ID: 927951561

View in Genome Browser
Species Human (GRCh38)
Location 2:27173387-27173409
Sequence GGGGAAGGGGTCTCCCTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927951561_927951572 0 Left 927951561 2:27173387-27173409 CCACTCAGGGAGACCCCTTCCCC No data
Right 927951572 2:27173410-27173432 AGACAGTGGAGGGTCATGACGGG No data
927951561_927951574 27 Left 927951561 2:27173387-27173409 CCACTCAGGGAGACCCCTTCCCC No data
Right 927951574 2:27173437-27173459 CTTTTTAGCTGCGTCCCACCAGG No data
927951561_927951573 1 Left 927951561 2:27173387-27173409 CCACTCAGGGAGACCCCTTCCCC No data
Right 927951573 2:27173411-27173433 GACAGTGGAGGGTCATGACGGGG No data
927951561_927951571 -1 Left 927951561 2:27173387-27173409 CCACTCAGGGAGACCCCTTCCCC No data
Right 927951571 2:27173409-27173431 CAGACAGTGGAGGGTCATGACGG No data
927951561_927951565 -10 Left 927951561 2:27173387-27173409 CCACTCAGGGAGACCCCTTCCCC No data
Right 927951565 2:27173400-27173422 CCCCTTCCCCAGACAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927951561 Original CRISPR GGGGAAGGGGTCTCCCTGAG TGG (reversed) Intergenic
No off target data available for this crispr