ID: 927951572

View in Genome Browser
Species Human (GRCh38)
Location 2:27173410-27173432
Sequence AGACAGTGGAGGGTCATGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927951559_927951572 10 Left 927951559 2:27173377-27173399 CCCAGTGCATCCACTCAGGGAGA No data
Right 927951572 2:27173410-27173432 AGACAGTGGAGGGTCATGACGGG No data
927951560_927951572 9 Left 927951560 2:27173378-27173400 CCAGTGCATCCACTCAGGGAGAC No data
Right 927951572 2:27173410-27173432 AGACAGTGGAGGGTCATGACGGG No data
927951561_927951572 0 Left 927951561 2:27173387-27173409 CCACTCAGGGAGACCCCTTCCCC No data
Right 927951572 2:27173410-27173432 AGACAGTGGAGGGTCATGACGGG No data
927951558_927951572 11 Left 927951558 2:27173376-27173398 CCCCAGTGCATCCACTCAGGGAG No data
Right 927951572 2:27173410-27173432 AGACAGTGGAGGGTCATGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927951572 Original CRISPR AGACAGTGGAGGGTCATGAC GGG Intergenic
No off target data available for this crispr