ID: 927951571

View in Genome Browser
Species Human (GRCh38)
Location 2:27173409-27173431
Sequence CAGACAGTGGAGGGTCATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927951560_927951571 8 Left 927951560 2:27173378-27173400 CCAGTGCATCCACTCAGGGAGAC No data
Right 927951571 2:27173409-27173431 CAGACAGTGGAGGGTCATGACGG No data
927951558_927951571 10 Left 927951558 2:27173376-27173398 CCCCAGTGCATCCACTCAGGGAG No data
Right 927951571 2:27173409-27173431 CAGACAGTGGAGGGTCATGACGG No data
927951559_927951571 9 Left 927951559 2:27173377-27173399 CCCAGTGCATCCACTCAGGGAGA No data
Right 927951571 2:27173409-27173431 CAGACAGTGGAGGGTCATGACGG No data
927951561_927951571 -1 Left 927951561 2:27173387-27173409 CCACTCAGGGAGACCCCTTCCCC No data
Right 927951571 2:27173409-27173431 CAGACAGTGGAGGGTCATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927951571 Original CRISPR CAGACAGTGGAGGGTCATGA CGG Intergenic
No off target data available for this crispr