ID: 927951559

View in Genome Browser
Species Human (GRCh38)
Location 2:27173377-27173399
Sequence TCTCCCTGAGTGGATGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927951559_927951563 -1 Left 927951559 2:27173377-27173399 CCCAGTGCATCCACTCAGGGAGA No data
Right 927951563 2:27173399-27173421 ACCCCTTCCCCAGACAGTGGAGG No data
927951559_927951562 -4 Left 927951559 2:27173377-27173399 CCCAGTGCATCCACTCAGGGAGA No data
Right 927951562 2:27173396-27173418 GAGACCCCTTCCCCAGACAGTGG No data
927951559_927951571 9 Left 927951559 2:27173377-27173399 CCCAGTGCATCCACTCAGGGAGA No data
Right 927951571 2:27173409-27173431 CAGACAGTGGAGGGTCATGACGG No data
927951559_927951573 11 Left 927951559 2:27173377-27173399 CCCAGTGCATCCACTCAGGGAGA No data
Right 927951573 2:27173411-27173433 GACAGTGGAGGGTCATGACGGGG No data
927951559_927951565 0 Left 927951559 2:27173377-27173399 CCCAGTGCATCCACTCAGGGAGA No data
Right 927951565 2:27173400-27173422 CCCCTTCCCCAGACAGTGGAGGG No data
927951559_927951572 10 Left 927951559 2:27173377-27173399 CCCAGTGCATCCACTCAGGGAGA No data
Right 927951572 2:27173410-27173432 AGACAGTGGAGGGTCATGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927951559 Original CRISPR TCTCCCTGAGTGGATGCACT GGG (reversed) Intergenic
No off target data available for this crispr