ID: 927949627

View in Genome Browser
Species Human (GRCh38)
Location 2:27158881-27158903
Sequence AGCTCAGCCCCGGCCTGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927949627_927949639 28 Left 927949627 2:27158881-27158903 CCGGCCCAGGCCGGGGCTGAGCT No data
Right 927949639 2:27158932-27158954 CCAAGCCAGTGCAGTCCTGTGGG No data
927949627_927949637 27 Left 927949627 2:27158881-27158903 CCGGCCCAGGCCGGGGCTGAGCT No data
Right 927949637 2:27158931-27158953 ACCAAGCCAGTGCAGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927949627 Original CRISPR AGCTCAGCCCCGGCCTGGGC CGG (reversed) Intergenic