ID: 927949627

View in Genome Browser
Species Human (GRCh38)
Location 2:27158881-27158903
Sequence AGCTCAGCCCCGGCCTGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 442}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927949627_927949637 27 Left 927949627 2:27158881-27158903 CCGGCCCAGGCCGGGGCTGAGCT 0: 1
1: 1
2: 2
3: 33
4: 442
Right 927949637 2:27158931-27158953 ACCAAGCCAGTGCAGTCCTGTGG 0: 2
1: 0
2: 1
3: 12
4: 173
927949627_927949639 28 Left 927949627 2:27158881-27158903 CCGGCCCAGGCCGGGGCTGAGCT 0: 1
1: 1
2: 2
3: 33
4: 442
Right 927949639 2:27158932-27158954 CCAAGCCAGTGCAGTCCTGTGGG 0: 2
1: 0
2: 0
3: 12
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927949627 Original CRISPR AGCTCAGCCCCGGCCTGGGC CGG (reversed) Intergenic
900216064 1:1482307-1482329 AGCACTGCCCAGGCCCGGGCCGG + Intronic
900270952 1:1788362-1788384 TGCTCTGCCAAGGCCTGGGCTGG + Intronic
900296616 1:1955103-1955125 AGCTCAGCGCGGAGCTGGGCCGG - Intronic
900344204 1:2203387-2203409 AGCTGTGCCCAGGCCTGGGCAGG - Intronic
900345398 1:2208112-2208134 GGCTCAGCCCCTGCCTGGGGGGG + Intronic
900437244 1:2636861-2636883 AGCTCAGCCTGTGGCTGGGCTGG + Intronic
900556818 1:3284815-3284837 TGCTCTGCCCTGGCCTGGGCGGG - Intronic
900594975 1:3476543-3476565 AGGGCTGCCCGGGCCTGGGCTGG - Intronic
900658411 1:3771553-3771575 AGCTGGGCCCCGGCCTCTGCTGG - Exonic
900954542 1:5878366-5878388 AGCTCAGACCAGGCCTGTGCCGG - Intronic
901262703 1:7885609-7885631 AGGACAGCCCAGGGCTGGGCGGG + Intergenic
901511538 1:9720328-9720350 AGCCCAGCCCCGACGTGGCCAGG - Intronic
901633708 1:10659959-10659981 AGGGCAGCCCCGACATGGGCGGG - Exonic
901811814 1:11771674-11771696 AGCTCAGGCCCTGCGTGGCCAGG - Intronic
901856846 1:12050033-12050055 TGCTCAGCACCAGCCTGGGCTGG + Intergenic
902192555 1:14773805-14773827 AGAGCAGGCCTGGCCTGGGCTGG - Intronic
902251566 1:15156939-15156961 AGCTCCTCCCCAGCCTGGACAGG + Intronic
902362249 1:15948264-15948286 AGCTCAGCCCCAGCCCTGACGGG + Intronic
902821668 1:18947236-18947258 AGCTCGCCTCCGCCCTGGGCTGG - Intronic
902870695 1:19312158-19312180 CGCTCCTCCCCGGCATGGGCGGG - Intergenic
903060300 1:20664400-20664422 AGCCCACCTCCGCCCTGGGCAGG - Exonic
903140425 1:21335718-21335740 AGCTGAGCTCCTGCCTGGGGTGG + Intronic
903184605 1:21622242-21622264 GGCTCTGCCCCAGCCAGGGCGGG - Intronic
903690132 1:25167508-25167530 AGCAGAGCCCGGGCCAGGGCTGG - Intergenic
904411590 1:30328221-30328243 AGCTCATCCCTGATCTGGGCTGG - Intergenic
905017542 1:34787925-34787947 AGGTCAGCCTCTGCTTGGGCTGG + Intronic
905340439 1:37274044-37274066 AGCTAATACCCAGCCTGGGCTGG - Intergenic
906117995 1:43368102-43368124 AGCGCAGGCTCGGCCGGGGCGGG + Intergenic
906521316 1:46468709-46468731 AGCTAAGCCCTGGCCTTGTCTGG + Intergenic
906524731 1:46487562-46487584 AACTCAGCCCGGGCCTGAGTGGG - Intergenic
907523674 1:55040930-55040952 ACCTCAGCCAAGTCCTGGGCTGG - Intronic
907671082 1:56475467-56475489 AGCTCAGCCCCCACCTTGGATGG - Intergenic
907682648 1:56578798-56578820 TGCGCGGCCCCGGACTGGGCTGG + Intronic
911806170 1:102211115-102211137 AGCTCAGCCTCTCCTTGGGCAGG + Intergenic
912775130 1:112502088-112502110 CGCTCAGGCCAGGCCTGGCCAGG - Intronic
913182289 1:116333931-116333953 AGCTCACTCAGGGCCTGGGCAGG - Intergenic
913209502 1:116571058-116571080 GGCTCCGCCCCGCCCTGGGCTGG + Intergenic
914241675 1:145857057-145857079 AGCTCAGCCCATGTCTTGGCAGG - Intronic
915499044 1:156301859-156301881 GGCTCAGCCCTTGGCTGGGCTGG - Intergenic
917854736 1:179091204-179091226 AGATCAGCCCTGGCAGGGGCTGG + Intronic
918475175 1:184917128-184917150 AAATGAGCCCCAGCCTGGGCTGG + Intronic
920191400 1:204196379-204196401 GCCTCAGTCCTGGCCTGGGCAGG + Exonic
920366313 1:205450023-205450045 AGCTCAGCCCTGGCCGGTGGTGG - Intronic
921833504 1:219754031-219754053 AGCCCAGCACCAGACTGGGCTGG + Intronic
922763740 1:228147281-228147303 AGCTGAGCCTAGGCCTGGCCTGG - Intronic
923045241 1:230350799-230350821 AGCCCAGCCCTGGCCTCCGCAGG + Intronic
923091457 1:230744344-230744366 AGCTCAGCCCAGTGCAGGGCAGG - Intergenic
923541510 1:234891353-234891375 AGATGAGCCCCGAGCTGGGCTGG + Intergenic
1064003674 10:11683677-11683699 AGCCCAGACTCTGCCTGGGCAGG - Intergenic
1064011996 10:11742745-11742767 AGGTCAGCCCCGGGCCGCGCGGG + Exonic
1065343040 10:24723834-24723856 AGCTGGGCCCCGGCCCGGCCCGG - Intergenic
1066480947 10:35795021-35795043 ATCAAAGCCCCAGCCTGGGCTGG + Intergenic
1067084045 10:43228921-43228943 AGCTGAGCCCCGGCCAGCCCTGG - Intronic
1067473649 10:46552796-46552818 AACACAGCCCCGGCCTGGTAAGG + Intronic
1067532181 10:47082109-47082131 AGCTCTGGCCCTGCCTGGTCTGG - Intergenic
1067553916 10:47254423-47254445 AGCTCTGCTCTGGCCGGGGCTGG + Intergenic
1067768158 10:49104459-49104481 TGCACAGCCCCAGCCTGGGGCGG + Intronic
1068669497 10:59709477-59709499 ACCTGAGTCCCGGCCTCGGCGGG + Exonic
1069709349 10:70478901-70478923 ACCTCTGCCCCCGCATGGGCTGG + Exonic
1069775332 10:70923891-70923913 AGCCCTGCCCTGGCCTGGACTGG - Intergenic
1069827290 10:71262079-71262101 ACCGCAGCCCCAGCCTGAGCTGG + Intronic
1069904443 10:71724141-71724163 AGCTCTGCCCTCCCCTGGGCAGG - Intronic
1070079139 10:73168291-73168313 TCCTCAGCCGCGGCCGGGGCAGG - Exonic
1070642621 10:78180531-78180553 AGGTCAGCCCCGGCCAGAGCAGG + Intergenic
1070791173 10:79190253-79190275 ACCACAGGCCTGGCCTGGGCAGG + Intronic
1071504645 10:86225182-86225204 AGCTCCCCACCGGCCTGGGAGGG - Intronic
1072067791 10:91887330-91887352 AGCTCAGGGCCGGCCCGGGAGGG + Intergenic
1073242819 10:102069256-102069278 ACCTCAGCCCCTTCCTGGTCTGG + Intergenic
1073516346 10:104078885-104078907 ACCTCAGACCAGGCCTGGACTGG - Intronic
1074102012 10:110361131-110361153 AGCTCAGCCCCAACCTGCCCTGG + Intergenic
1074712336 10:116187868-116187890 AGCAGAGCCCTGGCCAGGGCTGG + Intronic
1076168374 10:128300437-128300459 CGCACAGCCCAGGCCTGGACCGG - Intergenic
1076268826 10:129132794-129132816 AGGTCATCCCCGGCCTGCGAGGG - Intergenic
1076343516 10:129765663-129765685 TGGTCAGCCCCTGCCTTGGCTGG - Intronic
1076636719 10:131885940-131885962 TGCCCAGCCCCAGCCTGGCCAGG + Intergenic
1077097483 11:805158-805180 AGGTACGCGCCGGCCTGGGCGGG - Exonic
1077365159 11:2158627-2158649 AGCTCCACCCAGGGCTGGGCTGG - Intronic
1077495921 11:2886354-2886376 AGCTCGGCCCTGGCCTGCGCCGG + Intergenic
1077530060 11:3090850-3090872 GTCTCAGCCCCGGCATGGCCTGG + Intronic
1077536798 11:3128409-3128431 AGCTCAGCCTTGGCTGGGGCAGG + Intronic
1077635814 11:3840873-3840895 AGGTGAGGCCCGGCCGGGGCTGG - Exonic
1081616813 11:44596163-44596185 AGCCCAAGCCCGGCCTGGGGTGG - Intronic
1081716240 11:45252475-45252497 AGCTCCGCCTGGGCCTGGACGGG - Exonic
1081809719 11:45908012-45908034 AGCTGAGCCCAGGCCTGCGAGGG - Intergenic
1082786988 11:57322705-57322727 CTCCCAGCCCAGGCCTGGGCCGG - Intronic
1082941157 11:58706813-58706835 AGCTCAGCCTCCCCTTGGGCAGG - Intronic
1083743057 11:64721338-64721360 GATTCAGCCCAGGCCTGGGCTGG + Intronic
1083908764 11:65692729-65692751 ATCTCAGCCCCGGGCTTGGGGGG - Intergenic
1083952808 11:65966212-65966234 GGCGCAGGCACGGCCTGGGCAGG + Exonic
1084156761 11:67317493-67317515 GGCTCAGCCCAGGCTGGGGCGGG + Intergenic
1084526343 11:69700777-69700799 AGCTGGGCGCCGGCCTGGCCTGG - Intronic
1084961856 11:72721067-72721089 AGGCCAGGCCAGGCCTGGGCTGG - Intronic
1084961857 11:72721069-72721091 AGCCCAGGCCTGGCCTGGCCTGG + Intronic
1085013661 11:73158516-73158538 AGCTCAGAGCCGACCTGGGCTGG - Intergenic
1085235207 11:75009315-75009337 AGCTAAGTGCCGGCCTGTGCAGG - Exonic
1086370581 11:86151888-86151910 AGCCCAGCCCAGGCTGGGGCTGG - Intergenic
1086402134 11:86469635-86469657 TCCTCAGCCCCTGCCAGGGCTGG - Intronic
1088372449 11:109106619-109106641 AGCTCAGCCTCTCCTTGGGCAGG + Intergenic
1088579305 11:111299912-111299934 TGGCCAGCCCCGTCCTGGGCCGG - Intronic
1088582621 11:111330636-111330658 TGCCCAGCCCCTGTCTGGGCTGG - Intergenic
1089491717 11:118888078-118888100 AGCTCAGCCCCAGGCAGGGCAGG + Intronic
1089836960 11:121379171-121379193 AGCTCAGCCTCTCCTTGGGCAGG - Intergenic
1090955838 11:131512398-131512420 AGGACAGCCCCTGCCTGGGCTGG - Intronic
1091238889 11:134039412-134039434 AGCTCTGGCCCAGCCTGAGCTGG - Intergenic
1092122875 12:6056898-6056920 AGCTATGCCGCGGCCTGCGCGGG - Exonic
1092246887 12:6868684-6868706 AGTGCAGACCCAGCCTGGGCTGG + Intronic
1093488732 12:19681323-19681345 AGCTCAGGCTCTGCCTGGGCGGG + Intronic
1094362111 12:29641088-29641110 AGCTCAGACCCTCCTTGGGCGGG - Intronic
1095820788 12:46476513-46476535 AGGTCAGCCCTGGGCTAGGCAGG + Intergenic
1096178284 12:49537612-49537634 ATCTCATCCCCAGCCTTGGCTGG - Intergenic
1096576275 12:52554719-52554741 AGCTCAGACCTGGCCTGTGTGGG - Intergenic
1097187891 12:57205293-57205315 AGCCAAGCCCTGGCCTGGGGTGG + Intronic
1098403960 12:70104181-70104203 AGCCCTGCCCCTGCCTGTGCAGG - Intergenic
1100977998 12:100142449-100142471 ACCTCTGCCCCGGCCAGAGCGGG + Intronic
1102348518 12:112175045-112175067 AGCTGTGCCCCTGCCTGGGAAGG + Intronic
1102480797 12:113221789-113221811 TGCAAAGCCCCGGCCCGGGCTGG - Intronic
1102969482 12:117155239-117155261 ACCTCAGCCTTGCCCTGGGCTGG + Intronic
1104220046 12:126774055-126774077 AGATCAGGCCCGGGATGGGCTGG - Intergenic
1104729109 12:131095238-131095260 AGCTCAGCCCCAGCCCTGCCTGG + Intronic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1107470746 13:40688921-40688943 AGCTCAGCCCGGGGCTGCCCAGG - Intergenic
1109267899 13:60221735-60221757 AGCTCAGCCCACAGCTGGGCTGG - Intergenic
1112298577 13:98210378-98210400 AGCCCAGACCCAGCCTGGACAGG + Intronic
1112565381 13:100547518-100547540 AGCGCAGACCAGGCCTGCGCGGG - Intronic
1113825882 13:113252710-113252732 TGCCCAGCCCTGGCCTCGGCTGG - Intronic
1113842466 13:113367983-113368005 TGCCCAGCCTCAGCCTGGGCAGG + Intergenic
1113849974 13:113412553-113412575 AGCAGAGCCCCTGCATGGGCGGG + Intergenic
1114484663 14:23055645-23055667 GCCCCAGCCCGGGCCTGGGCAGG - Exonic
1115393215 14:32877372-32877394 AGCTCAGCCTCTCCTTGGGCAGG + Intergenic
1116346712 14:43803287-43803309 AGCTCAGCCTCTCCTTGGGCGGG - Intergenic
1117240696 14:53829508-53829530 AGCTCAGACCCTCCTTGGGCAGG - Intergenic
1117510789 14:56448783-56448805 AGCTCAGACTCTCCCTGGGCGGG + Intergenic
1119413992 14:74457304-74457326 AGCTCAGCCCAGGGCTGGCTAGG - Intergenic
1119684993 14:76624369-76624391 AGCCCAGCCCAGCTCTGGGCTGG + Intergenic
1119719982 14:76883950-76883972 AGGTCAGAGCGGGCCTGGGCTGG - Intergenic
1121010513 14:90517518-90517540 AGCTCATCTCCGCTCTGGGCGGG - Intergenic
1122326065 14:100881292-100881314 AGCTCAGCCAGCTCCTGGGCTGG + Exonic
1122556511 14:102583624-102583646 GGCACAGCCCCGGAGTGGGCAGG + Intergenic
1122716085 14:103697936-103697958 AGCTCAGCCCTGGCCTGGCTGGG - Exonic
1122825297 14:104367723-104367745 AGCTCTGCCTCAGGCTGGGCGGG + Intergenic
1122865149 14:104600387-104600409 GGCTCAGCGCCGGCACGGGCAGG + Intronic
1122891765 14:104735289-104735311 TGCATAGCCCGGGCCTGGGCTGG + Intronic
1123060267 14:105591261-105591283 AGCTCAGCCCAGCCCAGGCCAGG + Intergenic
1124707475 15:31977766-31977788 AGCTCATCCCCAGCCCTGGCTGG + Intergenic
1125247112 15:37653152-37653174 AGCTCAGCCCCTCCTTGAGCAGG - Intergenic
1125432231 15:39607137-39607159 AGCTCAGCCCCTGCCTCCTCAGG + Intronic
1126184817 15:45821680-45821702 AGCTCAGCCTCTCCTTGGGCGGG + Intergenic
1126977318 15:54198172-54198194 AGCTCAGCCCCTCCTTCGGCAGG - Intronic
1128245712 15:66131311-66131333 AGCACGGCCCAGGCCCGGGCAGG - Intronic
1128354982 15:66919757-66919779 AGCTCAGGCCCGTGCTGGGCTGG - Intergenic
1128683803 15:69669204-69669226 AGCCCAACCCCAGCCTGGGTAGG - Intergenic
1129709644 15:77814008-77814030 ATCTCAGCCCCTCCCTGTGCTGG + Intronic
1129750072 15:78056547-78056569 AGCTCAGCCTGGCCCTGGGGCGG + Intronic
1130356276 15:83133675-83133697 AGCTCAGCCTGAGCCTGTGCTGG - Exonic
1131248046 15:90813040-90813062 AGCTTAGGCCTGGCCTGGGGAGG + Intronic
1131872569 15:96777234-96777256 AGCTCACCCCCAGCCTGGATGGG - Intergenic
1132649340 16:1013570-1013592 TGCTCAGCTCTGTCCTGGGCTGG + Intergenic
1132649342 16:1013575-1013597 AGCTCTGTCCTGGGCTGGGCTGG + Intergenic
1132689328 16:1175463-1175485 TGCTGGGCCCTGGCCTGGGCTGG + Intronic
1132724000 16:1331034-1331056 AGCTCTGACCCCGTCTGGGCAGG + Intergenic
1132727321 16:1344606-1344628 ACCACAGCGCCTGCCTGGGCTGG + Exonic
1132892112 16:2209603-2209625 ACCAAAGCCCCCGCCTGGGCGGG + Exonic
1133732762 16:8590447-8590469 AGCTGCGCCCCGGCCAGAGCAGG - Intergenic
1135415431 16:22265094-22265116 AGCTCAGCCCCATCCTGGAGGGG + Intronic
1135725425 16:24850443-24850465 AGCTGTGCCCTGGCCTGGCCTGG - Intronic
1136365346 16:29806822-29806844 AGCTCAGCCCCGACCTGCAGGGG - Exonic
1136483861 16:30558583-30558605 AGCTCCGCCCCGGCCCGGCGAGG + Intergenic
1136687339 16:32003053-32003075 AGCTCCGACCCTGCCTGGGGCGG - Intergenic
1137002789 16:35245965-35245987 AGCCCACCCCTTGCCTGGGCAGG - Intergenic
1137012325 16:35335318-35335340 AGCCCATCCCTTGCCTGGGCAGG - Intergenic
1137026160 16:35477886-35477908 AGCCCATCCCTTGCCTGGGCAGG - Intergenic
1138240239 16:55421683-55421705 AGCTCAGCCCAGGGCTGCGTTGG - Intronic
1138475713 16:57269616-57269638 AGCTCAGCAGCTGCCAGGGCTGG + Intronic
1139409958 16:66751368-66751390 TGGTCAGCCCCGGGCCGGGCTGG + Intronic
1139476322 16:67204256-67204278 AGCTCAGCCTCTCCCTTGGCAGG - Intergenic
1139661785 16:68425756-68425778 CACCCAGCCCCAGCCTGGGCTGG - Intronic
1139884165 16:70196983-70197005 AGCTCAGCCCTGGCCTTCACGGG - Intergenic
1140368353 16:74398513-74398535 AGCTCAGCCCTGGCCTTCACGGG + Intergenic
1140446132 16:75029652-75029674 AGCTCAGCCTCAGCCTCAGCTGG - Intronic
1140475349 16:75237080-75237102 TTCTCAGCCCCGGCCAGGCCTGG - Intronic
1140507547 16:75483294-75483316 AGCTCAGCCCTTCCCTGGGTAGG + Intronic
1141204116 16:81920116-81920138 AGCTCTACCCCCACCTGGGCTGG - Intronic
1141686614 16:85574009-85574031 AGCTCAGCCCCCGCGGGGACTGG + Intergenic
1142309184 16:89302214-89302236 CGTTCAGCCCCACCCTGGGCCGG - Intronic
1142699234 17:1649386-1649408 AGCGCAGCCCCGGCCAGGGCAGG - Intronic
1142851572 17:2707250-2707272 AGCTCAGCCCCAGCATTGCCCGG + Intronic
1143730603 17:8880691-8880713 AGATCAGGTGCGGCCTGGGCCGG + Exonic
1144065724 17:11622495-11622517 AGCCCAGGCCAGGCATGGGCTGG - Intronic
1144576916 17:16435296-16435318 GGCTCAGCCCAGGCCTGGCTGGG - Intronic
1144685515 17:17223544-17223566 AGCTCAGGCCAGGCCAGGCCAGG - Intronic
1145100489 17:20072589-20072611 AGTTCAGAGCCGGCCTGGCCTGG - Intronic
1146920002 17:36704012-36704034 AGCCCCGCCCCGGGTTGGGCTGG + Intergenic
1147240017 17:39084709-39084731 AGCTGGGGCCCAGCCTGGGCAGG + Intronic
1147584973 17:41648767-41648789 TGCTCAGCCCCAGCCTGGGTTGG - Intergenic
1147721600 17:42543093-42543115 AGCACAGCCCTGATCTGGGCGGG - Exonic
1148849257 17:50546975-50546997 GGCTCTGCCCCTGCCTGGGGAGG - Intronic
1150748665 17:67838678-67838700 AGTTCAACACCAGCCTGGGCTGG - Intronic
1151424731 17:74023591-74023613 TGCTCCACCCCAGCCTGGGCTGG + Intergenic
1151559236 17:74861768-74861790 ACCTCCGCCCCGGCCCGGCCCGG + Intergenic
1151635919 17:75347723-75347745 AGCTCAGCTCATGGCTGGGCTGG - Intronic
1151698317 17:75729459-75729481 TGCTCACCCCTGGCCTAGGCTGG - Intronic
1152040846 17:77901710-77901732 AGCTCAGAGCTGGCCAGGGCTGG - Intergenic
1152394012 17:80020949-80020971 AGCTCAAAACCAGCCTGGGCAGG + Intronic
1152517757 17:80836176-80836198 AGGTCAGCCGCTCCCTGGGCCGG + Intronic
1152525852 17:80887981-80888003 ACCCCAGCCTCTGCCTGGGCCGG + Intronic
1152626523 17:81390275-81390297 GCCTCAGCCCAGGCCTGGTCGGG + Intergenic
1152820306 17:82434358-82434380 AACTCAGTCAGGGCCTGGGCAGG + Intronic
1152888134 17:82864709-82864731 AGCACAACCCCGGCCTCGGTGGG - Intronic
1152923513 17:83077651-83077673 ATCTCTGCCCCAGCCTAGGCTGG + Intergenic
1152930106 17:83104988-83105010 AGGTGAGCCCCCGCCTGGACCGG - Intergenic
1153935318 18:9914888-9914910 AGCTCTCCCCGGGCCGGGGCAGG - Intronic
1154090020 18:11349475-11349497 AGCTCAGACTCTCCCTGGGCAGG - Intergenic
1156448675 18:37254267-37254289 ACCTCAGCCCTCGCCTCGGCGGG + Intronic
1156467315 18:37356016-37356038 AGCCCAGCCCAGCCCTGGCCTGG + Intronic
1156607111 18:38679767-38679789 AGTTCAGCCTCCCCCTGGGCAGG + Intergenic
1157909016 18:51597659-51597681 AGCTCAGCCATGGGCTGAGCTGG - Intergenic
1157909017 18:51597661-51597683 AGCTCAGCCCATGGCTGAGCTGG + Intergenic
1159051196 18:63422563-63422585 AGCGCAGGCCCTCCCTGGGCCGG + Intergenic
1160499017 18:79393400-79393422 AGCTCCGGCCCGGCCCGCGCTGG + Intergenic
1160580958 18:79884413-79884435 TGCTCAACCCCGGCCTGGCAGGG + Intronic
1160592389 18:79951700-79951722 CGCGCAGCTCCGGCGTGGGCGGG - Intergenic
1160681030 19:411666-411688 GGCTCTGCCCCCACCTGGGCTGG - Intergenic
1160739225 19:678196-678218 AGCTCAGCCCCAGCAAAGGCTGG - Intronic
1160823739 19:1069746-1069768 AGCTGAGCCCCGCCCAGGCCAGG - Intronic
1160905540 19:1450158-1450180 AGCCCGGTCCGGGCCTGGGCAGG - Intronic
1160981580 19:1818860-1818882 TGGTCAGCCCCTGCCTGGGATGG + Intronic
1161323778 19:3653262-3653284 GGCTCGGCCCCGGCCGGGGAGGG - Intronic
1161361423 19:3852182-3852204 AGCTGAGCCCCGCCTTGGCCAGG - Intronic
1161380837 19:3964205-3964227 TGGGCAGCCCCGGCCTGGGGAGG - Intronic
1163196275 19:15723325-15723347 GGCTCAGCGCTGTCCTGGGCGGG + Intergenic
1163596177 19:18222251-18222273 AGTCCAGCCCTGGCCTGGGCCGG - Exonic
1163698941 19:18777588-18777610 ATCCCAGCCCAGCCCTGGGCGGG - Exonic
1164476154 19:28577517-28577539 AGTCCAGCCCCGGCCTGTGAAGG + Intergenic
1164578730 19:29421263-29421285 AGTGCAGACACGGCCTGGGCAGG + Intergenic
1164989760 19:32675285-32675307 AGCCCCGCCCCCGGCTGGGCTGG - Intronic
1165172832 19:33906046-33906068 AGCTCGCCTTCGGCCTGGGCGGG + Intergenic
1165354616 19:35295883-35295905 ACGTCAGCCCCGAGCTGGGCGGG + Exonic
1165745830 19:38229199-38229221 CTTTCAGCCCCGGCCGGGGCAGG + Intronic
1165862324 19:38915787-38915809 AGCTCAGCGCCGGGGAGGGCTGG - Intronic
1166120516 19:40683595-40683617 AGCTCAGCCCCTTCCTGGCTGGG - Intronic
1166214422 19:41325978-41326000 GCCTCAGCCCCGGCCGGGGGCGG - Intronic
1166294612 19:41883010-41883032 AGCTCGGGCGCGGCCGGGGCGGG + Intergenic
1166538797 19:43592522-43592544 AGCAGTGCCCCTGCCTGGGCTGG + Exonic
1166745563 19:45140387-45140409 AGCTCAGCCAGGGCAGGGGCTGG + Intronic
1167263078 19:48469815-48469837 AGCCCAGCGCCTGCCGGGGCCGG + Intronic
1167593842 19:50417545-50417567 AGCCCGGCCCCGCCCTGGGGAGG - Intronic
1167688513 19:50970901-50970923 GGCTCAGCACCTGCTTGGGCTGG + Intergenic
1168294125 19:55370405-55370427 AGCTGGGCCGCGGCCTGGGGAGG + Intronic
1168349499 19:55668070-55668092 AGCTCAGTCCCGGCCGGGCGCGG - Intronic
925147230 2:1589225-1589247 AGCTCTGCCCAGGTCTGCGCAGG - Intergenic
925414121 2:3657469-3657491 AGCTCAGTCCCTCCCTGCGCAGG + Intergenic
925458820 2:4042569-4042591 ACCTCAGCCTCGGGCAGGGCAGG - Intergenic
926055294 2:9770814-9770836 ACCACAGCCCAGGCCAGGGCCGG - Intergenic
926303303 2:11618941-11618963 AGCACAGCCCCGGACTGGGGGGG + Intronic
926991305 2:18683255-18683277 AGCTCAAGCCTGGCCAGGGCAGG + Intergenic
927036706 2:19185111-19185133 AGCTCAGCCCCTCCTTGGGCAGG + Intergenic
927949627 2:27158881-27158903 AGCTCAGCCCCGGCCTGGGCCGG - Intergenic
930486502 2:52017779-52017801 AGCTCAGACTCTGCTTGGGCAGG + Intergenic
931348691 2:61470409-61470431 AGCTCCGGCTCGGCCTGGCCCGG - Intronic
931566812 2:63622901-63622923 CGCCGAGCCCCGGCCTGGCCCGG - Intronic
932428914 2:71661855-71661877 AGCTCATCACTGGCCAGGGCTGG - Intronic
932712977 2:74081331-74081353 AGCTCAGCCTCGCGCTGTGCTGG + Intronic
933666839 2:84971230-84971252 AGCTCAGCCCCGACCAGGCCCGG + Exonic
933907974 2:86914062-86914084 GCCTCGGCCCCGGCCTGGCCGGG + Intronic
933907994 2:86914111-86914133 GCCTCGGCCCCGGCCTGGCCGGG + Intronic
937069248 2:119050290-119050312 AGCTCAGACCCTCCTTGGGCGGG + Intergenic
937812775 2:126217488-126217510 AGCTCAGCCTTGGCCTCAGCTGG - Intergenic
937989097 2:127652459-127652481 AGCTCAGCTCAGGCCAGGGCTGG + Exonic
938159553 2:128973137-128973159 ATCACAGCACCAGCCTGGGCTGG - Intergenic
938211076 2:129466104-129466126 AGAGCAGCCCCAGCCTGAGCTGG - Intergenic
938564234 2:132503741-132503763 AGCTTAGCCCCTCCCAGGGCAGG + Intronic
940034706 2:149301706-149301728 AGCTCAGACCCTCCTTGGGCTGG + Intergenic
941738344 2:169005340-169005362 AGCTCAGCCTCTCCTTGGGCGGG + Intronic
942043582 2:172086427-172086449 AGCTCAGCTCCTGCCTTTGCAGG - Intronic
942294806 2:174507202-174507224 AGCACAGCCCAGGCCTTGCCTGG - Intergenic
945338270 2:208618421-208618443 AGCTCAGACTCTCCCTGGGCAGG + Intronic
947749259 2:232524220-232524242 AGCCCAGCCCAGCCCTGGCCCGG + Intronic
949064149 2:241979684-241979706 AACACAGCCCGGCCCTGGGCAGG - Intergenic
1169352474 20:4880404-4880426 AGCTCAGCCACGGGAGGGGCAGG + Intronic
1170585037 20:17728162-17728184 GGCTGAGCCCCAGCCTGGGGTGG - Intronic
1171038668 20:21739581-21739603 AGCTCAGCCTCTCCTTGGGCAGG + Intergenic
1171242875 20:23585946-23585968 AGCTCAGCAGGGGCCAGGGCAGG - Intergenic
1171317118 20:24205131-24205153 AGCTCAGCTCAGGTCTGGCCAGG + Intergenic
1172118000 20:32583398-32583420 CGCTCAGCCCCGTCCCCGGCCGG - Intronic
1172389800 20:34559021-34559043 GGACCAGCTCCGGCCTGGGCGGG + Intronic
1173163459 20:40669795-40669817 TTCTCAGCCCCGCCCAGGGCTGG + Intergenic
1173255914 20:41394296-41394318 GGCTCAGCTCCTGCCTGGTCTGG - Intergenic
1173806023 20:45925844-45925866 AGCTCAAGCCCAGCCTAGGCGGG + Intergenic
1174390553 20:50216152-50216174 AGCTCAGCCCCACCCTGGACCGG - Intergenic
1175215665 20:57390684-57390706 AGCTCCACCCCGTTCTGGGCTGG - Intergenic
1175215821 20:57391330-57391352 AGCTCAGCCCCGCCCCCAGCCGG - Intergenic
1175781803 20:61687456-61687478 TCCTCAGCCACAGCCTGGGCGGG + Intronic
1175806881 20:61834399-61834421 AGCTTAGACCCTGCCTGGGCTGG - Intronic
1175925379 20:62468809-62468831 AGCTCTGCTGGGGCCTGGGCTGG - Intronic
1176062783 20:63179501-63179523 AGCCCAGCCGGGGCCTGGGATGG - Intergenic
1176099247 20:63357470-63357492 CACTCAGCACTGGCCTGGGCTGG + Intronic
1176676847 21:9786666-9786688 AGCTCAGCCCCAGCAGGTGCAGG - Intergenic
1177140517 21:17353111-17353133 AGCTCAGACTCTGCCTGGGTGGG - Intergenic
1178914905 21:36700745-36700767 AGCTCAGCAACGGCGGGGGCGGG - Intronic
1179491712 21:41745450-41745472 GGCCCAGCCCCGGCCGGGGAGGG - Intronic
1179600805 21:42476196-42476218 AGCCCAGCCTAGGCCTGGCCAGG + Intronic
1179783729 21:43718551-43718573 AACTCCGCACCGGCCTGGGGCGG - Intergenic
1180157316 21:45983876-45983898 TGCTCTGCCCCAGCCTGGGGTGG - Intronic
1180612836 22:17108916-17108938 AGCTCCGCGCCGCCCTGGACAGG + Exonic
1180981059 22:19878211-19878233 AACCCAGCCCCCTCCTGGGCTGG - Intronic
1180984035 22:19893585-19893607 ACCTGTGCCCAGGCCTGGGCCGG - Intronic
1181006266 22:20015147-20015169 AGCTCAGCCAAGAGCTGGGCAGG + Intronic
1181028910 22:20140707-20140729 CGGTGAGGCCCGGCCTGGGCAGG + Exonic
1181167228 22:20990346-20990368 AGCTCAGCCCCGGCCTCACAGGG - Intronic
1181745078 22:24950556-24950578 AGCTGACACCCGGTCTGGGCTGG + Intergenic
1182100607 22:27655047-27655069 TGCACAGAGCCGGCCTGGGCGGG + Intergenic
1182979682 22:34657245-34657267 AGCTCAGCCCAGGCTGGGGGTGG - Intergenic
1184412092 22:44331469-44331491 AGCTGAGCCCCGGGGCGGGCAGG - Intergenic
1184444428 22:44539145-44539167 AGGTCAGCCCAAGCCAGGGCAGG - Intergenic
1184564645 22:45284887-45284909 CGCCCCGCCCCCGCCTGGGCTGG - Intergenic
1184818379 22:46889812-46889834 AGCACCTCCCCGGCCAGGGCTGG + Intronic
1184979222 22:48084299-48084321 GACTCAGCCTCGGGCTGGGCAGG + Intergenic
1185275528 22:49948887-49948909 AGGACAGCCCTGGCCAGGGCTGG - Intergenic
950032572 3:9862436-9862458 GGGTCAGCCCCGGGCAGGGCGGG + Intergenic
950415682 3:12867785-12867807 GGGTCAGCCCCGGGCAGGGCTGG + Intronic
950578466 3:13847156-13847178 CCCTCCGCCCCAGCCTGGGCTGG + Intronic
950676065 3:14555162-14555184 TGCTGAGCCCCAGCCTGTGCCGG - Intergenic
950767784 3:15286257-15286279 AGCTCCGCCCCTGCCTGGGGAGG + Intronic
954127035 3:48537405-48537427 AGCTCAGGCCCGGCCTGGGCTGG + Intronic
954419394 3:50410598-50410620 AGCTCAACCCAGGAGTGGGCTGG - Intronic
955535146 3:59915641-59915663 TGCTCAGCTCTAGCCTGGGCTGG + Intronic
955732350 3:62000005-62000027 TGCCCAGCCCGGGCCTGGGGGGG - Intronic
958592503 3:96175679-96175701 GGCTCAGCCCACGCCTGGGCCGG - Intergenic
959125904 3:102290365-102290387 AGCTCAGCCTTAGCTTGGGCAGG + Intronic
960988427 3:123295325-123295347 AGCTCTGCACAGGGCTGGGCTGG + Intronic
961243921 3:125435263-125435285 AGCTCACCCCAGGCCAGAGCTGG - Intergenic
961372192 3:126438353-126438375 ACGGCAGCCTCGGCCTGGGCAGG - Exonic
961408356 3:126699334-126699356 AGTTCAACACCAGCCTGGGCTGG + Intergenic
961567328 3:127773075-127773097 AGCTGGGCTCCAGCCTGGGCTGG + Intronic
961712158 3:128836024-128836046 AGGTCAGCCCTGGGCAGGGCAGG - Intergenic
962367972 3:134798227-134798249 CCCTCAGCCCAGGCCAGGGCAGG + Intronic
964226469 3:154408680-154408702 AGCTCAGCCTCTCCTTGGGCAGG - Intronic
965184568 3:165446557-165446579 AGCTCAGCCTCTCCTTGGGCGGG - Intergenic
965206748 3:165729138-165729160 AGCTCAGCCCAAGGCTGGACTGG + Intergenic
968550793 4:1222597-1222619 TCCTCAGGCCAGGCCTGGGCGGG + Intronic
968618590 4:1593310-1593332 CGCTCAGCCCAGGCCAGGGGAGG + Intergenic
968654810 4:1773851-1773873 TGCTCAGCTCTGGCCTGGGACGG + Intergenic
968961785 4:3749214-3749236 AACTGAGCCCCGCCCTGGGTAGG + Intergenic
969228529 4:5814441-5814463 AGATCAGCACCGCCCTGGCCAGG - Intronic
969345462 4:6567145-6567167 ACTTCTGCCCCGGCCGGGGCTGG + Intergenic
969462452 4:7335951-7335973 AGCTCTGCCCCCTCCTGGCCGGG + Intronic
971910419 4:32788889-32788911 AGCTGAGATCCAGCCTGGGCTGG + Intergenic
975973892 4:80073201-80073223 AGCCCAGACCCGGCCCGAGCGGG - Intronic
976593929 4:86876342-86876364 AGCGCAGCGACGGCCGGGGCCGG + Intronic
981167631 4:141580862-141580884 AGCTCAGCCTCTCCTTGGGCAGG - Intergenic
982299506 4:153864947-153864969 AGCTCAGACTCTCCCTGGGCAGG + Intergenic
985115965 4:186591107-186591129 AGGTTAGCCAGGGCCTGGGCAGG - Intronic
985398692 4:189572117-189572139 AGCTCAGCCCCAGCAGGTGCAGG + Intergenic
985575424 5:671407-671429 ACCCCAGTCTCGGCCTGGGCAGG + Intronic
985986692 5:3522096-3522118 ACCCCAGCCCAGGGCTGGGCAGG + Intergenic
988421188 5:31008064-31008086 AGCTCAGCCTCTCCTTGGGCAGG + Intergenic
988497558 5:31758040-31758062 AGATGAGCCCCGGCCTGGGCAGG - Intronic
990382861 5:55233246-55233268 AGCTGCGCCACGGGCTGGGCCGG + Exonic
990614501 5:57493638-57493660 AGCACATCCCCGGAATGGGCTGG + Intergenic
991720728 5:69492783-69492805 CGCTCAGCCGGGGACTGGGCTGG - Intronic
992080594 5:73232403-73232425 AGTTCGGCCCGGGGCTGGGCAGG - Intergenic
996197810 5:120631680-120631702 AGCTCAGCCTCTCCTTGGGCAGG - Intronic
997199906 5:132003593-132003615 AGAACAGCCCCAGCCTGGCCAGG - Intronic
998267436 5:140676796-140676818 GGCTCTTCCCCTGCCTGGGCTGG + Exonic
998349693 5:141492523-141492545 ACCTGCGCCCCGGGCTGGGCCGG + Intronic
999303380 5:150504657-150504679 AGCTCTGCCCCTTCCTGGCCTGG + Intronic
999670969 5:153959076-153959098 AGCTCAGCCCCTGCCCGCTCAGG + Intergenic
1000047078 5:157530667-157530689 GGCTCAGCCCCTCTCTGGGCTGG + Intronic
1001083193 5:168681784-168681806 AGCTGAGCCCTGCCCTGAGCTGG - Intronic
1001290214 5:170451948-170451970 TGCCCTGCCCAGGCCTGGGCTGG + Intronic
1002337085 5:178487224-178487246 AGGGAAGCCCTGGCCTGGGCTGG - Intronic
1002428812 5:179191413-179191435 AGCTCAGTCACGGGATGGGCCGG - Intronic
1002721033 5:181261561-181261583 AACTCGGCCCCGGCCCGGGCGGG - Intergenic
1002773310 6:307611-307633 AGAGCAGCCCCTCCCTGGGCCGG + Intronic
1003029427 6:2589216-2589238 AGCTCAGCCTCTCCTTGGGCAGG + Intergenic
1003048932 6:2763519-2763541 AGCTCCTCACCGTCCTGGGCCGG + Intergenic
1003370239 6:5517899-5517921 AGCACAGCCCAGGCCAAGGCGGG - Intronic
1003963295 6:11229361-11229383 CGCTGAGCCCCCGCCCGGGCTGG + Intronic
1003963300 6:11229370-11229392 ACCTCAGGCCCAGCCCGGGCGGG - Intronic
1003968917 6:11279981-11280003 GGCTCAGCTCCTGCCTGGGCAGG + Intronic
1004005344 6:11632840-11632862 AGCTGAGAGCAGGCCTGGGCTGG + Intergenic
1004230874 6:13831887-13831909 AGCTCAAGGCCTGCCTGGGCCGG - Intergenic
1004888536 6:20074888-20074910 AGCTCAGCCTCTCCTTGGGCAGG - Intergenic
1005687308 6:28267229-28267251 AGCTGGGCCCCGGGCTGGGGCGG + Intronic
1005840851 6:29743814-29743836 GGCCCAGCCCTGGCTTGGGCAGG + Intergenic
1005850193 6:29815033-29815055 GGCCCAGCCCTGGCTTGGGCAGG + Intergenic
1006300644 6:33192158-33192180 AGCGCGGCCCCAGGCTGGGCAGG - Exonic
1007167540 6:39839594-39839616 GGGTCAGCCTCAGCCTGGGCTGG + Intronic
1007667748 6:43525567-43525589 AGCTCAGGCCTGGCTTGGGGAGG + Intronic
1008042275 6:46815233-46815255 AGCTCAGCCTCTCCTTGGGCAGG + Intronic
1010211036 6:73363086-73363108 TTCTCCGCCCCGGCCTGCGCGGG - Exonic
1010952926 6:82058269-82058291 TGCTCAGCCCCAGCCTGCTCAGG + Intergenic
1011633896 6:89352811-89352833 AGCGCCGCCCCGGCCGGCGCCGG - Exonic
1011965857 6:93156749-93156771 AGCTCAGCCTCTCCTTGGGCTGG + Intergenic
1012510582 6:99996559-99996581 AGCTCCTCACTGGCCTGGGCTGG + Intergenic
1013472613 6:110477957-110477979 AGGTCACCCCCTGCCTGGGTTGG - Intergenic
1016277971 6:142377434-142377456 GGCTCAGGCAAGGCCTGGGCAGG + Intronic
1018686473 6:166307945-166307967 GGCGCGGCCCCGGCCTGGACAGG - Exonic
1018736129 6:166688390-166688412 TGCTCATCCCCGGCCTTGCCAGG + Intronic
1019138415 6:169927148-169927170 AGCCCGGCCCCTGCCAGGGCCGG - Intergenic
1019351694 7:557042-557064 CTCCCACCCCCGGCCTGGGCCGG + Intronic
1019473105 7:1231611-1231633 AGGAGAGCTCCGGCCTGGGCTGG - Intergenic
1019476539 7:1247271-1247293 CGCTCAGACACGGCCTGAGCCGG - Intergenic
1019550733 7:1601172-1601194 AGCTGAGCCCCACCCTGGACTGG - Intergenic
1022506647 7:30911834-30911856 AGCTGAGCCACAGCCTGGGCTGG - Exonic
1023081626 7:36532186-36532208 AGGTCAGCCCCTGCCACGGCTGG - Exonic
1023537780 7:41231775-41231797 AGCTCAGCCTCTTCTTGGGCAGG + Intergenic
1023876952 7:44291527-44291549 AACTCGGCCACAGCCTGGGCCGG + Intronic
1025807544 7:64849585-64849607 AGCTTAGCCTCTGCTTGGGCGGG + Intergenic
1026654473 7:72245205-72245227 AGCCCAGCCCCGCCCTGGTAAGG + Intronic
1027260518 7:76461759-76461781 AGCTCCGGCTCGGCCTGGGCAGG - Exonic
1027311895 7:76959872-76959894 AGCTCCGGCTCGGCCTGGGCAGG - Intergenic
1028501843 7:91527697-91527719 AGCTCAGCCTCATCTTGGGCGGG - Intergenic
1029111179 7:98213710-98213732 TGCTCAGCCCTGGCCTGTGTGGG + Intergenic
1029118409 7:98250376-98250398 ACCTCAGCCCCGGAAAGGGCTGG - Intronic
1029483815 7:100827490-100827512 AGCTCAGCCCCTGCCCGGCCCGG - Exonic
1030249594 7:107427717-107427739 AGCTCAGCCTGTGGCTGGGCTGG + Intronic
1030884541 7:114922150-114922172 AGGCCAGAGCCGGCCTGGGCTGG - Exonic
1033026842 7:137782445-137782467 AGCTCAGCCTCTCCTTGGGCAGG - Intronic
1034058887 7:148067794-148067816 AGCTCAGCCTCCCCTTGGGCAGG + Intronic
1034113035 7:148557173-148557195 TGCTCAGCCCCTTCATGGGCGGG + Intergenic
1034982664 7:155488750-155488772 AGCTGAGTCCAGGCCTGGGGTGG - Intronic
1035173443 7:157033655-157033677 GGCTCAGCCCTGGCCAGGCCTGG - Intergenic
1035314538 7:157989894-157989916 AGCGCAGCCCTGGGCAGGGCGGG - Intronic
1035314541 7:157989899-157989921 AGGTCAGCGCAGCCCTGGGCAGG - Intronic
1036557955 8:9876498-9876520 AGGTGAGCCCCAGCCTGGGATGG - Intergenic
1036910686 8:12755106-12755128 GGCTCCGCCACGGGCTGGGCTGG - Exonic
1037510947 8:19582004-19582026 AGCTCAGATACAGCCTGGGCTGG - Intronic
1038004484 8:23418132-23418154 AGCCCAGCCAAGGTCTGGGCAGG - Intronic
1039702620 8:39978161-39978183 ACCTCAACCCGGGCCTGCGCTGG + Intronic
1041394434 8:57376626-57376648 ACCACAGCCCCTGCCTGGCCTGG - Intergenic
1041832049 8:62164995-62165017 AGCTCAGCCTCTCCTTGGGCAGG - Intergenic
1044274599 8:90285287-90285309 AGTTCATCCCCGGCCAGTGCTGG - Intergenic
1044585502 8:93865832-93865854 AGCTAAGCCCCAGCCTAGACAGG - Intronic
1046690875 8:117282924-117282946 CGCTCAGCCCATGGCTGGGCCGG - Intergenic
1047607337 8:126488368-126488390 AGCTCAGCCTCTCCTTGGGCGGG + Intergenic
1047775582 8:128067681-128067703 ATCCCAACCCAGGCCTGGGCTGG + Intergenic
1047890422 8:129302886-129302908 AGCTCAGCCTCTCCTTGGGCAGG + Intergenic
1049173052 8:141173993-141174015 AGCTCAGCAGTGGCCTGGCCAGG + Intronic
1049184774 8:141244276-141244298 AGTCCAGCCCATGCCTGGGCCGG + Intronic
1049219562 8:141422668-141422690 TGCTCAGCCGTGGCCTGGGCTGG + Intronic
1049323628 8:142010585-142010607 AGCCCGGCCCAGGCCTGGACAGG - Intergenic
1049393437 8:142383585-142383607 AGCTCAGCACCTGCCAGAGCTGG + Intronic
1049478485 8:142807876-142807898 TCCTCAGCCCAGGCCTGGGAAGG + Intergenic
1049985626 9:948208-948230 AACCCAGCCCCGGCCTGCTCAGG + Intronic
1053434571 9:38066862-38066884 ACCTTTGCCCAGGCCTGGGCTGG - Intronic
1057092845 9:92275675-92275697 AGCCCAGCCATGGCCTGGGTAGG - Intronic
1060228818 9:121812458-121812480 TGCTCTGCTCCGGCCTGGGAAGG + Intergenic
1060808745 9:126596855-126596877 AGTTCAGGACCAGCCTGGGCTGG - Intergenic
1060889219 9:127177593-127177615 TGCTCAGCGCAGACCTGGGCTGG - Intronic
1061178308 9:129010196-129010218 AGCTCCTGCTCGGCCTGGGCAGG + Exonic
1061423400 9:130484251-130484273 AGCTCAGCTGGGGCCTGGGCTGG - Intronic
1061480490 9:130895639-130895661 AGCTCAGGCCCTGCCCAGGCAGG - Intergenic
1061517564 9:131098398-131098420 AGCCAAGCCCCAGGCTGGGCAGG - Intronic
1061545661 9:131302688-131302710 TGCTCAGCCCCCTCCTGTGCTGG + Intronic
1061571138 9:131478060-131478082 AGCTCGGCCAGGCCCTGGGCTGG + Intronic
1061811791 9:133166622-133166644 AGCTCAGGGCCAGCCTGGGTGGG + Intergenic
1061815500 9:133192167-133192189 AGCTCAGGGCCAGCCTGGGTGGG + Intergenic
1061874817 9:133538423-133538445 AGGTGAGGCCCGGCCCGGGCAGG + Exonic
1062035163 9:134379703-134379725 ACCTGAGGCCCAGCCTGGGCGGG + Intronic
1062340205 9:136090781-136090803 AGGGCAGCCCGGCCCTGGGCTGG - Intronic
1062464667 9:136675731-136675753 ACATCAGCCCCAGGCTGGGCAGG + Intronic
1062472497 9:136712600-136712622 GCCTCAGCCCCGGCCCGGCCCGG - Exonic
1062598983 9:137311681-137311703 GGCCCTGCCCCGGCCAGGGCTGG + Intronic
1062713580 9:137990302-137990324 AGCTCAGACTCTGCTTGGGCGGG - Intronic
1187588853 X:20693525-20693547 AGCTCAGCCTCTTCTTGGGCGGG - Intergenic
1191688754 X:63919054-63919076 AGCTCTATCCAGGCCTGGGCTGG - Intergenic
1192107015 X:68326735-68326757 GGATCAGCCCCTGCCTGGCCAGG + Intronic
1192165006 X:68822729-68822751 AGCTCAGCCCAGGCCAGCACCGG + Intergenic
1192181792 X:68920774-68920796 AGCTGAGCCCAGGCCGGGGCTGG + Intergenic
1192248087 X:69389458-69389480 AGTGCAGCCCCCGACTGGGCTGG - Intergenic
1192368142 X:70492143-70492165 AGCTGAGCCCCTGGCTTGGCAGG - Exonic
1194602558 X:95940538-95940560 AGCTCAGCCTCTCCTTGGGCGGG - Intergenic
1195675885 X:107506979-107507001 AGCCCAGCCCCGGCCCGGAGGGG + Intergenic
1195795462 X:108642234-108642256 AGCTCAGACCCTCCTTGGGCAGG - Intronic
1196231886 X:113233620-113233642 AGCTCAGCCTCTTCTTGGGCAGG + Intergenic
1196949007 X:120857332-120857354 AGCTCAGCCTCTCCTTGGGCAGG - Intergenic
1200043536 X:153387643-153387665 AGCACACCACAGGCCTGGGCTGG - Intergenic
1200096332 X:153665850-153665872 AACTCAGCCACCGCCTGGCCAGG + Intergenic