - Intergenic
1128500642 15:68225011-68225033 CTGCCTGGCAGAAAAGGAAGGGG + Intronic
1128608133 15:69053737-69053759 GTGGGAGGGAGAAGATAAAGGGG - Intronic
1128673709 15:69593959-69593981 CTCGGAGGGACAGAAGGAACGGG - Intergenic
1128739012 15:70070910-70070932 GTGGGAGGGAGGAGAGGAAGAGG - Intronic
1129160688 15:73746080-73746102 CTGGGAGAGAGGGAAGGAGGTGG - Intronic
1129223804 15:74153622-74153644 CAGGCAGGGTGGAAAGGAAGAGG + Intergenic
1129243729 15:74267475-74267497 CTAGGAGGGAGGACAGGCAGGGG - Intronic
1129384082 15:75185961-75185983 GAGGGAGGGAAAGAAGGAAGTGG + Intergenic
1129578203 15:76776555-76776577 GTGGGAGGCAGAAAAAGTAGTGG + Intronic
1129675783 15:77632003-77632025 ATGGGAGGGGGGACAGGAAGGGG + Intronic
1129767169 15:78177664-78177686 CAGGGAGGGACAAAAGGTCGCGG - Intronic
1130350931 15:83091211-83091233 CTGGGAGAAGGAAAAGGAAAGGG - Intergenic
1130740058 15:86589730-86589752 GAGGGAGGGAGGAAAGGAGGAGG - Intronic
1130787602 15:87117350-87117372 CTGGGAGGAATAAATGGAAAAGG + Intergenic
1130825629 15:87542882-87542904 GTGGGAAGAAGAAATGGAAGGGG + Intergenic
1130895362 15:88166264-88166286 CTGGAAGGCAGAAGTGGAAGGGG + Intronic
1130937459 15:88482361-88482383 ATGGGATGGACAAAAGGAGGTGG + Intergenic
1130938535 15:88489620-88489642 GTGGGAGGAAGAGGAGGAAGCGG - Intergenic
1130996254 15:88906005-88906027 CTGGGAGGGTGAAGAGGACTTGG + Intronic
1131052714 15:89359173-89359195 GAGGGAGGGAGAAGAGGAACGGG - Intergenic
1131059780 15:89397557-89397579 CTGGGAGGGAGCAGGGGCAGGGG + Intergenic
1131107277 15:89743808-89743830 GTGGGAGGGAGAAATGGGTGGGG - Intergenic
1131117006 15:89801913-89801935 CTGGGAGGAGGACAAGAAAGAGG + Intronic
1131151425 15:90049689-90049711 CTGGGAAGGAGAGACGGAAGAGG - Intronic
1131172820 15:90190602-90190624 CTGTGAGGGGAAAAAGGAACAGG - Intronic
1131236579 15:90702169-90702191 CAGTGAGAGAGAAAAGGAATTGG + Intergenic
1131278461 15:91001961-91001983 CTGGGAGGGACAGAATGAATTGG - Intronic
1131418940 15:92287402-92287424 CTGTGAGGGAAACAGGGAAGTGG - Intergenic
1131540333 15:93270142-93270164 CTGGCAGGGAGATGAGGAGGAGG + Intergenic
1131582677 15:93660579-93660601 CTGGGAAGGGAAAAGGGAAGGGG - Intergenic
1131608976 15:93940928-93940950 GTGAGAGGGAGAGAAGGAAAGGG + Intergenic
1131793341 15:95988414-95988436 GAGGGAGGGAGGGAAGGAAGAGG + Intergenic
1131821499 15:96278833-96278855 CTGGGAAGCAGAAGAGGAAGTGG - Intergenic
1132772142 16:1569575-1569597 GAGGGAGAGAGAAAAGGAAGGGG - Intronic
1133274035 16:4625843-4625865 GTGGAAAGGAGAGAAGGAAGAGG + Intronic
1133553387 16:6881263-6881285 TGGGGAGAGAGCAAAGGAAGGGG + Intronic
1133597095 16:7303832-7303854 GAGGGAGGGAGAGGAGGAAGGGG - Intronic
1133836678 16:9373750-9373772 CCAGGAGGGAGCAAAGGCAGAGG + Intergenic
1133874691 16:9722808-9722830 CAGGGAGGAAGAAAAGGAGAAGG - Intergenic
1133874783 16:9723398-9723420 GGAGGAGGAAGAAAAGGAAGAGG + Intergenic
1133898112 16:9948689-9948711 CTGCATGGGAGTAAAGGAAGAGG + Intronic
1134667346 16:16028455-16028477 CTGGCAGAGAGAGGAGGAAGGGG - Intronic
1135166381 16:20142822-20142844 CTGGGAGGGAGCGAGGGAGGTGG + Intergenic
1135458201 16:22617309-22617331 ATGTGAGGCAGAAGAGGAAGAGG + Intergenic
1135598155 16:23759102-23759124 CTGGGAGGGAGAAAAACAGCAGG - Intergenic
1135640915 16:24119217-24119239 CTGGGAGGGAGGGAGGAAAGAGG + Intronic
1136222930 16:28840130-28840152 GTGGGTGAGAGAAGAGGAAGAGG - Intergenic
1137290806 16:47050695-47050717 CTTGGAGGCAGAAGAGGAAAAGG - Intergenic
1137393153 16:48098016-48098038 CAGGCCTGGAGAAAAGGAAGAGG + Intronic
1137792201 16:51184788-51184810 TTGGGAGGAGGAAAAGGAAGAGG + Intergenic
1137906491 16:52327405-52327427 CTGGGAGGAAGAAACGAATGAGG + Intergenic
1138218529 16:55227330-55227352 GAGGGAGGGAGAAAGGGAGGTGG - Intergenic
1138333191 16:56231580-56231602 CTGGGAGGGACTAAAAGAACTGG + Intronic
1138339872 16:56281600-56281622 AAGGGAGGGAGAGAGGGAAGGGG - Intronic
1138418369 16:56884328-56884350 TTGGGAGGGATAAAGGGGAGGGG - Intronic
1138438988 16:57023182-57023204 AAGGGAGGGAGAAAGGAAAGAGG - Intronic
1138595885 16:58028723-58028745 CTGGGAGGGGAGAGAGGAAGTGG - Intronic
1138995651 16:62449502-62449524 CTGAGAGGGAGGAGAGGAAGTGG - Intergenic
1139164289 16:64547797-64547819 GTGGGAGGGAGGAGAGGATGAGG - Intergenic
1139293233 16:65876671-65876693 GTGGAATGGGGAAAAGGAAGAGG + Intergenic
1139442772 16:66977148-66977170 CTGGGAGGGGGGAGAGGAGGGGG + Intergenic
1139444285 16:66987348-66987370 CTGGGGAGGGGAAAAGGCAGGGG - Intergenic
1139504131 16:67390662-67390684 CTGGGGGAGAAAAAAGAAAGGGG - Intronic
1139777392 16:69324939-69324961 CTCAGAGGAAGAAAAGGCAGTGG - Exonic
1139946277 16:70644722-70644744 GGGGGAGGGGGAAGAGGAAGAGG + Intronic
1139988575 16:70920713-70920735 CTGGGAGGGGGAAGGGGAGGAGG - Exonic
1140127588 16:72131150-72131172 CTGAGATGTAGAAAAAGAAGTGG + Intronic
1140292460 16:73673462-73673484 CTGGGAGGGGGAAGAGAATGAGG - Intergenic
1140314741 16:73885035-73885057 CTGGGTGGGGGGAAAGAAAGGGG - Intergenic
1140416076 16:74774711-74774733 CTCGGAGGGCGAGAAGGAGGCGG + Exonic
1140451576 16:75075102-75075124 GTGGGAGGGAGTAAATGGAGAGG + Intronic
1140558706 16:75952067-75952089 CAGGGAGGGAAGAAAGGAAGGGG - Intergenic
1140565558 16:76037176-76037198 CTGTGAGGCAGAAAGGGGAGAGG + Intergenic
1140668481 16:77250036-77250058 CTAGGAGTGAGAAATGGAATTGG + Intronic
1140928896 16:79609117-79609139 CTGGGAATGAGAGAAGGAACCGG + Intergenic
1141025268 16:80540979-80541001 CTAGGAGACAAAAAAGGAAGTGG - Exonic
1141154857 16:81590223-81590245 ATGGGAGGGAGGAAAAGAATGGG - Intronic
1141431399 16:83972002-83972024 CGGGGAGGGGGAGAGGGAAGGGG + Intronic
1141460865 16:84178152-84178174 AGGGGAGGGAGGAAAGAAAGGGG + Exonic
1141471351 16:84240622-84240644 TTGGGTGGGTGAAAAGGAAGAGG + Intergenic
1141518469 16:84562054-84562076 CTGGGAGGGAGCAAAAGACATGG - Intergenic
1141657648 16:85424576-85424598 CGGGCTGGGAGAGAAGGAAGAGG - Intergenic
1141850173 16:86639785-86639807 CAGGGAGTGAGATCAGGAAGGGG + Intergenic
1141946101 16:87311063-87311085 ATGGGAGGAAGAAGGGGAAGAGG - Intronic
1142419536 16:89961894-89961916 TGGGGAGGGAGAGCAGGAAGGGG + Intronic
1142835202 17:2580426-2580448 CTGGGAGGAAGAAAAGGCAGTGG + Intergenic
1142889901 17:2936480-2936502 CAGGGAGGAAGGAGAGGAAGAGG - Intronic
1142953040 17:3499735-3499757 CAGGGAGAGAGACAAGGAAATGG - Exonic
1143126146 17:4641892-4641914 ACGGGAGGGAGAAAAAGAAAAGG + Intronic
1143149181 17:4796835-4796857 CTGGCAGGCAGGAAAGGAAAAGG - Intronic
1143389645 17:6552682-6552704 CTAGGAGGATGGAAAGGAAGAGG - Intronic
1143512937 17:7405844-7405866 CTGGGAAGGGGAGAAGGAGGGGG - Intronic
1143595639 17:7912062-7912084 CTGGGAGGGAGGAAGGGACGAGG + Exonic
1143611263 17:8019245-8019267 CAGGGAGAGAGGGAAGGAAGGGG - Intronic
1143686767 17:8523648-8523670 GGGGGAGGGAGAAGTGGAAGTGG + Intronic
1143786028 17:9256380-9256402 GAGGGAGGGAGAAAGAGAAGAGG - Intronic
1143961418 17:10724186-10724208 GTGGGAGGAAGCAAAGGAAGAGG + Intronic
1143973598 17:10813633-10813655 CTGGGACAGAGAGGAGGAAGGGG + Intergenic
1144050001 17:11490329-11490351 CTGAGAGGGAGTAAGAGAAGAGG + Intronic
1144058561 17:11561607-11561629 CTGGGAGGGAGAGTGGAAAGAGG - Exonic
1144101403 17:11945179-11945201 CTGGCAGGGGGAAGGGGAAGAGG + Intronic
1144340984 17:14310150-14310172 CTGGGATGGAGAGGAGGAAGAGG + Intronic
1144354034 17:14427276-14427298 TTGGGAGGTAGAAATGGAACTGG + Intergenic
1144512994 17:15893506-15893528 CAGGGAGGAAGAAAGGGAGGAGG - Intergenic
1144696702 17:17308749-17308771 CTGGCAGGGAGCACAGGAATGGG - Intronic
1144727649 17:17509952-17509974 GTGGGAGGTAGGACAGGAAGAGG - Intronic
1144738615 17:17568836-17568858 CTGGGAGGAGGAAGAGGAGGAGG - Intronic
1144752086 17:17655929-17655951 GAGGGAGGGAGAGAAGGGAGGGG + Intergenic
1144758542 17:17694542-17694564 CGGGGAGAGAGGAAAGGAAATGG - Intronic
1144767224 17:17739426-17739448 CCAGGAGGGAGAGAAAGAAGAGG + Intronic
1144779372 17:17800116-17800138 CTGGGAAGGGGAGAGGGAAGAGG - Intronic
1145835749 17:27953034-27953056 GTGGGAGGGGGAAAAAGAGGTGG - Intergenic
1145905459 17:28513872-28513894 CAGGGATGGCGAAAAGGAAGGGG + Intronic
1145941832 17:28746823-28746845 CTGGGAGGGGGAACAGGGATGGG - Intronic
1146111935 17:30097824-30097846 ATGGGAGAGACAAATGGAAGGGG - Intronic
1146267200 17:31460628-31460650 GAGGGAGAGAGAAAATGAAGAGG - Intronic
1146569810 17:33942497-33942519 CTGTAAAGGAGAAAAGGAGGTGG - Intronic
1146654714 17:34628530-34628552 GTGGGAGGAAGAAGAGGGAGAGG - Intronic
1146917078 17:36684912-36684934 CTCAGAGGGAGTAGAGGAAGGGG - Intergenic
1146933089 17:36791958-36791980 TGGGGAGGGGGAAAAGGTAGAGG + Intergenic
1147161248 17:38570659-38570681 CTGGGAGGGAGATAAAGACAGGG + Intronic
1147255388 17:39178086-39178108 TGGGGAGAGAGAAAAGGAAGAGG + Intronic
1147586585 17:41656684-41656706 CAGGTAGGGAAGAAAGGAAGAGG + Intergenic
1147689399 17:42306218-42306240 CTGAGAGGGAGACAAGAGAGGGG - Intronic
1147845303 17:43400348-43400370 CTAGGTGGGAGGAAAGGGAGGGG - Exonic
1147901562 17:43789736-43789758 ATGGGAGGGGGAAGAGGAGGAGG - Intergenic
1148079994 17:44962442-44962464 GTGGGAGGGAATAAATGAAGGGG + Intronic
1148203343 17:45764325-45764347 GAGGGAGGGAGAAAAGGTGGAGG + Intergenic
1148221333 17:45864652-45864674 AGGGGAGGGAGAAAGGGAAATGG - Intergenic
1148466262 17:47866892-47866914 CTGGGAGGGAGACAGGGAGGGGG + Intergenic
1148728987 17:49819098-49819120 CTGGGAAATAAAAAAGGAAGGGG - Intronic
1148853443 17:50565821-50565843 CCAGGAGGGAGGAAAGGAGGAGG + Intronic
1148948011 17:51282600-51282622 CGGGGAGGGAGAAGAGGTTGGGG + Intronic
1148966164 17:51437857-51437879 CTGGGAGGGAGATGGAGAAGGGG + Intergenic
1149052978 17:52328844-52328866 ATGAGAAGGAGAAAAGGAGGAGG - Intergenic
1149165096 17:53741939-53741961 GTGGTAAGGAGAAAAGAAAGAGG + Intergenic
1149911332 17:60569610-60569632 ATGCGAGGGAGAAAAGGGAGGGG - Intronic
1150003157 17:61454596-61454618 GTGGCGGAGAGAAAAGGAAGAGG + Intronic
1150221799 17:63499848-63499870 CTGGAAGGTAGCAGAGGAAGAGG + Intronic
1150427283 17:65086720-65086742 AGGGAAGGGAGAACAGGAAGGGG - Intergenic
1150545649 17:66154971-66154993 GAGGGAGGGAGAAAGAGAAGTGG - Intronic
1150666565 17:67144725-67144747 GTGGGAGGGATGACAGGAAGTGG - Intronic
1150667259 17:67152848-67152870 CTGGGAAGGAGCAAAGAAATAGG + Intronic
1150830160 17:68511982-68512004 AAAGGAGGGAGAAAAGGCAGAGG + Intronic
1150916393 17:69441929-69441951 CTGGGAGGGAGAAAGGCACTTGG + Intronic
1151023819 17:70653455-70653477 TTAGGAAGGAGAAAAAGAAGGGG + Intergenic
1151050994 17:70978539-70978561 GAGGGAGGGAGGAAAAGAAGGGG + Intergenic
1151051004 17:70978565-70978587 GAGGGAGGGAGGAAAAGAAGGGG + Intergenic
1151078496 17:71301520-71301542 AGGGAAGGGAGAAAAGAAAGGGG - Intergenic
1151330223 17:73402111-73402133 CTGGGAGCCGGAACAGGAAGAGG - Exonic
1151544521 17:74784605-74784627 CTGGGAGGGAGGATTGGCAGGGG + Intronic
1151765341 17:76130815-76130837 CTTGGAGAGGGAAGAGGAAGAGG - Intergenic
1151833522 17:76569373-76569395 CTGGGAGGGAGATTTGGAGGTGG + Intronic
1151833603 17:76569595-76569617 CTGGGAGGGAGACTGGGTAGGGG + Intronic
1151886344 17:76925256-76925278 CCGGGAGGCAGACACGGAAGTGG - Intronic
1152180092 17:78814187-78814209 CTTGCAGGGAGACACGGAAGAGG - Intronic
1152313686 17:79567066-79567088 CTGGGAAGGAGAACGGGAAGAGG - Intergenic
1152328733 17:79658249-79658271 GAGGGAGGGAGAAATGGAGGAGG - Intergenic
1152368922 17:79873030-79873052 CTTGGAGGCAGATTAGGAAGAGG - Intergenic
1152598922 17:81251689-81251711 AAGGGCGGGACAAAAGGAAGTGG + Intronic
1152609230 17:81307466-81307488 AGGGGAAGGAGAAAGGGAAGGGG - Intergenic
1152639624 17:81444209-81444231 CTGGGAGGGAGAACGGGACCTGG - Intronic
1152650834 17:81491849-81491871 GAGGGAGGGAGAGAGGGAAGGGG - Intergenic
1152658222 17:81529774-81529796 ATGGGGTGGAGAAAAAGAAGGGG - Intronic
1152753621 17:82077848-82077870 CTGGGAGGGAGCAAGGGACAGGG - Intergenic
1152762816 17:82118262-82118284 CTGGGAGGGAGTAAGAGAAGAGG + Intronic
1152852164 17:82643599-82643621 CTGGGATGTAGAACAGTAAGTGG - Intronic
1153317941 18:3742513-3742535 CTGGAAGGGAACAATGGAAGAGG + Intronic
1153630740 18:7067510-7067532 CTGGGAGGGAGGAGAGCAAGTGG + Intronic
1153659165 18:7311185-7311207 CTGGGCTGGCGAGAAGGAAGGGG - Intergenic
1154072819 18:11168699-11168721 CTGGGAAGGGGAAAGGGGAGAGG - Intergenic
1155389242 18:25316194-25316216 CGGGCAGGGAGAAAGGAAAGGGG + Intronic
1155996142 18:32333218-32333240 GTGGAAGAGAGACAAGGAAGGGG + Intronic
1156034742 18:32753769-32753791 CTGGGAGGTGGAGAAGGAGGGGG - Intronic
1156058190 18:33036821-33036843 CGGGGAGACAGAATAGGAAGCGG + Intronic
1156170316 18:34475465-34475487 CAGGGAGAGGGAAGAGGAAGGGG - Intergenic
1156197420 18:34790946-34790968 CCTGGAGGGAGAATAGGCAGCGG + Intronic
1156270233 18:35523904-35523926 CTGGGAAGGAGAGGAGAAAGAGG - Intergenic
1156454270 18:37284323-37284345 GTGGGTGGGAGAGGAGGAAGGGG - Intronic
1156472879 18:37388486-37388508 TGGGGAGGGAGAGGAGGAAGAGG - Intronic
1156475492 18:37403052-37403074 CTGGGAGGAAGGGAAGGAGGAGG + Intronic
1156475507 18:37403137-37403159 CAGGCAGAGAGAGAAGGAAGAGG + Intronic
1156558687 18:38096892-38096914 TGGGAAGAGAGAAAAGGAAGAGG + Intergenic
1157401757 18:47394452-47394474 CTGCGAGGGAGCAAAGGAAATGG + Intergenic
1157406202 18:47424435-47424457 CTGAGAGAGAGTGAAGGAAGGGG + Intergenic
1157413770 18:47485375-47485397 CTTGGAGGCAGAATAGGAAAAGG + Intergenic
1157424957 18:47576911-47576933 CTGGGAGGCAGAGCAGGAAATGG + Intergenic
1157784887 18:50472763-50472785 CAGGCACAGAGAAAAGGAAGAGG + Intergenic
1157863918 18:51165039-51165061 GTGGGAGGGAACAATGGAAGAGG + Intergenic
1157889303 18:51399812-51399834 CTGTCAGGGACAAAAGGCAGAGG - Intergenic
1157965103 18:52199967-52199989 TGGGGGGTGAGAAAAGGAAGGGG - Intergenic
1158103770 18:53861348-53861370 GAGGGAGGGAGGAAAGGAGGAGG + Intergenic
1158499488 18:57987314-57987336 CTGGGAGGGGCAAAGGGAGGAGG - Intergenic
1158634688 18:59146482-59146504 CTGGCAGGAAGACAAGAAAGTGG + Intronic
1159026084 18:63183272-63183294 CAGTGAGGGAGAGAAAGAAGAGG + Intronic
1159547854 18:69863166-69863188 TTGGGAGGGAAAAAAGAAATTGG - Exonic
1159586082 18:70284784-70284806 ATGGGAGGGAGGGAAGGAAGTGG + Intergenic
1159841975 18:73408628-73408650 CTGGGATGGAGAGAAGGGACTGG + Intergenic
1160111877 18:76040345-76040367 CAGGGAAGGAGAAAGGGAGGTGG + Intergenic
1160128775 18:76205271-76205293 GAGGGAGGGAGGAAAAGAAGGGG + Intergenic
1160760539 19:782060-782082 CAGGGAGGGAGAGACGGACGGGG - Intergenic
1160951534 19:1669893-1669915 AGGGGAGGGAGGGAAGGAAGGGG - Intergenic
1161085438 19:2332959-2332981 CTGGGAGGGGGAGCAGGAGGAGG + Intronic
1161085459 19:2333020-2333042 CTGGGAGGGGGAGCAGGAGGAGG + Intronic
1161085497 19:2333141-2333163 CTGGGAGGGGGAGCAGGAGGAGG + Intronic
1161197075 19:2992830-2992852 CTGGGAAGGAAAAAAGGTAGTGG + Intronic
1161299483 19:3535944-3535966 CAGGGAGGGAGGCAAGGCAGGGG + Intronic
1161637242 19:5396612-5396634 CTGGGAGGTAGAGGAAGAAGGGG + Intergenic
1162012109 19:7823539-7823561 AGGGGAGGGAGAAAAGGGAAAGG + Intergenic
1162030315 19:7914461-7914483 CTCGGTGGAAGAAAAGGAAGGGG - Exonic
1162246464 19:9405719-9405741 GTGGAAGGGAGGAAAGGAAGGGG + Intergenic
1162461645 19:10817286-10817308 CTGGGTGGGAGAAGAGGCACTGG - Intronic
1162690514 19:12426048-12426070 AGGGGAAGGGGAAAAGGAAGAGG + Intronic
1162779817 19:13001094-13001116 CTGGGGTGGGGAAAAGGAGGGGG + Intronic
1162952963 19:14082733-14082755 CTGGCAGGGAGAAAAGGCCTTGG - Intronic
1162954518 19:14090831-14090853 GAGGGAGGGAGGGAAGGAAGGGG - Intronic
1163161977 19:15470173-15470195 CTGGGCTTGAGAAAAGGCAGAGG - Intronic
1163164027 19:15483097-15483119 CTGAGGGGGAGGAAGGGAAGGGG - Intronic
1163169944 19:15524293-15524315 CAGGGAGGGAGAATGGGAAGTGG + Intronic
1163187552 19:15649641-15649663 CTGGGAGGGAGAGAGGGAATAGG + Intronic
1163594261 19:18211704-18211726 CTGGGAGGAAGTAAAAGGAGGGG - Intronic
1163719074 19:18889783-18889805 CAGGGATGGAGACAAGGCAGGGG - Intronic
1164189017 19:22898507-22898529 CAGAGAGAGAGAGAAGGAAGGGG - Intergenic
1164286409 19:23821461-23821483 CTGGGAGGCAGACCAGGAAAAGG - Intronic
1164425993 19:28142446-28142468 GAGAGAGGGAGAGAAGGAAGGGG + Intergenic
1164505172 19:28854295-28854317 GTAGGAGTGAGAAAGGGAAGAGG - Intergenic
1164505606 19:28858508-28858530 GAGGGAGGAAGGAAAGGAAGGGG + Intergenic
1164572665 19:29385445-29385467 CTGGGAGGGGGAAATGGACCAGG + Intergenic
1164718678 19:30415188-30415210 GGGGGAGGGAGAAGAGGAGGAGG - Intronic
1164718690 19:30415215-30415237 GGGGGAGGGAGAAGAGGAGGAGG - Intronic
1164718698 19:30415236-30415258 GGGGGAGGGAGAAGAGGAGGAGG - Intronic
1165386605 19:35513823-35513845 GAGGGAGGGAGAAATGGATGAGG + Intergenic
1165761809 19:38326003-38326025 CTGGGTGGGGGAGAAGTAAGTGG + Intronic
1165773643 19:38392236-38392258 CTGGGAAGGAGAGGAGGAGGAGG - Exonic
1165808771 19:38597647-38597669 AAGGGATGGAGGAAAGGAAGTGG - Intronic
1165867302 19:38946568-38946590 CTGGGAAGGAGAGATGGCAGGGG + Intronic
1166001227 19:39878579-39878601 GTAGGAGGGAGGAAGGGAAGAGG - Intronic
1166166942 19:40997387-40997409 ATGGGAGGGGGAAGGGGAAGAGG - Intronic
1166662006 19:44653593-44653615 CTATGAGTGAGAAAAGGAGGAGG + Intronic
1166793162 19:45409730-45409752 ATGGGAGGGAGAAAAAAATGAGG + Exonic
1166986593 19:46663697-46663719 CTGGAAGGTAGAATAGGGAGGGG + Intergenic
1167140426 19:47646945-47646967 CTGGGAGGGGGAGAAGGAGTGGG - Intronic
1167240789 19:48342075-48342097 AGGGAAGGGAGAAAGGGAAGGGG + Intronic
1167247864 19:48384521-48384543 CAGGGCGGGAGAAAAGGCAGAGG + Intronic
1167304326 19:48698283-48698305 CCTGGAAGGAGAGAAGGAAGAGG - Intronic
1167389321 19:49183362-49183384 GTGAGAGAGAGAAAAGAAAGAGG - Intronic
1167616419 19:50536801-50536823 CTGGAAGGGTGGGAAGGAAGGGG + Intronic
1167709095 19:51099140-51099162 CTGGTGGGGAGAGAAGGGAGCGG + Intronic
1167765276 19:51478573-51478595 CTTGGAGGGAGCAGAGGAGGTGG + Intergenic
1167798349 19:51725156-51725178 CAGGCAGGGAGAAAAGAACGAGG - Intergenic
1167834818 19:52059834-52059856 CTGCCAGGCAGAAAAGGTAGAGG - Intronic
1168298229 19:55388286-55388308 CTGTGATGGTGAAGAGGAAGCGG + Intronic
1168401245 19:56087321-56087343 CCGGGAGGGAGAAGGGCAAGAGG - Intergenic
1168433873 19:56302561-56302583 GGGGGAGGAAGAAAAGGAAGGGG - Intronic
1168652060 19:58097843-58097865 GTGGGTGGGAGAACAGGAAGGGG - Intronic
1202702666 1_KI270713v1_random:222-244 GTGGCCGGGAGAAAAGGGAGAGG + Intergenic
925013586 2:504471-504493 AAGGGAGGGAGAGAAGGAAGCGG - Intergenic
925350329 2:3196832-3196854 CGGTGAGGGAGGAAAGGAAGTGG + Intronic
925559628 2:5176312-5176334 CTGGGAGAGAGTAAAGGAGAAGG - Intergenic
925953179 2:8935138-8935160 CTAAGAGGAAGAAAAGCAAGAGG + Intronic
926818947 2:16831817-16831839 TTGGGTGGGAGAAACAGAAGTGG + Intergenic
927127273 2:20023187-20023209 ATGGAAAGAAGAAAAGGAAGTGG - Intergenic
927187187 2:20490362-20490384 CTGGGAGGGATCAAAGCATGGGG - Intergenic
927255226 2:21035470-21035492 CTGGGAGGGAGGAATGGAGAGGG - Intronic
927456486 2:23254768-23254790 CTAGGAAGGAGAGATGGAAGTGG + Intergenic
927475642 2:23412405-23412427 CTGGGGGACAGAGAAGGAAGAGG + Intronic
927501371 2:23585620-23585642 CTGGGGGGCAGAAAGGGAGGAGG - Intronic
927679495 2:25130529-25130551 CTGTGAGGGAGAAAACGTGGGGG - Intronic
927946491 2:27137934-27137956 CTGGGAGGGAGAAAAGGAAGGGG + Exonic
928118447 2:28564633-28564655 CTGGCAGGTAGCAAAGGAACTGG + Intronic
928125067 2:28609859-28609881 GTGGCAGTGGGAAAAGGAAGAGG - Intronic
928243414 2:29606197-29606219 CTGTGAGGGAGACAGGGGAGGGG - Intronic
928346698 2:30504696-30504718 AAGGGAGAGAGAAAAGGAAGGGG - Intronic
928353454 2:30585174-30585196 TTGAGAGGGAAACAAGGAAGAGG - Intronic
928373298 2:30756674-30756696 CTGGGAAGGAGAACTGGAAAAGG + Intronic
928940582 2:36723654-36723676 CAGAGAGGGAGAAAGTGAAGTGG + Intronic
928949152 2:36799206-36799228 CAGGGATGGAGGAAAGGAAGCGG + Intronic
929072764 2:38050278-38050300 CAGGGAGACAGAAAAGGATGAGG - Intronic
929308701 2:40397199-40397221 CAGAAAGAGAGAAAAGGAAGGGG - Intronic
929385707 2:41403717-41403739 GATGGAGGGAGAAAAGGAAAGGG + Intergenic
929444395 2:41991549-41991571 GTGGGAGGGAAAGGAGGAAGAGG + Intergenic
929444501 2:41991947-41991969 AGGGGAGGGAGAAGAGGAGGGGG + Intergenic
929468881 2:42170465-42170487 GTGGAATGGAGAAAGGGAAGAGG + Intronic
929562183 2:42962821-42962843 GTTGGAGGGAGAAAAGGTAGAGG + Intergenic
929589545 2:43136045-43136067 CTGGGAGGAAGAGAAGGAGAGGG + Intergenic
929864263 2:45704938-45704960 ATGGGAGGGACAAAGGAAAGGGG - Intronic
929867350 2:45729502-45729524 GTAGGAGGGGGAAAAGGAATCGG - Intronic
930121384 2:47763758-47763780 CTGGGAGGGTGGGAAGGATGGGG - Intronic
930231467 2:48847940-48847962 CAGGGAGGGAGAAGAAGAAAGGG - Intergenic
930246591 2:48989958-48989980 CAGGGAGGGAGGAGAGAAAGAGG - Intronic
930539995 2:52693467-52693489 GAGGGAGGGAGAAAGGGAGGAGG + Intergenic
930759037 2:55011746-55011768 ATGAGAGGGGAAAAAGGAAGTGG + Intronic
930790018 2:55315302-55315324 CAGGGAAGGAGAAGAGGAATGGG + Intronic
930991584 2:57662908-57662930 CTGAGGTGGATAAAAGGAAGTGG - Intergenic
930992904 2:57682053-57682075 ATTTGAGGGAGAAAAGGAAGGGG - Intergenic
931128470 2:59304202-59304224 CTGGCAGGAAAAAAAGGAAAAGG - Intergenic
931189471 2:59986055-59986077 CGGGGAGTGAGAGAAGGAATAGG + Intergenic
931640552 2:64377346-64377368 CTGGGAAAGAGAAAAGGAGAGGG + Intergenic
931739837 2:65231994-65232016 CTGGGAGATAGAAAATCAAGCGG - Intronic
931755040 2:65365961-65365983 CTAGGTGGGAGAAAGGGTAGTGG - Intronic
931926349 2:67076899-67076921 CTGGGAGTGAGAAGAGAATGTGG - Intergenic
931983370 2:67718294-67718316 CTGTGAGGGATAGAAGGATGAGG - Intergenic
932088097 2:68780337-68780359 CTGGTAAGGAGAGAAGGAAAGGG - Intronic
932177253 2:69614281-69614303 CAAGGAAGGAGAAAGGGAAGAGG + Intronic
932462941 2:71895111-71895133 GAGGGAGAGAGGAAAGGAAGAGG - Intergenic
932515299 2:72340992-72341014 CAAGGAGAGAGAAAAGGAGGAGG + Intronic
932657765 2:73625176-73625198 CTAGGGGGAAAAAAAGGAAGGGG + Intergenic
932664444 2:73685464-73685486 CTAGGGGGAAAAAAAGGAAGGGG + Intergenic
932689558 2:73900771-73900793 CTGGGAGTGTGGAAAGGAACTGG - Intronic
932703221 2:74004568-74004590 CTGGGAAGGAGAAGAGCCAGGGG + Intronic
932735593 2:74252046-74252068 CTGGGAGGGAAAGAAGGCAGGGG + Intronic
932743699 2:74313571-74313593 CAGGGATGAAGAAAACGAAGTGG + Intronic
932771131 2:74501547-74501569 CTAGGCGGGAGAGATGGAAGGGG - Intronic
933721141 2:85398522-85398544 CTGGGAGTGAGACAAGGATGGGG - Intronic
933725170 2:85422715-85422737 CTGGGTGGGACAGAGGGAAGAGG + Intronic
933851946 2:86375141-86375163 CTGGGAAGGATAAAGGGAGGGGG - Intergenic
934150115 2:89138411-89138433 CAGGGAGTGATAAGAGGAAGGGG - Intergenic
934217181 2:90043618-90043640 CAGGGAGTGATAAGAGGAAGGGG + Intergenic
934665203 2:96164721-96164743 CCGGGAAGGAGGAAGGGAAGGGG - Intergenic
934715183 2:96538890-96538912 TGGGGAGGGAGAGAAGGAAAGGG + Intronic
935223550 2:101035017-101035039 CTGGGGGGGAGACAGGGAAGAGG + Intronic
935622966 2:105144525-105144547 CTGTGATGGAGAAACGGGAGAGG + Intergenic
936024761 2:109022603-109022625 GTGGGAGGGGGAGAGGGAAGAGG + Intergenic
936233596 2:110725028-110725050 GAGGGAGGGAAGAAAGGAAGGGG + Intergenic
936456949 2:112682576-112682598 CTGGGAAGGGGAAAGGGAAGAGG - Intergenic
936456992 2:112682800-112682822 TTGGGAAGGGGAAAAGGAAGAGG - Intergenic
936934204 2:117822794-117822816 GTGGGAGGGAGAAATTGAAAAGG - Intronic
937043813 2:118840327-118840349 CTGGGAGGGTGAAATGGAATGGG + Intergenic
937102740 2:119284089-119284111 CTGGGAATGAGAAAAGGGTGTGG - Intergenic
937311339 2:120905217-120905239 GAGGGAGGGAGAGAAGGAGGAGG + Intronic
937345962 2:121125456-121125478 AGGGGAAGGAGAAGAGGAAGAGG + Intergenic
937380333 2:121370813-121370835 TTGGGAGGGAGAAAATAAAGAGG - Intronic
937451532 2:122006001-122006023 AGGGGAGGGAGGAAAGGAAGAGG + Intergenic
937670130 2:124529880-124529902 CTTTGAGAGAGAAAAAGAAGGGG - Intronic
937752409 2:125492459-125492481 CTGGGAAGGAAAAGAGGGAGCGG - Intergenic
937777533 2:125797307-125797329 CGGGGAGGGGGAAGAGGAGGGGG + Intergenic
937812090 2:126210657-126210679 CTGGGAGGAAGAAGAGGAGAGGG + Intergenic
937815369 2:126244834-126244856 CTGGGAGGGAAGAGAGGCAGAGG + Intergenic
937859252 2:126695338-126695360 CTGTGAGGAAGAAAAAGAAAAGG + Intronic
937903201 2:127038272-127038294 CTGGGTGGGAGAAACCAAAGAGG - Intergenic
938025825 2:127946997-127947019 GAGAGAGAGAGAAAAGGAAGGGG + Intronic
938220659 2:129564464-129564486 CTGGTAGGGAGAAAGGAACGAGG - Intergenic
938266579 2:129932596-129932618 CTGGGAGGGAGTAAAGGGGAGGG + Intergenic
938325882 2:130400937-130400959 ATGGGAGGGAAATAATGAAGAGG + Intergenic
938325886 2:130401009-130401031 ATGGGAGGGAAATAATGAAGAGG - Intergenic
938371161 2:130769008-130769030 CCAGGAGGGAGAGAGGGAAGAGG + Intergenic
938423013 2:131158936-131158958 ATGGGAGGGAAATAATGAAGAGG + Intronic
938423017 2:131159008-131159030 ATGGGAGGGAAATAATGAAGAGG - Intronic
938617650 2:133016060-133016082 GTGGGAGAGAGAAAAGAAATAGG + Intronic
938701784 2:133886017-133886039 CTGGGAGGAAGGAAAGGAAAGGG - Intergenic
938840956 2:135162964-135162986 CCTGGCGGTAGAAAAGGAAGAGG - Exonic
939548705 2:143586932-143586954 GTTGGAGGGAGGAAAGGGAGAGG - Intronic
939644011 2:144674521-144674543 GTGGGAGGGAGAAAGGAAAATGG - Intergenic
940106110 2:150102182-150102204 CTTGCTGGGAAAAAAGGAAGAGG - Intergenic
940830302 2:158457899-158457921 CTGGCAGGGAGAGGAGGAAGCGG - Intronic
940923142 2:159331976-159331998 CTGGAAGGGAAGAAAGGAGGTGG + Intronic
940996811 2:160158667-160158689 CTAGTAGGAAGAAAATGAAGGGG + Intronic
941134826 2:161701723-161701745 CTAGGAAGGGTAAAAGGAAGGGG - Intronic
941220929 2:162779883-162779905 TTGAGAGGGGGAAAAGTAAGAGG - Intronic
941234007 2:162946586-162946608 AGGGGAGGGGGAAAGGGAAGGGG + Intergenic
941297152 2:163753754-163753776 CTTGTTGGCAGAAAAGGAAGGGG - Intergenic
941320289 2:164046322-164046344 ATTAGAGGGAGAAAGGGAAGAGG + Intergenic
941488584 2:166114053-166114075 CTGGAAGGGAGGTAAGGAAGTGG - Intronic
941591151 2:167422137-167422159 GGAGGAGGGAGGAAAGGAAGAGG + Intergenic
941735007 2:168964551-168964573 CAGGGAGGGAGAAAGAGAAAGGG + Intronic
942352709 2:175069579-175069601 GTGGGAGGGTGAGTAGGAAGTGG + Intergenic
942965848 2:181891890-181891912 GAGGGAGGGAGGGAAGGAAGGGG - Exonic
943055614 2:182974635-182974657 CTAGGAGAGAGAGATGGAAGAGG + Intronic
943470968 2:188292760-188292782 CTGGGAGGGCCCAAAGGAAGGGG + Intronic
943521945 2:188962340-188962362 GAGGGAGGGAGGAAAGGGAGAGG + Intergenic
943683192 2:190789359-190789381 CATGGAGGAAGAAAAGGAAAAGG + Intergenic
944062456 2:195583707-195583729 CTGGAAGGGAGAAACAGACGAGG - Intronic
944822430 2:203444043-203444065 AAGGAAGGGAGAGAAGGAAGGGG + Exonic
944916022 2:204361110-204361132 CAGGGAGGAAGAAAGGAAAGGGG - Intergenic
944987870 2:205199317-205199339 CAGGGAGGAAGAAAGGGAAGAGG + Intronic
945021962 2:205582725-205582747 TTGGGAGCTAGTAAAGGAAGTGG + Intronic
945047774 2:205797272-205797294 ATGGGAGGGTGAAGAGGAAAAGG - Exonic
946201334 2:218072551-218072573 CAGGGTGGGGGAAAAGGAGGAGG - Intronic
946327165 2:218990683-218990705 CTGGAAGGGAGGAAATGAGGAGG - Intronic
946426125 2:219598071-219598093 CTGGGGGGGGAAAGAGGAAGCGG - Intronic
946498389 2:220219274-220219296 ATGGAAGGGAGAAAAAAAAGAGG - Intergenic
946553089 2:220823853-220823875 GAGGGAGGAAGAAGAGGAAGGGG - Intergenic
946734810 2:222743658-222743680 CTGGAGCGAAGAAAAGGAAGTGG - Intergenic
946915883 2:224520822-224520844 TTGGTAGGGTGAAGAGGAAGAGG - Intronic
947196939 2:227577468-227577490 ATGGCAGTGAGAAAAGAAAGGGG + Intergenic
947624823 2:231612908-231612930 CTGGGAGGGAGAAGGGAAGGGGG + Intergenic
947651419 2:231789498-231789520 CTGTGAGGATGAAGAGGAAGGGG - Intronic
947724490 2:232388501-232388523 CTCGGCGGCAGAAAAGGCAGCGG - Intergenic
947944839 2:234092660-234092682 CTGCGAAGGGGAAAAGGAGGTGG + Intergenic
948113924 2:235479723-235479745 CTGGGATGAGGAAGAGGAAGAGG - Intergenic
1168949881 20:1790013-1790035 GTGGGAGGGAGAATAGGATTTGG + Intergenic
1168973193 20:1945008-1945030 GTGGGAAGGAAGAAAGGAAGGGG + Intergenic
1169170833 20:3463652-3463674 CTGGGAGGCAGAAATGAAAAAGG - Intergenic
1169213211 20:3778919-3778941 CCGGGAGGGAGAAATGGAAAAGG + Intronic
1169554212 20:6732209-6732231 CTGGCAGGGGGGAAAGGGAGAGG + Intergenic
1169601718 20:7268780-7268802 CTGGGAAGGGTAATAGGAAGTGG - Intergenic
1169812204 20:9619701-9619723 CTGGAAGGAAAAATAGGAAGAGG - Intronic
1169818467 20:9683505-9683527 CAAGGAGGAAGAAAAAGAAGAGG - Intronic
1170134269 20:13055776-13055798 CTGTGAGGCAGAGAAGGAAATGG + Intronic
1170301703 20:14891064-14891086 GAAGGAAGGAGAAAAGGAAGGGG - Intronic
1170731864 20:18982980-18983002 GTGGGAGGGATTACAGGAAGAGG + Intergenic
1170883860 20:20321285-20321307 CTAGGAGGGAGAAGAGTAGGAGG + Intronic
1170915887 20:20625041-20625063 CAGGCAGGCAGAAAAGCAAGAGG - Intronic
1171201538 20:23245998-23246020 GAGGGAGGGAGAGAAGGAGGTGG + Intergenic
1171267731 20:23785936-23785958 CTGGGTGGTAGACAAGCAAGTGG - Intergenic
1171946870 20:31386665-31386687 TGGGAAGGGAGAATAGGAAGAGG + Intronic
1172182572 20:33012590-33012612 CTGGTAGGGAGAACATGCAGAGG - Intronic
1172198143 20:33106160-33106182 CAGGAAGAGAGAAAAAGAAGTGG - Intronic
1172231821 20:33341812-33341834 CTGGCAGGGAGAAAGTGCAGGGG + Intergenic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1172509544 20:35490861-35490883 CTTGGGAGTAGAAAAGGAAGTGG - Intronic
1172571690 20:35975662-35975684 AAAGGAGAGAGAAAAGGAAGGGG - Intronic
1172752321 20:37259436-37259458 CTGGGAGACAGAAAAGGCAGTGG - Intronic
1172834979 20:37867642-37867664 GGGAGAGGGAGAAAAGGATGAGG - Intronic
1173037645 20:39428082-39428104 GGGGGAGGGAGAAAGGGAGGGGG - Intergenic
1173044297 20:39494598-39494620 ATGGGAGAGAAATAAGGAAGGGG + Intergenic
1173150906 20:40565862-40565884 CTGGGTGGGAGGACAGGATGAGG + Intergenic
1173310988 20:41895629-41895651 CTGAGAGGGAGAAAGGGGAGGGG + Intergenic
1173313105 20:41917846-41917868 AGGGAAGGGAGAAAAGGGAGGGG - Intergenic
1173313662 20:41923741-41923763 CTGGGAGGGAAAGAAGGAGTAGG + Intergenic
1173375812 20:42482154-42482176 GAGAGAGGGAGAAAAGGGAGCGG + Intronic
1173423143 20:42920438-42920460 AAGAGAGGGAGAGAAGGAAGGGG + Intronic
1173530939 20:43769175-43769197 CAGGGAGGGAGGAAGGGAGGAGG + Intergenic
1173572590 20:44087151-44087173 CGGGGAAGGAGAGAAGGAGGGGG - Intergenic
1173582765 20:44159299-44159321 CTGGGTGGGTAAACAGGAAGTGG + Intronic
1173584345 20:44170955-44170977 CATCGAGGGAGAAAAGGATGTGG - Intronic
1173716526 20:45211600-45211622 AAGGGAGGGAGGGAAGGAAGGGG + Intergenic
1173948835 20:46974449-46974471 TTGGGATGAAGGAAAGGAAGAGG + Intronic
1174109135 20:48185805-48185827 CAGGAAGGGTGCAAAGGAAGAGG - Intergenic
1174130217 20:48339171-48339193 CTGGGAGGGTTACAAAGAAGGGG + Intergenic
1174151863 20:48491728-48491750 CTGGGAGGGAGAGAAAGTGGGGG - Intergenic
1174241073 20:49135159-49135181 TTGGGTGGGAGAAAAGAAAGTGG + Intronic
1174777698 20:53360951-53360973 CCCAGAGGGAGAAAAAGAAGAGG - Intronic
1174857710 20:54062906-54062928 CTGGGTGGGACAAAAGCAAAAGG + Intronic
1174998915 20:55604467-55604489 CAGGCAGGAAGAAAAGGAGGAGG - Intergenic
1175007460 20:55700517-55700539 CTGGCAGGGAGAAGGGGTAGAGG + Intergenic
1175093771 20:56525546-56525568 CTTTCAGGTAGAAAAGGAAGGGG + Intronic
1175298865 20:57928705-57928727 GGGGGAGGAAGAAAAGGAGGAGG - Intergenic
1175657786 20:60786972-60786994 GAGGAAGGGAGAAAAGGAGGGGG - Intergenic
1175715244 20:61251203-61251225 CTGGGAGGGAGAGAGGGAAGCGG + Intergenic
1175831606 20:61967704-61967726 AGGGGAGGGGGAAAAGGGAGGGG - Intronic
1175955399 20:62606501-62606523 CAGGAAGGGAGGAGAGGAAGGGG + Intergenic
1176222105 20:63974604-63974626 CTGGGAGGGTGTAAGGGGAGTGG + Exonic
1176268881 20:64225138-64225160 GTCGGAGGGAGGAAAGGAAGTGG - Intronic
1177186859 21:17806887-17806909 GTGGGAGGTAGAAAAGACAGAGG + Intronic
1178226494 21:30725325-30725347 TGGGGAGGGAGAAAAGGAGGAGG + Intergenic
1178737490 21:35166283-35166305 GAGGGAGGGAGGGAAGGAAGGGG + Intronic
1178744239 21:35232339-35232361 AAGGGAAGGAGAGAAGGAAGGGG - Intronic
1178805361 21:35834705-35834727 CTGGGGGCCAGAAGAGGAAGAGG - Intronic
1178856243 21:36252895-36252917 GTGGGAGGGAACAAAGGAAGAGG - Intronic
1178920775 21:36736741-36736763 GAGGGAGGGAGGAAAGGAAAGGG - Intronic
1179396212 21:41042767-41042789 GAGAGAGGGAGAGAAGGAAGAGG - Intergenic
1179428968 21:41305213-41305235 CAGGGAGATAGAAAAGAAAGTGG + Intronic
1180129237 21:45816427-45816449 CGGGGAGGGGGAAGGGGAAGGGG - Intronic
1180458087 22:15530737-15530759 CTGGAAAGGAGTAAAGAAAGAGG - Intergenic
1180465318 22:15604944-15604966 CTGGGAGGGACTAAAGGAGAGGG - Intergenic
1180857277 22:19056466-19056488 CTGTGATGGTGAAGAGGAAGGGG + Intronic
1181533921 22:23532147-23532169 CTGAGGGAGAGAAAAGGAAAAGG + Intergenic
1181534181 22:23533232-23533254 GGGGGAGAGAGAAAAGGAAGAGG + Intergenic
1181620740 22:24089517-24089539 CAGGGAGGGAGGGAAGGTAGGGG + Intronic
1181663369 22:24370918-24370940 GGGGGAGGGAAAAAAGAAAGGGG + Intronic
1181789210 22:25250477-25250499 AAGGGAGGGAGGAAAGAAAGGGG - Intergenic
1181861129 22:25819002-25819024 GAGGCAGGGAGAAAAGGAACTGG - Intronic
1181896550 22:26113199-26113221 GTGGGAGGAAGAAAGAGAAGGGG + Intergenic
1182103300 22:27672101-27672123 AAGGGAGGGAGGGAAGGAAGGGG + Intergenic
1182162900 22:28140952-28140974 GGAGGAGGAAGAAAAGGAAGAGG + Intronic
1182496751 22:30714058-30714080 CTGGGAAGGATAGAGGGAAGTGG - Intronic
1182497320 22:30718743-30718765 CTGGCAGGGGGAAAAAAAAGGGG - Intronic
1182835424 22:33337802-33337824 CTGGCAGGGAGATAAGGAAGTGG + Intronic
1183145062 22:35982594-35982616 GTGGGTAGGAGAAAAGGAAATGG + Intronic
1183162916 22:36126806-36126828 AAGGGAGGGAGGGAAGGAAGGGG - Intergenic
1183251852 22:36735847-36735869 GTGGGAGGGAGAAAACAGAGAGG + Intergenic
1183328158 22:37205469-37205491 GAGGAAGGGAGAAGAGGAAGAGG - Exonic
1183529824 22:38347331-38347353 GTGGGAGGGGGAAACGGAAGAGG + Intronic
1183630408 22:39029194-39029216 CTGGGAGAGAGAAAGAGGAGGGG - Intronic
1183633869 22:39049280-39049302 CTGGGAGAGAGAAAGAGGAGGGG - Intronic
1183741924 22:39673557-39673579 CTGGCAGGCAGAAGAGCAAGAGG - Intronic
1184001182 22:41674737-41674759 GAGGGAGGGAGGAAAGGAAGGGG + Exonic
1184549277 22:45195940-45195962 CTCTGTGGGGGAAAAGGAAGAGG - Exonic
1184600214 22:45539069-45539091 ATGGGAGGGGGAAGAGGAGGAGG - Intronic
1184836155 22:47022326-47022348 CTGGGAGGGAGGAAAAGTACAGG + Intronic
1184864619 22:47195401-47195423 CTGGGAGGGAGAGAAAGGAGCGG - Intergenic
1184890965 22:47379015-47379037 GGAGGAGGAAGAAAAGGAAGAGG + Intergenic
1185083785 22:48724877-48724899 ATGGCAGGGAGGAAAGGCAGTGG + Intronic
1185088342 22:48752672-48752694 CTGGGAGGGAGGGCAGGAGGCGG + Intronic
1185202468 22:49516669-49516691 ATGGGAGGGAGAGAGGGAGGAGG + Intronic
949436750 3:4038149-4038171 CTTGGAGGCAGCAGAGGAAGAGG + Intronic
949454332 3:4222826-4222848 CTGGAAGGGAGGCAAGCAAGAGG + Intronic
950119398 3:10471570-10471592 GAGGGAGGGAGGAAAGGAGGCGG + Intronic
950657799 3:14447873-14447895 CAGGGGAGGAGATAAGGAAGTGG - Intronic
950805656 3:15601244-15601266 CCGGGAGGGAGGGAAGGATGTGG - Intronic
950852064 3:16071331-16071353 CTGTGGGAGAGAAAAGGGAGTGG - Intergenic
950924221 3:16724069-16724091 TTGGGAGGTAGAAAAGGAAAAGG - Intergenic
951336256 3:21425715-21425737 AAGGGAGGGAGAGAAGGAGGTGG + Intronic
951354975 3:21654934-21654956 GTGGGAGGGAGATGTGGAAGAGG + Intronic
951482451 3:23175940-23175962 CTAGGAAGCATAAAAGGAAGGGG - Intergenic
951491612 3:23275723-23275745 CTGGGAGGGAGAGTTGAAAGAGG + Intronic
951520879 3:23609846-23609868 GAGGAAGGGAGAAAGGGAAGCGG + Intergenic
951703870 3:25524606-25524628 CAGGGAGGGAGGAAGGGAGGGGG - Intronic
951867530 3:27324684-27324706 ATGTGAGAGAGTAAAGGAAGGGG - Intronic
952171590 3:30812916-30812938 CGGGGAAGAAGAGAAGGAAGGGG + Intronic
952253000 3:31672422-31672444 TAGGGAGAGAGAGAAGGAAGGGG + Intronic
952259191 3:31723255-31723277 CTGAGAGAGAGAAAAGACAGTGG + Intronic
952455159 3:33465837-33465859 ATGTGAGGGAGAGAAGGAAGAGG + Intergenic
952713166 3:36452781-36452803 CTGGGAAGTAGCAAAGGAAAGGG + Intronic
952996372 3:38886930-38886952 CTTGGAGGGGAAAGAGGAAGAGG - Intronic
953033762 3:39193912-39193934 GAGGGAGGGAGACCAGGAAGAGG - Intergenic
953039495 3:39242704-39242726 GTGGGAGGAGGAAAAGGAACAGG + Intergenic
953367183 3:42354821-42354843 GGAGGAGGGAGAAAAGGAGGAGG - Intergenic
953453022 3:43019806-43019828 CTGGGTGGGAGAAGGGGTAGAGG - Intronic
953818873 3:46187126-46187148 TTGAGAGGGAGAAAAAAAAGGGG - Intronic
953938969 3:47073545-47073567 GTGAGAGGGAGAAGAGGAAAAGG + Intronic
953991378 3:47486176-47486198 CTGGGAGTGAGAATGGAAAGGGG - Intergenic
954167712 3:48773706-48773728 ATGGGGGGAAAAAAAGGAAGGGG - Intronic
954287489 3:49629377-49629399 GTGGGAGGGAGACAAGGCATGGG + Intronic
954558351 3:51535903-51535925 CTGGGAGGAGGGAATGGAAGAGG + Intergenic
954796541 3:53164176-53164198 CTGGGAGGAAGAAATGGCAAAGG - Intronic
954865744 3:53728022-53728044 CTGGGTGGGAGACAGGGCAGGGG - Intronic
955307468 3:57848631-57848653 GGAGGAGGAAGAAAAGGAAGAGG - Intronic
955475111 3:59328503-59328525 CTGGGAGGTAGACAAGGCAGGGG + Intergenic
955670232 3:61394380-61394402 GAGGGAGGGGGAAAAGGAGGGGG + Intergenic
955893054 3:63670579-63670601 CTAGAAGGGAGAATAAGAAGAGG + Intronic
955931579 3:64062781-64062803 TTAGGAGAGAGGAAAGGAAGTGG + Intergenic
956414226 3:69010765-69010787 CTGTGAGAGAGCAAAGGGAGTGG + Intronic
956529526 3:70202390-70202412 TCTGGAGGGACAAAAGGAAGAGG + Intergenic
956611967 3:71133409-71133431 CTGAAAGGGAGAGGAGGAAGAGG - Intronic
956849708 3:73217734-73217756 GAGGGAGGGAGAAAAGGGAGGGG - Intergenic
956968233 3:74489403-74489425 GAGGGAGGGAGGAAGGGAAGGGG - Intronic
957067947 3:75541280-75541302 CTGGGGTGGAGGAAAGGTAGGGG + Intergenic
957388715 3:79533109-79533131 CCTGGAGGGAGAATAGGGAGAGG + Intronic
957717846 3:83954353-83954375 ATGAGAGGAAGAGAAGGAAGGGG + Intergenic
957892596 3:86379244-86379266 CTGAGAAGGAGACAAAGAAGGGG + Intergenic
958080457 3:88740156-88740178 GGGGGAGGGAGAAGAGGAAAAGG - Intergenic
958474537 3:94564195-94564217 CTGAAAGGAAGAAAAGGAAGAGG + Intergenic
958702695 3:97614802-97614824 CTGGGAGCAAGAAAAGTGAGTGG + Intronic
958712613 3:97736327-97736349 TGGAGAGAGAGAAAAGGAAGGGG - Intronic
958855058 3:99375266-99375288 CTAAGAGTGAGAAAATGAAGGGG - Intergenic
958855745 3:99382963-99382985 GAGGGAGGAAGAAAAGAAAGAGG + Intergenic
958974873 3:100656571-100656593 GTGTGGGGGAGAAAAGAAAGTGG + Intronic
959146915 3:102557714-102557736 CAGGGTGGCAGAAATGGAAGAGG - Intergenic
959627664 3:108471101-108471123 GAGGGAGGGGGAAAATGAAGGGG + Intronic
959901719 3:111669226-111669248 GTGGGAAGGAGAAATGGAAGAGG + Intergenic
960850955 3:122053124-122053146 CTGGGAGGGAGCACAGGCTGGGG + Intergenic
960914029 3:122679530-122679552 CTGAAAGGGAGGGAAGGAAGTGG - Intergenic
960998445 3:123354689-123354711 CTGGGAGGAAGAAGAAGATGAGG + Intronic
961110543 3:124279632-124279654 CTAGCAGGGAGAAAAGGAAATGG + Intronic
961254192 3:125533171-125533193 AGGGGAGGAAGAGAAGGAAGGGG - Intronic
961285214 3:125796703-125796725 CTGGGGTGGAGGAAAGGTAGGGG - Intergenic
961737346 3:129010495-129010517 CTGGGATGGAGGAAAGGGGGTGG + Intronic
961798187 3:129424917-129424939 CTGGGAGGGCATCAAGGAAGAGG + Intronic
962010193 3:131384157-131384179 CATGGAGAGAGAAAAAGAAGAGG + Intronic
962038665 3:131682465-131682487 TTGGGAGAAAGTAAAGGAAGAGG - Intronic
962210312 3:133472057-133472079 GAGGGAGGGAGAAAAGAAAGGGG - Intronic
962642884 3:137406731-137406753 GGGGGAGGGAGAAAAGGAGAGGG + Intergenic
963076253 3:141349124-141349146 GAGTGAGGGAGAAAAGGTAGAGG - Intronic
963267197 3:143251311-143251333 GTAGGAGGGAGAAAGAGAAGGGG + Intergenic
963848373 3:150182431-150182453 CTGAGAGGACGAAGAGGAAGAGG + Intergenic
963870354 3:150408915-150408937 GTGGGAGGGCGAAGAGGAGGAGG - Exonic
964164435 3:153685385-153685407 CTGAAATGGAGAAAAGGAGGAGG - Intergenic
964434179 3:156634888-156634910 CTTGGAGGGGGAACAGGGAGAGG - Intergenic
964570621 3:158105246-158105268 CCGGGAGGGAGAAGGGGCAGAGG - Intronic
964593763 3:158398083-158398105 ATGGGAGAGAGAAAGGGTAGAGG + Intronic
964833342 3:160910274-160910296 CGGGGAAGGGGAAAGGGAAGGGG - Intronic
965599387 3:170440539-170440561 CTGGGAGCCAGAAAAGTAAAGGG + Intronic
965699258 3:171442825-171442847 GGGGGAGGGGGAAAGGGAAGAGG - Intronic
965729949 3:171761185-171761207 TTGGGAGGGAGCAGAGCAAGTGG + Intronic
966268921 3:178081622-178081644 TTTGGAGGGAGAAAGGGATGGGG - Intergenic
966332760 3:178833563-178833585 TTGGGAAGGATAACAGGAAGGGG - Intronic
966461476 3:180181654-180181676 CAGGGAGGGAGGGAAGGGAGGGG - Intergenic
966567433 3:181398605-181398627 CTGGGGTAGAGACAAGGAAGAGG + Intergenic
966602733 3:181791099-181791121 GAGGGAGGGAGGGAAGGAAGGGG + Intergenic
967102549 3:186228290-186228312 CAGGGGGAGAGAGAAGGAAGAGG - Intronic
967202495 3:187084875-187084897 CAGGGAGGGATGGAAGGAAGGGG - Intergenic
967464330 3:189785837-189785859 CTAGCAGGGAGGAAAGAAAGTGG + Intronic
967502199 3:190211494-190211516 CTGTGATGGAAAAATGGAAGAGG + Intergenic
967631760 3:191751792-191751814 CTAGGAGGTAGAAAAAGAATTGG - Intergenic
967676501 3:192305438-192305460 CTGGGAGGCAGAGAAGGAGTGGG - Intronic
967937028 3:194737192-194737214 AGCGGGGGGAGAAAAGGAAGGGG - Intergenic
968045208 3:195620076-195620098 GTCGGAGGGACAGAAGGAAGAGG - Intergenic
968046428 3:195626220-195626242 CTGGGAAGGAGAGAAAGAATAGG - Intergenic
968061060 3:195726419-195726441 GTCGGAGGGACAGAAGGAAGAGG - Exonic
968165290 3:196459936-196459958 CTAGGAAGGAGGAAAGGAAAAGG + Intergenic
968308225 3:197663871-197663893 CTGGGAAGGAGAGAAAGAATAGG + Intergenic
968312771 3:197697677-197697699 CTGGGAGGGAGAACAGTAGCAGG + Intronic
968381458 4:100310-100332 ATGTGAGGGAGAGAAGGAAGAGG - Intergenic
969149865 4:5160454-5160476 TGGGGAGGGGGAGAAGGAAGGGG - Intronic
969472363 4:7396616-7396638 CGGGGAGGAAAAAAAGGAAGCGG - Intronic
969495339 4:7523116-7523138 CTGGAAGGAAGAAAGGGAGGAGG - Intronic
969506451 4:7591169-7591191 GTGGGAGGAGGAAGAGGAAGTGG - Intronic
969741567 4:9031881-9031903 CTGGGGTGGAGGAAAGGTAGGGG - Intergenic
969800936 4:9564784-9564806 CTGGGGTGGAGGAAAGGTAGGGG - Intergenic
969881657 4:10179204-10179226 GAGGGAGGGGGAAAAGGTAGAGG + Intergenic
970146586 4:13042451-13042473 CTGGTAGGGAAAAAGGGAACAGG - Intergenic
970384712 4:15544485-15544507 CAGGCAGGAAGGAAAGGAAGTGG + Intronic
970444553 4:16112781-16112803 GAGGGAGGGAGGAAAGGAACAGG + Intergenic
970447986 4:16139919-16139941 TTGGAAGAGAGAAAAGAAAGAGG + Intergenic
970559107 4:17265620-17265642 GTGGAAGGGAGAAAAGAATGGGG - Intergenic
970903299 4:21185402-21185424 CAGAGAGGAAGAAGAGGAAGAGG - Intronic
971218101 4:24680635-24680657 ATGGGAGGGAGAGAAGGAGCAGG + Intergenic
971293855 4:25371741-25371763 CTGGGAGGTAGAATGTGAAGCGG + Intergenic
971365303 4:25972243-25972265 GTGGGTGGGAGAAAAGGGAGGGG + Intergenic
971607941 4:28683233-28683255 TTTGTAGGAAGAAAAGGAAGGGG - Intergenic
971900504 4:32651933-32651955 CTGAGATGGAGAACAGAAAGTGG + Intergenic
972314605 4:37914470-37914492 CTGTAATGGAGCAAAGGAAGTGG - Intronic
972359876 4:38316859-38316881 CAACAAGGGAGAAAAGGAAGAGG + Intergenic
972509777 4:39757822-39757844 CTGGGAGTGAGCATAGGAAAGGG - Intronic
972836427 4:42876119-42876141 CAGAGAGGCAGAGAAGGAAGAGG + Intergenic
973067244 4:45811043-45811065 CTGGGAAGAAGAAGGGGAAGGGG - Intergenic
973254144 4:48092087-48092109 CTGAGAGAGAGAAAAGAAAGAGG + Intronic
973594177 4:52468685-52468707 GAAGGAGGAAGAAAAGGAAGAGG - Intergenic
973875941 4:55218589-55218611 CAGGTAGGGTCAAAAGGAAGAGG - Intergenic
974273333 4:59680890-59680912 CTGGGAGGGGGAAAAGATGGTGG + Intergenic
974592716 4:63974383-63974405 CTGGAAAGGAGAAAAATAAGAGG - Intergenic
974915136 4:68170306-68170328 CTGGGAAGGGTAAAGGGAAGGGG - Intergenic
975328420 4:73086314-73086336 TTGTGAGAGAGAAAAAGAAGAGG + Intronic
975328426 4:73086425-73086447 CTGTAAGAGAGAAAAAGAAGAGG - Intronic
975393098 4:73842974-73842996 AAGGGAGGGAGAGAAGGAAAGGG - Intronic
975497098 4:75046906-75046928 CTGGAGGGGAGAACAGGTAGGGG - Exonic
975633286 4:76422722-76422744 CTTGGAGAGGGAAAAGGAGGGGG - Intergenic
975864018 4:78707406-78707428 GTGGGAGGAAGAAGAGGAGGAGG - Intergenic
976111600 4:81680604-81680626 ATGGGATGGAGAAAAGCAGGTGG + Intronic
976446469 4:85135633-85135655 CTGGGTGGGGGAAAGGGAGGGGG + Intergenic
977232900 4:94473228-94473250 ATGAGAGGGAGAATAGTAAGAGG + Intronic
977584570 4:98760635-98760657 GTGAGTGGGAGACAAGGAAGTGG - Intergenic
978121418 4:105083761-105083783 AGGGGTGGGAGAGAAGGAAGAGG + Intergenic
978354195 4:107853439-107853461 GGGGGAGGGAGAAAAGGAGTGGG - Intronic
978457303 4:108908350-108908372 CTAGGAGGGAGGGAAGAAAGAGG - Intronic
978840582 4:113207420-113207442 CTTGTAGGGAGAAAAGTAAATGG + Intronic
978916652 4:114133016-114133038 CTTGTGGAGAGAAAAGGAAGTGG - Intergenic
978926452 4:114251698-114251720 CTGGGATGCAGAAAAGCAAAGGG + Intergenic
979145602 4:117243374-117243396 GTGGGAAGCAAAAAAGGAAGAGG - Intergenic
979166561 4:117539856-117539878 CTGTGCAGGAGAAAAGGTAGTGG + Intergenic
979385014 4:120054543-120054565 CTGTGAGGGAGAAGAGGGTGGGG - Intergenic
979569092 4:122195010-122195032 CAGGGAAGGAGAAGAGGAAACGG - Intronic
979912748 4:126390326-126390348 AGGGGAGGGAGAAATGGAAATGG - Intergenic
979921694 4:126503933-126503955 CCGGAAGGGAGGTAAGGAAGTGG - Intergenic
980145143 4:128973455-128973477 GTGGGAGGGAGGAGAGGGAGAGG + Intronic
980555129 4:134393946-134393968 CTGGGAAGGAGAAAGACAAGCGG - Intergenic
980680705 4:136155820-136155842 CTGGGAGTGATAGAAGCAAGAGG - Intergenic
980757487 4:137184801-137184823 GTGGGAGGGAGGAAGGGAATGGG - Intergenic
981424872 4:144591631-144591653 CTGGGAGAGAGAGAAGGGTGTGG - Intergenic
981489941 4:145328435-145328457 GAGGGAGGGAGGGAAGGAAGAGG + Intergenic
981800446 4:148649032-148649054 GGGGGAGGGAGGGAAGGAAGGGG + Intergenic
982097924 4:151940201-151940223 CTGGGGGGGAGAACAGCAAATGG - Intergenic
982546088 4:156734761-156734783 AATGGAGGGAGAAAAGGAGGAGG + Intergenic
983026452 4:162743495-162743517 CTCAGAAGGAGAAAAGGAAAAGG - Intergenic
983426499 4:167590268-167590290 CTCAGAAGGAGAGAAGGAAGAGG + Intergenic
984106993 4:175559958-175559980 GAGGGAGGGAAAGAAGGAAGAGG + Intergenic
984330546 4:178310149-178310171 CTGGAAGAGAGAGAATGAAGAGG - Intergenic
984443009 4:179797236-179797258 ATGAGAGAGAGAGAAGGAAGAGG + Intergenic
984519744 4:180787371-180787393 CAGGTAGGGAGAAATGCAAGGGG + Intergenic
984911342 4:184676697-184676719 AAGGGAAGGAGAAAGGGAAGGGG - Intronic
985286916 4:188345105-188345127 TAAGGAGGGACAAAAGGAAGCGG + Intergenic
985446530 4:190023826-190023848 GAGGGAGGGAGAGAAGGAGGAGG - Intergenic
985561458 5:588582-588604 CTGTGTGGGTGAAAATGAAGTGG + Intergenic
986091375 5:4511848-4511870 GTGGAAGAGAGAGAAGGAAGTGG - Intergenic
986282815 5:6337412-6337434 CAGGGAGAGAGAAAAGTTAGAGG - Intergenic
986284643 5:6350434-6350456 CTGGGAGGGAGGGAGGGAAGGGG + Intergenic
986609439 5:9551936-9551958 CTGGGTGGGAGAAAGGGAGAGGG - Intergenic
986744094 5:10729372-10729394 GTGGGAGGTAGGAAATGAAGGGG - Intronic
987394825 5:17413203-17413225 CTGGGAAGGATAAAGGGGAGAGG - Intergenic
987740530 5:21903185-21903207 CTGGGAAGCAGAAAAATAAGTGG + Intronic
987808654 5:22804382-22804404 CTGTGAGAGAGAGAAGGATGGGG + Intronic
987910159 5:24132469-24132491 CAGGGAGGGAGAGGAGGAGGTGG + Intronic
988181682 5:27803189-27803211 CTGGGAGAGTGAACAGGTAGAGG - Intergenic
988707847 5:33743155-33743177 TGGAGAGGCAGAAAAGGAAGGGG + Intronic
988801150 5:34698054-34698076 AAGGGAGGGAGAAAGGGGAGGGG - Intronic
988905246 5:35781364-35781386 TTTGGAGGGAGAAATTGAAGAGG + Intronic
989069615 5:37497147-37497169 GAGGGAGGGAGTGAAGGAAGGGG - Intronic
989119468 5:37990066-37990088 TTGGGAGGGAGAGAAGCAAGGGG - Intergenic
989141576 5:38206793-38206815 CTGGGAGGGAAAATAAGAAAAGG - Intergenic
989194039 5:38698771-38698793 CTGGGAGACAGAATGGGAAGAGG - Intergenic
989261346 5:39423161-39423183 CTGGGAGTGGGAAAAGAAGGGGG + Intronic
989983175 5:50666928-50666950 CTGGGTGAGAGAAGAGGAGGAGG - Exonic
990008197 5:50966522-50966544 CAGGGAGGAAGGAAAGGAAGAGG + Intergenic
990012865 5:51021323-51021345 CTGTCAGGGAGAAAGGGAAAAGG - Intergenic
990081578 5:51922424-51922446 ATGGGAGGCAGAAATGGAACTGG + Intergenic
990224526 5:53634619-53634641 CAGGGAAGGAAAAAGGGAAGAGG - Intronic
990299236 5:54434112-54434134 CTGTGAAAGAGAAGAGGAAGAGG + Intergenic
990370529 5:55113972-55113994 ATGGGAGGAAGAAGAGGAGGGGG + Exonic
990524413 5:56610591-56610613 CTGGGTTGAAGCAAAGGAAGGGG - Intergenic
990544871 5:56813675-56813697 CTGTAAGTGAGAAAAGTAAGTGG - Intergenic
990615188 5:57500668-57500690 ATGGGAAGGAGAAAAGCAAAAGG + Intergenic
990637322 5:57743540-57743562 GTGGGATGGAGAAGAGGAGGTGG + Intergenic
991175674 5:63685159-63685181 GGCTGAGGGAGAAAAGGAAGAGG - Intergenic
991775114 5:70077133-70077155 TTGGGAAAGAAAAAAGGAAGTGG + Exonic
991854407 5:70952553-70952575 TTGGGAAAGAAAAAAGGAAGTGG + Exonic
991937704 5:71818140-71818162 GTGGGAGGCAGAAGAGGTAGGGG + Intergenic
992040588 5:72827028-72827050 AGGGTAGAGAGAAAAGGAAGAGG + Intronic
992150832 5:73901192-73901214 ACAGGAGGGAGAGAAGGAAGAGG + Exonic
992361263 5:76041038-76041060 CTGGGAGGGGCAGAAGGGAGAGG + Intergenic
992766219 5:80003102-80003124 CTGGGATGGAGAAAGGGTAGGGG + Intronic
992783344 5:80147676-80147698 GTGGGAGGGAGAAGGGGAAGGGG - Intronic
992799302 5:80281365-80281387 CTGGGAAGGGGTGAAGGAAGAGG + Intergenic
992882889 5:81128127-81128149 CTGGTGGGGAGGAAGGGAAGCGG + Intronic
993041729 5:82822314-82822336 CTGTGAGTTAGAAAGGGAAGAGG + Intergenic
993333767 5:86632074-86632096 CTGGGTGGGAAAGAAGGCAGAGG + Intergenic
993548448 5:89243309-89243331 GTAGGAAGGAGAAAAGTAAGTGG + Intergenic
993626187 5:90227641-90227663 CTAGGGGGCAGGAAAGGAAGGGG - Intergenic
993864878 5:93180866-93180888 ATTGGAGGGATAAGAGGAAGGGG + Intergenic
994203852 5:97010176-97010198 GAGGGAGGAAGAAAGGGAAGAGG - Intronic
994331937 5:98516517-98516539 CTGGGAAGGGTAAAGGGAAGGGG - Intergenic
995005840 5:107194487-107194509 GTTGGCGGGAGAAGAGGAAGAGG + Intergenic
995314451 5:110752325-110752347 CTGGGAGAGAGAACAGGGAAGGG - Intronic
995354634 5:111224135-111224157 CTGGGAGAGAGAAAGGAAAGAGG + Exonic
995400425 5:111734557-111734579 CTGGCAGGCAGAAACTGAAGAGG - Intronic
995658186 5:114450440-114450462 CTGGAAGTTAGAAAAGGAACAGG + Intronic
995685631 5:114769016-114769038 TTGGTAGGGAGAAAAGGGGGTGG - Intergenic
995808394 5:116079365-116079387 GAGGGAGGGGGATAAGGAAGGGG + Intergenic
996086815 5:119313387-119313409 GGTGGAGGGAGAGAAGGAAGGGG + Intronic
996416629 5:123217748-123217770 GAGGGAGGGAGAAAGGGAGGAGG + Intergenic
996699743 5:126438310-126438332 CAGAGAGGGAGAATATGAAGGGG + Intronic
997199737 5:132002640-132002662 CAGGGAGGGAGAACAAGGAGAGG + Intronic
997264856 5:132489683-132489705 CTGGGAGGGGCTGAAGGAAGGGG - Intronic
997396647 5:133565385-133565407 CTGGCAGGAAGAAAAGGAGTGGG - Intronic
997723939 5:136104712-136104734 CTGGGACGGAGGAAAAGAAAGGG - Intergenic
998071600 5:139202103-139202125 CTGGGTGGGCAAAGAGGAAGGGG - Intronic
998131170 5:139651682-139651704 CTAGGAGGGAGAGAGGGATGTGG + Intronic
998164574 5:139835700-139835722 CTGGGAGAGGGAAAAGAGAGAGG - Intronic
998170631 5:139870325-139870347 CAGGGAGGGGGAGAAGGAGGTGG + Intronic
998447544 5:142210446-142210468 CTGGGATGAAGAAAGAGAAGCGG + Intergenic
998532843 5:142901468-142901490 GAGGAAGGCAGAAAAGGAAGTGG - Intronic
998555647 5:143120965-143120987 CTGGGAGGAAGGAAAAGAAAAGG - Intronic
999226663 5:150030936-150030958 CTGGGAGGGAGAACAGGGTCAGG + Intronic
999397596 5:151239918-151239940 TTTGGAGGGGCAAAAGGAAGAGG + Intronic
999472120 5:151864293-151864315 CTAGCAGGAAGAAAAGAAAGTGG + Intronic
999476061 5:151899853-151899875 GTGGGAGGTAGGACAGGAAGGGG - Intronic
999717974 5:154377251-154377273 CTGAGAGGCAGACATGGAAGAGG + Intronic
999817375 5:155191057-155191079 CTGGGAGTGGGAATAGGAATGGG - Intergenic
1000141775 5:158411730-158411752 CTGGGAGGATAAAAAGCAAGAGG + Intergenic
1000177605 5:158773077-158773099 GAGGGAGGGAGGAAAGGATGAGG + Intronic
1000185136 5:158851556-158851578 AGGGGAGGGAAAAAGGGAAGGGG + Intronic
1000185143 5:158851574-158851596 AGGGGAGGGAAAAAGGGAAGGGG + Intronic
1000228252 5:159290688-159290710 CTGGAGAGGAGAAATGGAAGGGG - Intergenic
1000482884 5:161801818-161801840 ACGGAAAGGAGAAAAGGAAGGGG - Intergenic
1000753841 5:165132231-165132253 ATGGGAGGGAAAAAGGGAAAGGG - Intergenic
1000770311 5:165344805-165344827 GAAGGAGGGAGAGAAGGAAGGGG + Intergenic
1001136701 5:169108473-169108495 CTGGGTTGGAGGAAAGGTAGAGG + Intronic
1001227247 5:169955407-169955429 CTGGGAGGGAAGAAAGGAGGAGG + Intronic
1001525059 5:172423021-172423043 CTGGGAGGCAGAGGAGGCAGAGG - Intronic
1001672029 5:173481707-173481729 GTGGGAGGGAGGCAAGGAAGGGG - Intergenic
1001810756 5:174626545-174626567 CTGGGAGGAAGAAGAGGAGGTGG - Intergenic
1001919465 5:175588825-175588847 AAGGGAGGGAGGAAAGAAAGAGG + Intergenic
1001948499 5:175799433-175799455 CTGGAAGGTGGAAAAGGAAGGGG + Intronic
1002071607 5:176681710-176681732 CTGGGAGGCGGGACAGGAAGAGG - Intergenic
1002083095 5:176749016-176749038 CTGGAAGAGAAAAAAGGAAGGGG - Intergenic
1002094923 5:176824999-176825021 CTGGGAGGGAGGGAAGGAGAGGG - Intronic
1002337536 5:178490257-178490279 GAGAGAGAGAGAAAAGGAAGGGG + Intronic
1002660527 5:180788370-180788392 CTGTGAGGGTGGAGAGGAAGAGG - Intergenic
1003220610 6:4157735-4157757 CTGGGACTGAGAACAGCAAGGGG + Intergenic
1003425931 6:5998370-5998392 ATAGGAGGGAGAGAGGGAAGGGG - Exonic
1004131052 6:12920563-12920585 CTGGCAGGGAAAATAGGAACAGG - Intronic
1004300484 6:14453177-14453199 CTGGCAAGGAGAAAAGAAAGTGG - Intergenic
1004447043 6:15710110-15710132 ATGGGAAGGGGAAGAGGAAGGGG - Intergenic
1004483919 6:16047749-16047771 CTGTGAGAGAGAAAAGGCAAAGG + Intergenic
1004485650 6:16063741-16063763 AAGGGAGGGAGGGAAGGAAGAGG + Intergenic
1004546479 6:16603261-16603283 CTTGGAAGGAGAAAAGCCAGGGG - Intronic
1004637107 6:17479543-17479565 AAAGGAGGGAAAAAAGGAAGGGG + Intronic
1004683315 6:17917871-17917893 CTTGGAGGGTGGAAAGGAAATGG - Intronic
1004700022 6:18069979-18070001 CTGTGAGGGAAAAAAGGGAGAGG - Intergenic
1005443253 6:25894248-25894270 ATGAGAGGGAGAAAAAGAAGGGG - Intergenic
1005466649 6:26122586-26122608 CTGGGTGGGGGAGAATGAAGAGG - Intronic
1005721557 6:28607273-28607295 ACGGGAGGGAGAAAGGAAAGTGG - Intronic
1005964893 6:30720336-30720358 CTGAGAGGGAGAAAGGAGAGGGG - Exonic
1006000507 6:30961244-30961266 GAGGGAGAGAGAAGAGGAAGAGG - Intergenic
1006113289 6:31761724-31761746 TGGGGAGGGAGAAAAGGGAAGGG - Intronic
1006155334 6:32010348-32010370 CTAGGAGGGAAAGCAGGAAGAGG + Intergenic
1006161640 6:32043082-32043104 CTAGGAGGGAAAGCAGGAAGAGG + Intronic
1006174985 6:32116296-32116318 TTGGGAGGGAGACAAGGGTGAGG - Intronic
1006320247 6:33315684-33315706 GTGGGAGGGGGCATAGGAAGAGG + Exonic
1006725443 6:36196646-36196668 CAGGGAGGGAGCGAGGGAAGGGG + Intergenic
1006825953 6:36936689-36936711 CTGAGTGGCTGAAAAGGAAGGGG - Intergenic
1006887983 6:37398116-37398138 CTGGGGAGCAGACAAGGAAGTGG + Intergenic
1006918991 6:37615343-37615365 GAGGGAGGGAGAAAAGGGATGGG - Intergenic
1007208173 6:40169702-40169724 CTGGGGAGAAGAAATGGAAGAGG - Intergenic
1007282009 6:40719816-40719838 CTGGGAAGGAAAACAGGAAGTGG + Intergenic
1007301637 6:40872137-40872159 CTGGAGTGGTGAAAAGGAAGGGG - Intergenic
1007415868 6:41690918-41690940 CTGGGAGGGGGAAAAGGCAAGGG + Intronic
1007422634 6:41728775-41728797 CGGGGAGGGAGACAGGGCAGAGG + Intronic
1007752542 6:44079258-44079280 CTGTAAGGGAGAAAAGGAGGAGG - Intergenic
1008023393 6:46605664-46605686 TTTGGAGGGAGAAATGGGAGAGG - Intronic
1008111247 6:47497361-47497383 CAGGGAAGGAGAAGGGGAAGGGG - Intronic
1008304021 6:49878851-49878873 ATGGGAGGGAGAAAACACAGAGG - Intergenic
1008347081 6:50441160-50441182 CTGATAGGGTGAAATGGAAGAGG - Intergenic
1008367505 6:50699539-50699561 CAGGAAAGGAGAAAAGGAGGGGG + Intergenic
1008636025 6:53411973-53411995 GTGAGAGGGAGAGAAGGAAGAGG + Intergenic
1010153321 6:72762198-72762220 CTGGGGGGAAGGAAAGGAAAGGG + Intronic
1010167816 6:72938249-72938271 CTGGGAGGTAGGAATGGGAGTGG + Intronic
1010402188 6:75458622-75458644 CTGGGAGGAAGAGGAGGAATAGG + Intronic
1010571223 6:77476093-77476115 ATGTGAGGGAGAGAAAGAAGAGG - Intergenic
1010761362 6:79726926-79726948 TTTGGGGGGAGAAAAGAAAGAGG - Intergenic
1010844087 6:80683580-80683602 AAAGGAGAGAGAAAAGGAAGAGG - Intergenic
1010844154 6:80684135-80684157 TAGGGAGGGAGAAAATGTAGTGG + Intergenic
1010991048 6:82480218-82480240 CAGGGAGGAAGACAGGGAAGTGG + Intergenic
1011027167 6:82881677-82881699 CTGGGACAGAGAAAGAGAAGAGG - Intergenic
1011058062 6:83228436-83228458 TTGGAAGGGAGTAAAGGGAGGGG - Intronic
1011262154 6:85480956-85480978 CTGGGTGGGAGCTAATGAAGAGG - Intronic
1011262949 6:85487519-85487541 TAGGGAGGAAGGAAAGGAAGAGG + Intronic
1011844844 6:91551115-91551137 CTGAGAGTGAGGTAAGGAAGTGG + Intergenic
1011949132 6:92942591-92942613 GAGGGAGGGAGAAAAGGAGGTGG - Intergenic
1012423856 6:99093461-99093483 AAAGGAGGAAGAAAAGGAAGCGG + Intergenic
1013085790 6:106856406-106856428 CTGAGAAGGAAAGAAGGAAGGGG + Intergenic
1013292229 6:108729402-108729424 CTGGGAGGGAGGCAAGGATGTGG - Intergenic
1013842598 6:114415487-114415509 ACGGGAAGGAGGAAAGGAAGAGG - Intergenic
1014002988 6:116385515-116385537 AGGGAAGGGAGAAAAGGAGGGGG + Intronic
1014091967 6:117414169-117414191 ATGGAGGGGAGAGAAGGAAGAGG - Intronic
1014636688 6:123856158-123856180 CTAGGAGGAAAAAAAGGAAGGGG - Intronic
1014761311 6:125359755-125359777 GAGGGAGGGAGAACAGGAGGGGG + Intergenic
1015113357 6:129619264-129619286 AGGGGAGGGGGAAAAGAAAGAGG + Intronic
1015113466 6:129619535-129619557 AGGGGAGAGAGAAAAGGAAGGGG + Intronic
1015113477 6:129619566-129619588 AGGGGAGAGGGAAAAGGAAGGGG + Intronic
1015645577 6:135384718-135384740 CTGGGAGTCAGATAATGAAGTGG + Intronic
1015866031 6:137727667-137727689 CTTGGAGGGAGAAGTAGAAGGGG + Intergenic
1016199642 6:141393097-141393119 ATAGAAGGAAGAAAAGGAAGAGG + Intergenic
1016387233 6:143540286-143540308 CTGAAATGGAGAAGAGGAAGGGG + Intronic
1016437825 6:144056065-144056087 GTGGGATGGAGAAAGGGATGAGG - Intronic
1016461280 6:144282646-144282668 GAGGGAGGGAGGGAAGGAAGAGG - Intergenic
1016491816 6:144613210-144613232 GAGGGAGGGAGAGAAGGAAGGGG + Intronic
1016844039 6:148553710-148553732 CTGTGAGAGAGAAAGGGAGGAGG + Intergenic
1017052660 6:150408094-150408116 CTGGGAGAAAGACATGGAAGGGG - Intergenic
1017148183 6:151253632-151253654 CTGGGAGGGAGAGGGGGAATAGG + Intronic
1017163979 6:151391003-151391025 GTGGGAGGGAGGAAGGGGAGGGG - Intronic
1017484895 6:154893435-154893457 TTGGGAGGGAGAAAAAGAGGTGG - Intronic
1017567107 6:155699316-155699338 GTGGGAGGGAGGGAAGGAGGAGG - Intergenic
1017576181 6:155807231-155807253 AGAGGAGGGAGCAAAGGAAGAGG + Intergenic
1018611131 6:165648942-165648964 CTGGGATGGGGACAAGGATGGGG - Intronic
1018678124 6:166240924-166240946 CGGGGAGGGAGGGAGGGAAGCGG + Intergenic
1019144778 6:169969708-169969730 TTGGGAGGGAGGAGAGGAAAGGG - Intergenic
1019299275 7:295436-295458 CTGGGACCCAGAAAAGGAAGGGG + Intergenic
1019665960 7:2252488-2252510 CTGGGTGGCAGAGGAGGAAGGGG + Exonic
1019963999 7:4484333-4484355 CAGGGAGAGAGAATGGGAAGGGG + Intergenic
1020033185 7:4947364-4947386 GAGGAAGGGAGAGAAGGAAGAGG + Intronic
1020208560 7:6139800-6139822 CTGTGTGGGAGGAAAGGGAGCGG - Intronic
1020503351 7:8951933-8951955 GAGGGAGGGAGGGAAGGAAGAGG + Intergenic
1020667785 7:11069323-11069345 CTGGAAGGGAGATGGGGAAGGGG + Intronic
1020752311 7:12157589-12157611 GAGGGAGGGAGGAAGGGAAGGGG + Intergenic
1021648198 7:22807398-22807420 CAAGGATGGAGGAAAGGAAGAGG + Intergenic
1021968889 7:25949077-25949099 GTGGTAGGGAAAAAAGGAAATGG - Intergenic
1021981691 7:26061758-26061780 CTTGGAGGGGAAAAAGGAGGCGG + Intergenic
1022257554 7:28674416-28674438 CTGGGAGGAAAACCAGGAAGTGG - Intronic
1022327022 7:29341606-29341628 ATGGGAGGGAGAGAGGGAGGGGG + Intronic
1022673158 7:32474845-32474867 AAGGGAGGGAGAAAAGGAGGAGG + Intergenic
1023259314 7:38342288-38342310 CTGGGAATGAGAAAGGGAAGGGG + Intergenic
1023259773 7:38346609-38346631 CTGGGAATGAGAAAGGGAGGGGG + Intergenic
1023260248 7:38350938-38350960 CTGGGAATGAGAAAGGGAGGGGG + Intergenic
1023261225 7:38360089-38360111 CTGGGAATGAGAAAGGGAGGGGG + Intergenic
1023261741 7:38364901-38364923 CTGGGAATGAGAAAGGGAGGGGG + Intergenic
1023796765 7:43800028-43800050 CTGGGAGGCAGAAATTGCAGTGG - Intronic
1023927471 7:44680262-44680284 CTGAGAGGGTGAAGAGGAAGAGG - Intronic
1024109260 7:46128769-46128791 ATGGGAGGATGACAAGGAAGGGG + Intergenic
1024447630 7:49499906-49499928 CGGGGAAGGGAAAAAGGAAGAGG + Intergenic
1024509350 7:50190902-50190924 CAGGGAGGGAGAAAAGTCACTGG - Intergenic
1024515372 7:50248317-50248339 AAGGGAAGGAGAAGAGGAAGAGG + Intergenic
1024570381 7:50718149-50718171 CAGGAAGGAAGAAAGGGAAGGGG + Intronic
1024803506 7:53108566-53108588 CTGAGAGGGGGAAACGGATGAGG + Intergenic
1024863152 7:53869878-53869900 ATGGGATGGAGAAAATGAGGTGG + Intergenic
1025639750 7:63354852-63354874 CTGGGTGGGGGACAAAGAAGTGG - Intergenic
1025642949 7:63393240-63393262 CTGGGTGGGGGACAAAGAAGTGG + Intergenic
1026040696 7:66865781-66865803 AAGGGAGGGGCAAAAGGAAGGGG - Intergenic
1026159025 7:67852653-67852675 GAAGGAGGGAGAAAAGGAGGAGG + Intergenic
1026228406 7:68462782-68462804 AGGGGAGGGAGGAAAGGAAGTGG - Intergenic
1026672500 7:72402356-72402378 TTGTGGGGAAGAAAAGGAAGTGG - Intronic
1026903752 7:74051186-74051208 CTGGTGGGGAGATAAGGAAAGGG - Intronic
1026928638 7:74210597-74210619 CTGGGAGGGAGAGAGGGAGGCGG - Intronic
1027135883 7:75623681-75623703 CTGGGCTGGAGAAGAGGAGGCGG - Intronic
1027386698 7:77666066-77666088 CTGGTAAGAAGAAAATGAAGGGG + Intergenic
1027558848 7:79701770-79701792 CTGGGGGGGAGGGAAGGAAGGGG - Intergenic
1028157544 7:87448729-87448751 GTGAGAGAGAAAAAAGGAAGAGG + Intronic
1028304172 7:89241372-89241394 CTGGCAGGGAGTAGAGGTAGTGG - Intronic
1028450680 7:90978597-90978619 ATGGGAGGGAGAAGAGGGATAGG - Intronic
1028582724 7:92423972-92423994 CAGGGAGAGAGAAGAGGAAATGG + Intergenic
1028582729 7:92424031-92424053 GTGGAAGAGAGAATAGGAAGAGG + Intergenic
1029185229 7:98733566-98733588 CTGGAAGGGAGAAAAGAAATGGG + Intergenic
1029236862 7:99127334-99127356 GAGGGAGTGAGAAAAGGAAGAGG + Intronic
1029364855 7:100110168-100110190 CTGGGAGGAAGAAATGGGGGAGG - Intronic
1029412802 7:100426739-100426761 GGGGGAGGGAGAGAAGGAGGGGG - Intronic
1029495566 7:100894256-100894278 CTGGGAGAAAGAAAGGGAAAGGG + Intronic
1029603831 7:101586338-101586360 CTGGGAGGTAGAGAAGCACGTGG + Intergenic
1029995134 7:105000526-105000548 CAGGGATGGAAAAAAGGAGGAGG + Intergenic
1030148784 7:106382262-106382284 CTGGGAGGAGGAGGAGGAAGAGG + Intergenic
1030301300 7:107977099-107977121 GAGGGAGGGAGGAAGGGAAGGGG - Intronic
1030870769 7:114753072-114753094 CTGGGATGAAGAATATGAAGTGG - Intergenic
1030973088 7:116086249-116086271 CTGGGTGTGGGAAGAGGAAGGGG - Intronic
1031359529 7:120831638-120831660 CTGGTAGGGTGAAGAGGAGGAGG + Intronic
1031840994 7:126739021-126739043 CAGGGAGGAAGAAAAGGAGAAGG + Intronic
1031909933 7:127505431-127505453 CTGGGAGAGGGAAGGGGAAGGGG - Intergenic
1032132089 7:129238250-129238272 CAGGGAGGTAGAAATGGAATAGG + Intronic
1032400198 7:131619402-131619424 CTGGCAAGGACAAAAGAAAGAGG + Intergenic
1032806741 7:135362824-135362846 CTGAGAGGGAGAAAACAGAGTGG + Exonic
1032818706 7:135503933-135503955 ATGGGAGGCAGAAAATAAAGGGG + Intronic
1032996114 7:137448555-137448577 AAGGGAGGGAGAGAAGGAGGAGG + Intronic
1033137651 7:138798248-138798270 GTGGGAGGGAAAGAAGGAGGAGG + Intronic
1033463322 7:141567460-141567482 GGGGAAGGGAGAAAAAGAAGGGG - Intronic
1033512379 7:142071733-142071755 CTTAGCGGGAGAAAAGAAAGAGG - Intronic
1033563986 7:142560980-142561002 CTGGGAGGTAGAAGGAGAAGGGG - Intergenic
1033602258 7:142896833-142896855 CTAGGATGGAGGAAAGGACGTGG + Intergenic
1033804377 7:144937555-144937577 AGGGGAAGGAGAAAGGGAAGGGG - Intergenic
1033825757 7:145187116-145187138 CTGGAAGGAAGGAAGGGAAGGGG - Intergenic
1034238558 7:149591926-149591948 CTCAGAGGGAGGCAAGGAAGAGG + Intergenic
1034298704 7:149996234-149996256 AGGGGAGGGAGGAGAGGAAGGGG + Intergenic
1034356346 7:150453447-150453469 CAGGGAGGTAGTAAAGGCAGTGG - Intronic
1034363130 7:150520011-150520033 CTGGTAGGGAAAACTGGAAGTGG + Exonic
1034614834 7:152406886-152406908 TTTGGAGGGAGAAGAGGTAGTGG + Intronic
1034789463 7:153955161-153955183 CTGGGAGGTAGGAAAACAAGGGG + Intronic
1034807313 7:154100546-154100568 AGGGGAGGGAGGAGAGGAAGGGG - Intronic
1034927228 7:155131792-155131814 CTGGGGTGGAGAAGAGGATGTGG - Intergenic
1035019312 7:155791351-155791373 CTGGGAGGAAGAAGAGGGGGAGG - Intergenic
1035045107 7:155960435-155960457 CTGGGAAGGTAAAAAGGAATGGG - Intergenic
1035241489 7:157533508-157533530 CTGGGAGGTGGTAAAGGATGAGG - Intergenic
1035278196 7:157760527-157760549 ATGGGAGGGAGGACAGGGAGAGG - Intronic
1035332647 7:158106372-158106394 CTGGGAGGGAGCAGAGGTGGAGG - Intronic
1035409264 7:158626038-158626060 CTGGGAAGGGGAAGAGGAAAAGG - Intergenic
1035518223 8:254935-254957 GTGGAAGGGAGAAATGGAAGAGG + Intergenic
1035820493 8:2586677-2586699 ATGGGAGGGAGGAATTGAAGGGG - Intergenic
1035825889 8:2643819-2643841 GTGGGGGGGAGAGAAGGAATGGG + Intergenic
1035901658 8:3463217-3463239 CTGTAAGGCAGAGAAGGAAGTGG - Intronic
1036246776 8:7124481-7124503 CTGGGGTGGAGGAAAGGTAGCGG - Intergenic
1036397810 8:8383879-8383901 TTGGGAGGGGGAAAAAGCAGAGG + Intronic
1036475612 8:9090229-9090251 CTGTGAGAGAGGAAAGGAAGAGG + Intronic
1036485530 8:9175505-9175527 CTGGGAGGGAGAAAGGTGTGAGG + Intergenic
1036662230 8:10715839-10715861 CTGGCACAGAGAAAAGGCAGGGG - Intergenic
1036711166 8:11079550-11079572 CTGGAAGGGGAAAAAGGAAATGG + Intronic
1036946866 8:13102323-13102345 TTTGGAGGGAGGAAAGGAATTGG - Intronic
1036973040 8:13376465-13376487 CAGGCAGGGAGAAGAGGAGGGGG - Intronic
1037312171 8:17567853-17567875 CTGGAATGGAGAAGAGGTAGGGG + Exonic
1037319763 8:17631602-17631624 GTGTGTGGGAGGAAAGGAAGTGG - Intronic
1037678078 8:21069241-21069263 AAGGGAGGGAGAAAAGGCAATGG + Intergenic
1037723763 8:21466749-21466771 CTGGAAGGGAGGAAAGGAATGGG - Intergenic
1037839235 8:22232198-22232220 GTGGGAGGGGGAAAGGGCAGAGG + Exonic
1037939967 8:22943984-22944006 ATGGGAAGGAAAGAAGGAAGGGG - Intronic
1038016944 8:23523435-23523457 AGGAGAGGGAGAAAAGGCAGAGG + Intergenic
1038652692 8:29420087-29420109 CTGGCAGGCAGAACATGAAGTGG - Intergenic
1038957173 8:32480296-32480318 CTAGGAGAGAGATAGGGAAGGGG + Intronic
1039016099 8:33150657-33150679 CAGTGAGGGAAGAAAGGAAGGGG + Intergenic
1039218867 8:35305679-35305701 GAGGGAGGAAGAAAAGAAAGAGG - Intronic
1039742318 8:40394070-40394092 CTGGGAGGGAGAGAAGGCTGGGG - Intergenic
1039775907 8:40736520-40736542 CTTGGAGGTACAAAATGAAGAGG + Intronic
1040580920 8:48697902-48697924 CTGGATGGGAGGAAAGGCAGTGG + Intergenic
1040833541 8:51706234-51706256 CTGGGAGGTAGAAGAGGTGGAGG + Intronic
1041168934 8:55120627-55120649 GTGGGTGGGAGAAGGGGAAGAGG - Intronic
1041434932 8:57828514-57828536 AAGTGAGGGAGAAATGGAAGAGG + Intergenic
1041444148 8:57931792-57931814 GAGGGAGGGAGGAAGGGAAGAGG + Intergenic
1041541061 8:58985493-58985515 CTAGGAGGTAGAAAAGGGAATGG + Intronic
1041789978 8:61684540-61684562 ATGGGACGGAGAAAAGGATTTGG - Intronic
1042397811 8:68311869-68311891 GAGGGAGGGAGACAGGGAAGGGG - Intronic
1042963591 8:74328239-74328261 GTGGGATGAAGGAAAGGAAGAGG - Intronic
1043495576 8:80796947-80796969 GAGGGAGGGAGAGAAGGAAAGGG + Intronic
1043623288 8:82224754-82224776 CTGGGTGGGAAGAAGGGAAGAGG + Intergenic
1044115184 8:88327238-88327260 GAGAGAGGGAGAAAACGAAGGGG - Exonic
1044305601 8:90637112-90637134 CTGGGAGGGAAAAAAATGAGAGG + Intronic
1044428610 8:92082903-92082925 GGAGGAGGGAGAGAAGGAAGAGG + Intronic
1044558443 8:93589564-93589586 GTGGGAGGGTAAAAAGGAAATGG - Intergenic
1044621046 8:94190999-94191021 GTGGGAGGAAGAAAAGGAGAGGG - Intronic
1044822979 8:96170149-96170171 CTGGGAGAAAGAAGAGGAGGCGG - Intergenic
1044872028 8:96628878-96628900 CAGGGAGGGAGGGAAGGAAGGGG - Intergenic
1044885932 8:96777403-96777425 ATGGGAGGGAGAAATGGAAGGGG + Intronic
1044886556 8:96784583-96784605 CTGGGAAGGAGAGAAAGAAGTGG - Intronic
1045017282 8:98010571-98010593 CTGGGAGGGGAGAGAGGAAGAGG - Intronic
1045328001 8:101131022-101131044 GTGGGAGGGACAGAGGGAAGAGG + Intergenic
1045336909 8:101213298-101213320 AAGTGAGGGAGTAAAGGAAGTGG + Intergenic
1045906783 8:107355242-107355264 TTGGTAGGGAGAGAGGGAAGCGG - Intronic
1046126087 8:109910262-109910284 AGGGGAGGGGGAAAAGGAAAAGG - Intergenic
1046538391 8:115547299-115547321 GAGAGAGGGAGAAAGGGAAGGGG - Intronic
1046601655 8:116324259-116324281 GTGGGAAGGAGAAGAGGATGGGG + Intergenic
1046686868 8:117237455-117237477 ATGGGAGGGAGAGAAGGAGGAGG + Intergenic
1046750832 8:117924673-117924695 CTGGAGGGCAGAAAAGCAAGAGG + Intronic
1046966829 8:120176848-120176870 GTGGGAGGAAGAAAAGGAAAGGG - Intronic
1047024987 8:120814482-120814504 CTGGGAGGGAGACACTGAGGAGG + Intergenic
1047107414 8:121748314-121748336 ATGGGAGGCAGAAAAAGAAGGGG + Intergenic
1047254788 8:123207006-123207028 GTGGGAGGGGGAAGAGGAAGAGG - Intronic
1047287845 8:123503663-123503685 CCGGGAAAGGGAAAAGGAAGGGG + Intronic
1047340345 8:123974959-123974981 CTGGTAGGAAGCAAAGGGAGAGG + Intronic
1047696252 8:127406312-127406334 CGGGGAAGGGGAAGAGGAAGGGG + Intergenic
1047899940 8:129409259-129409281 CTAGGAAAGAGAAAAGGAAGGGG + Intergenic
1047904787 8:129460968-129460990 CAGGGAGGGGGAAAAGGATCTGG + Intergenic
1048272926 8:133043884-133043906 ATTGGAGGGAGGAAAGAAAGAGG - Intronic
1048417635 8:134243958-134243980 AAGGGAGGGGGAAAGGGAAGAGG + Intergenic
1048483035 8:134819235-134819257 CTGGGAGTGGGAAGGGGAAGAGG + Intergenic
1048483038 8:134819241-134819263 GTGGGAAGGGGAAGAGGAAGGGG + Intergenic
1048920017 8:139219657-139219679 GAGGGAGGGAGAGAAGGAAGGGG - Intergenic
1049012343 8:139895478-139895500 CTGGGAGGTGGAGAAGGAAAAGG + Intronic
1049176171 8:141194010-141194032 CTGCCAGGGAGAAACGGGAGGGG - Intronic
1049463332 8:142739976-142739998 CTGGGAGGGCGTAGAGGTAGGGG + Intergenic
1049614176 8:143569065-143569087 CTGGGAGGGAGAAACTGGAGGGG + Intronic
1049614225 8:143569197-143569219 CTGGGAGGGAGAGACTGTAGGGG + Intronic
1049990734 9:989305-989327 CTGGAGAGGAAAAAAGGAAGTGG - Intronic
1050091782 9:2022693-2022715 TTGGCAGTCAGAAAAGGAAGTGG + Intronic
1050588101 9:7134060-7134082 CAGGGAGGGGGAGAGGGAAGAGG - Intergenic
1051124453 9:13788322-13788344 CAGGGAGTGAGAAAAAGAAGAGG + Intergenic
1051141079 9:13979450-13979472 CTGGCAAAGAGAAAAGGAAGCGG + Intergenic
1051169283 9:14302765-14302787 CTGAAGGGGAAAAAAGGAAGGGG - Intronic
1051675440 9:19553945-19553967 TTGGGTGGGGGAGAAGGAAGGGG - Intronic
1051718259 9:20008285-20008307 CTGGGAGGGGAACAAGGGAGAGG + Intergenic
1051752490 9:20357954-20357976 GAGGGAGGGAGAAAAGTAGGGGG - Intronic
1051873416 9:21765455-21765477 TGGGGAAGAAGAAAAGGAAGAGG + Intergenic
1052121388 9:24721829-24721851 CTGGGAGGAATAAAAGAAAATGG + Intergenic
1052242079 9:26285613-26285635 ATGGGAGGGAGAACAAGTAGAGG - Intergenic
1052753895 9:32521339-32521361 GTGGGGGGAAGAAAAGGAAGAGG + Intronic
1052925887 9:34016079-34016101 ATAGAAGGGAGAAAAGGGAGAGG + Intronic
1052967580 9:34352464-34352486 CTGGGAGATAGGAAAGGCAGTGG + Intergenic
1053095581 9:35325121-35325143 CTCAGAGGGAGAGAAGGATGAGG + Intronic
1053148486 9:35728059-35728081 CTGGGAGGGGGACACGGCAGTGG - Intronic
1053370000 9:37552808-37552830 GTGGAAGGTAGAAAAGCAAGAGG + Intronic
1053425635 9:38008241-38008263 CGGGGTGAGAGAATAGGAAGTGG + Intronic
1053475473 9:38379163-38379185 ATGGGAGAGAGAGAAGGAAGGGG + Intergenic
1053614727 9:39751833-39751855 CTCAGAAGGAGAAAAGGAAAAGG + Intergenic
1053783041 9:41630484-41630506 CTGAGAGGGAAAGAAGAAAGGGG + Intergenic
1053900000 9:42786149-42786171 CTCAGAAGGAGAAAAGGAAAAGG - Intergenic
1054170994 9:61840626-61840648 CTGAGAGGGAAAGAAGAAAGGGG + Intergenic
1054238791 9:62590559-62590581 CTCAGAAGGAGAAAAGGAAAAGG - Intergenic
1054552921 9:66625081-66625103 CTCAGAAGGAGAAAAGGAAAAGG - Intergenic
1054666541 9:67740186-67740208 CTGAGAGGGAAAGAAGAAAGGGG - Intergenic
1055132126 9:72787544-72787566 GTGAAAGGGAAAAAAGGAAGTGG + Intronic
1055377197 9:75661790-75661812 CTTGTAGAGAGAAAAGCAAGAGG + Intergenic
1055513784 9:77018326-77018348 CAGGGAAGGGTAAAAGGAAGGGG + Intergenic
1055581467 9:77711110-77711132 GTAGGAGGGGGAGAAGGAAGGGG - Intergenic
1055677778 9:78682815-78682837 GAGAAAGGGAGAAAAGGAAGGGG - Intergenic
1055808851 9:80127646-80127668 CTGGGAGGGAGCATAAGACGTGG + Intergenic
1056040064 9:82656134-82656156 CTGGGAAGGGAAGAAGGAAGGGG + Intergenic
1056068087 9:82957808-82957830 GTGGGCAGGGGAAAAGGAAGGGG + Intergenic
1056069740 9:82973762-82973784 TTGGAAGGGAAAGAAGGAAGAGG - Intergenic
1056118478 9:83463945-83463967 CTGGGAGGAACAGGAGGAAGAGG - Intronic
1056463245 9:86828401-86828423 CTGGTAAGGAGAAAGGGAGGAGG - Intergenic
1056924256 9:90819636-90819658 ATGGGAGGGACCCAAGGAAGGGG - Intronic
1057764814 9:97907463-97907485 CTAGCAGGGAGAGAATGAAGAGG - Intronic
1057847154 9:98534340-98534362 CTTGGAGGGAGAAAAGGGAAAGG + Intronic
1057921002 9:99096823-99096845 CTTGGAGGGAGAATGGTAAGAGG + Intergenic
1058139468 9:101342440-101342462 AGGGGAGGGGGAAGAGGAAGGGG + Intergenic
1058166819 9:101628402-101628424 CTATGAGGGAGAAAAAGAAATGG + Intronic
1058297181 9:103324000-103324022 AGGGGAAGGAGAAAGGGAAGTGG - Intergenic
1058383124 9:104401178-104401200 CTAGGAAGGAGAAAAGAAAGAGG - Intergenic
1058625054 9:106926167-106926189 CTGTTGGGCAGAAAAGGAAGTGG - Exonic
1058840877 9:108907919-108907941 CTGGGATGGAGCAAAGACAGAGG + Intronic
1058868099 9:109180080-109180102 CTGGGTGAGAGAGGAGGAAGGGG - Intronic
1058956994 9:109958583-109958605 AAGAGAAGGAGAAAAGGAAGAGG + Intronic
1059383000 9:113943066-113943088 CTGGGAAGGAGATAGGGTAGGGG + Intronic
1059401724 9:114074766-114074788 CAGGGAAGGAGAGAGGGAAGGGG + Intronic
1059650995 9:116315738-116315760 ATGGGAGGAAGAAGAGGTAGAGG + Intronic
1059731230 9:117059205-117059227 CTAGGAAGTAGAAAAGGGAGAGG + Intronic
1060451693 9:123748659-123748681 GTGGGAGGTAGAAAAGAAAATGG - Intronic
1060467857 9:123923416-123923438 CTGTGGCGGAGAAAGGGAAGAGG + Intronic
1060483856 9:124034822-124034844 TTGGGAGGGATTGAAGGAAGGGG - Intergenic
1060839321 9:126781707-126781729 CTGGGAGGGAGGCCAGGGAGCGG + Intergenic
1060929316 9:127478911-127478933 CTGGGAGGAAAAAAAGACAGTGG - Intronic
1061045517 9:128162967-128162989 GTGTGAGAGAGGAAAGGAAGAGG + Intronic
1061196199 9:129108459-129108481 AAGGGTGGGAGAAAAGGACGTGG - Intronic
1061217288 9:129229074-129229096 ATGGGAAGGAGGGAAGGAAGAGG - Intergenic
1061246304 9:129402729-129402751 GGGGGAGGGAGAAAAGGAGGAGG - Intergenic
1061725014 9:132577461-132577483 AAGGAAGGGAGAAAGGGAAGAGG + Intergenic
1061843654 9:133375389-133375411 CTGGGAAAGAGAAAAGGAAAAGG + Intronic
1061881779 9:133572446-133572468 GTGGGAGGGAGAGTGGGAAGGGG + Intronic
1062407346 9:136403225-136403247 CTGGCGGGGAGAAAGGTAAGGGG + Intronic
1062480940 9:136751029-136751051 GAGGGAGGGAGAAATGGGAGGGG + Intergenic
1062519636 9:136952285-136952307 CAGGGACAGAGAGAAGGAAGTGG - Intronic
1185505209 X:628069-628091 CAGGGAGGGGGAAGAGAAAGAGG - Intronic
1185803281 X:3032571-3032593 GAGGGAGGGAGGAAGGGAAGAGG + Intronic
1185867563 X:3637110-3637132 GAGGGAGGGAGGAAAGGAAAGGG + Intronic
1186400837 X:9258002-9258024 CTCAGAGGGAGAGAAGGAATGGG + Intergenic
1186644804 X:11495261-11495283 CTGCCAGAGAGAAAAGGAAAGGG - Intronic
1186675436 X:11812098-11812120 CTGGGAGGGAAGAAAGGAATTGG - Intergenic
1187327868 X:18308337-18308359 CAGGGAGGGAGGAAAGGACAGGG + Intronic
1187407801 X:19019666-19019688 CTAGGAGAGACAAAAGGAAAAGG + Intronic
1187416061 X:19094491-19094513 CTGGGAGAGAGAGGAGGAGGAGG + Intronic
1187462602 X:19501209-19501231 CAGGGAGGGAGAAAGGGAGAAGG + Intronic
1187876008 X:23804833-23804855 GAGGGAGGGAGAAAGGAAAGAGG - Intergenic
1187966698 X:24619085-24619107 CTAGAAGGGAGAAAAAGAAAGGG + Intronic
1188288593 X:28360658-28360680 GGGGGAGGAAGAAAAAGAAGAGG + Intergenic
1188306874 X:28569720-28569742 TTCAGAGGGAGAAAAGGGAGTGG + Intergenic
1188432537 X:30121139-30121161 CTGGGATGGAAAACATGAAGAGG - Intergenic
1188469671 X:30523995-30524017 GTGGGAGGGAGGATAGGGAGAGG - Intergenic
1188472676 X:30558039-30558061 AGGGCATGGAGAAAAGGAAGAGG + Intergenic
1188613981 X:32134656-32134678 CTGGAAGAAAGAAAAGGAAAGGG - Intronic
1189069033 X:37845122-37845144 CTGGGAGGTGGAAGAGGGAGTGG - Intronic
1189077919 X:37937448-37937470 CTGCCAGTCAGAAAAGGAAGGGG + Intronic
1189110547 X:38285941-38285963 AGGGGAGGAAGAAGAGGAAGGGG - Exonic
1189155846 X:38756135-38756157 CTGGGATGGTGAATAGGAAGTGG - Intergenic
1189224117 X:39398378-39398400 GAGGGAGGGAAATAAGGAAGAGG - Intergenic
1189229096 X:39438199-39438221 CTGAGAGGCAGAATAGGAGGAGG - Intergenic
1189498637 X:41532564-41532586 AAGGAAGGGAGAAAAGAAAGGGG - Intronic
1189597696 X:42587116-42587138 GTAGGAGGGAGAAAAGGAAAAGG + Intergenic
1189945930 X:46178969-46178991 GAGGGAGGGAGGAGAGGAAGTGG - Intergenic
1190035678 X:47021123-47021145 CTGGCAGGGAGAAGAAGGAGGGG - Intronic
1190111187 X:47590138-47590160 CTGTGAGGGGGAAAAGAGAGAGG - Intronic
1190336651 X:49266773-49266795 GTGGGAGGGAGCAAGGGAGGGGG + Intergenic
1190650260 X:52562808-52562830 CCAGGTGGGAGATAAGGAAGGGG - Intergenic
1190797663 X:53759801-53759823 CTGGGAGGGAGGAGAAGATGGGG - Intergenic
1190931295 X:54951319-54951341 CTGGGAGGGAGGAGAGGATGGGG + Intronic
1192051417 X:67727629-67727651 CTGGGAAGGGGCAGAGGAAGTGG - Exonic
1192195824 X:69027442-69027464 CTGGGAGGAGGAACAGGAAAAGG + Intergenic
1192247707 X:69387467-69387489 AAGGGAGGGAAGAAAGGAAGGGG - Intergenic
1192275853 X:69630164-69630186 GTGTGAGGGAGTCAAGGAAGGGG + Intronic
1192330381 X:70170719-70170741 CTTGGACAGAGAAAGGGAAGGGG - Intergenic
1192340900 X:70262525-70262547 CTGGGAGTGAGAGGAGGAGGCGG + Intergenic
1192410914 X:70931315-70931337 CGGGGAGCGAGAAAAGGGGGAGG + Intergenic
1192456853 X:71283372-71283394 GGGGGAGGGGGAAAAGGAAAGGG - Intronic
1192479427 X:71471949-71471971 CTGCCAGGCAGAAAAGGAGGGGG + Intronic
1192529333 X:71872018-71872040 GTAGGAGGGTGAAAAGGGAGAGG + Intergenic
1192784628 X:74324371-74324393 TTGGGAGGAAGAAAGGGGAGAGG + Intergenic
1192803999 X:74493964-74493986 TTGGGAGGAAGAAAGGGGAGAGG - Intronic
1192916694 X:75659005-75659027 AGAGGAGGGAGAGAAGGAAGAGG + Intergenic
1193183763 X:78488111-78488133 CTGGGAAGGGGAAAAGGAAAGGG + Intergenic
1194125419 X:90010633-90010655 GTGGAAGGGAGAATGGGAAGAGG - Intergenic
1194268699 X:91783141-91783163 AAGGGAAGAAGAAAAGGAAGGGG - Intronic
1194593907 X:95835396-95835418 CTTGGAGGCAGCAGAGGAAGGGG + Intergenic
1194863843 X:99040527-99040549 TTGGGAGGAAGAATAGGAAGGGG - Intergenic
1195116920 X:101708237-101708259 GAGGGAGGAAGAAAAGGAAAAGG - Intergenic
1195117037 X:101709562-101709584 GTAGGAGGGAGATAAGGGAGAGG - Intergenic
1195208916 X:102632233-102632255 ATGGGAGCGAGAACAGGAATGGG + Intergenic
1195227584 X:102814147-102814169 CTGGGATGGAGTTGAGGAAGAGG + Intergenic
1195335299 X:103847687-103847709 GTAGGAGGGAGAAGAGGAAGTGG - Intergenic
1195491392 X:105474255-105474277 CTAGAAGGTAGAAAAGGAAAAGG + Intronic
1195751864 X:108167904-108167926 CTGAGAGGAAGGGAAGGAAGAGG - Intronic
1195869322 X:109469755-109469777 CTGGGTGGGAGAAAACTGAGAGG - Intronic
1195944242 X:110192107-110192129 TTGGGAGAGTGAAAAGGGAGAGG - Intergenic
1196067402 X:111479677-111479699 CTGGGGAGGGGATAAGGAAGGGG - Intergenic
1196352795 X:114752754-114752776 CTGGGAGTGACAAAAAGAAGGGG - Intronic
1196505588 X:116437115-116437137 TTGGGAGGGAGAGAAGGGACAGG - Intronic
1196776745 X:119345049-119345071 GTGGGTGGGGGAAGAGGAAGTGG - Intergenic
1196881154 X:120199248-120199270 GGGGGAGGGAGAGAGGGAAGGGG - Intergenic
1196918202 X:120560977-120560999 GGGAGAGGGAGAAAAGGAGGAGG - Intronic
1197289513 X:124638166-124638188 CTGGAAGAGAGAGAAGGAGGGGG + Intronic
1197467185 X:126819639-126819661 AAGGGAGGGAGAAAAGGAGTGGG - Intergenic
1197659076 X:129150306-129150328 CTGGGGTTGAGAGAAGGAAGAGG + Intergenic
1198262204 X:134974750-134974772 ATGGGAGGGGGAATGGGAAGAGG - Intergenic
1198440281 X:136656595-136656617 CTTAGAGGGACAAAAGGAGGTGG + Intronic
1198445100 X:136705319-136705341 AGGGGAGGGAGAAAAGAAAAGGG + Intronic
1198508445 X:137324996-137325018 CTGTGATGGTGAAGAGGAAGCGG - Intergenic
1198768953 X:140107856-140107878 GAGGGAGGGAGAAGAAGAAGAGG + Intergenic
1199039326 X:143092799-143092821 ATTGGATGGAGAGAAGGAAGTGG + Intergenic
1199086331 X:143634189-143634211 CAGGGAGGGAGAACAGGCAAGGG - Intronic
1199118182 X:144017668-144017690 GTGGGAGGGAGGAAAAGTAGAGG - Intergenic
1199405571 X:147454995-147455017 CGGGGAGGGAAAAAAGTAGGCGG + Intergenic
1199570667 X:149264145-149264167 TTGGGATGGAGAATTGGAAGAGG - Intergenic
1199622621 X:149713697-149713719 ATGGGAGGCAGAAAGTGAAGGGG - Intronic
1199629160 X:149764080-149764102 CTGGGAGGGAGAGAATGAGTTGG - Intergenic
1199687630 X:150278809-150278831 CTGGGAAGGGTAGAAGGAAGTGG - Intergenic
1200002664 X:153070037-153070059 CTGGGAGGTAGAAAAGCCTGGGG + Intergenic
1200005059 X:153079972-153079994 CTGGGAGGTAGAAAAGCCTGGGG - Intergenic
1200039645 X:153355875-153355897 CAGGGAGGCAGACAAGGAACTGG + Intronic
1200072333 X:153535446-153535468 GAGGGAGGGAGAAGAGGGAGGGG - Intronic
1200138375 X:153885785-153885807 CTGGGCGGGAGAACAGGGCGGGG - Intronic
1200252585 X:154561589-154561611 ATGCGAGGGAGGGAAGGAAGGGG + Intronic
1200265182 X:154642827-154642849 ATGCGAGGGAGGGAAGGAAGGGG - Intergenic
1200335085 X:155342015-155342037 GTGGGAGGGTGAGGAGGAAGTGG - Intergenic
1200351383 X:155499206-155499228 GTGGGAGGGTGAGGAGGAAGTGG + Intronic
1200585901 Y:5004057-5004079 AAGGGAAGAAGAAAAGGAAGGGG - Intronic
1200978210 Y:9236336-9236358 GATGGAGGGAGAGAAGGAAGAGG - Intergenic
1201300193 Y:12498551-12498573 CAGGGAGGAAGAGGAGGAAGAGG - Intergenic
1201637389 Y:16139287-16139309 CTGAGTGGCAGAACAGGAAGTGG - Intergenic
1202083790 Y:21113543-21113565 GTGTGAGGGAGATGAGGAAGTGG - Intergenic
1202372951 Y:24210574-24210596 CTGTGAGGCCCAAAAGGAAGGGG - Intergenic
1202497831 Y:25459546-25459568 CTGTGAGGCCCAAAAGGAAGGGG + Intergenic
1202589357 Y:26466201-26466223 CTGGGTGGGGGAAAAGGATTGGG + Intergenic