ID: 927951560

View in Genome Browser
Species Human (GRCh38)
Location 2:27173378-27173400
Sequence GTCTCCCTGAGTGGATGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927951560_927951571 8 Left 927951560 2:27173378-27173400 CCAGTGCATCCACTCAGGGAGAC No data
Right 927951571 2:27173409-27173431 CAGACAGTGGAGGGTCATGACGG No data
927951560_927951562 -5 Left 927951560 2:27173378-27173400 CCAGTGCATCCACTCAGGGAGAC No data
Right 927951562 2:27173396-27173418 GAGACCCCTTCCCCAGACAGTGG No data
927951560_927951563 -2 Left 927951560 2:27173378-27173400 CCAGTGCATCCACTCAGGGAGAC No data
Right 927951563 2:27173399-27173421 ACCCCTTCCCCAGACAGTGGAGG No data
927951560_927951572 9 Left 927951560 2:27173378-27173400 CCAGTGCATCCACTCAGGGAGAC No data
Right 927951572 2:27173410-27173432 AGACAGTGGAGGGTCATGACGGG No data
927951560_927951565 -1 Left 927951560 2:27173378-27173400 CCAGTGCATCCACTCAGGGAGAC No data
Right 927951565 2:27173400-27173422 CCCCTTCCCCAGACAGTGGAGGG No data
927951560_927951573 10 Left 927951560 2:27173378-27173400 CCAGTGCATCCACTCAGGGAGAC No data
Right 927951573 2:27173411-27173433 GACAGTGGAGGGTCATGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927951560 Original CRISPR GTCTCCCTGAGTGGATGCAC TGG (reversed) Intergenic
No off target data available for this crispr