ID: 927951574

View in Genome Browser
Species Human (GRCh38)
Location 2:27173437-27173459
Sequence CTTTTTAGCTGCGTCCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927951561_927951574 27 Left 927951561 2:27173387-27173409 CCACTCAGGGAGACCCCTTCCCC No data
Right 927951574 2:27173437-27173459 CTTTTTAGCTGCGTCCCACCAGG No data
927951569_927951574 7 Left 927951569 2:27173407-27173429 CCCAGACAGTGGAGGGTCATGAC No data
Right 927951574 2:27173437-27173459 CTTTTTAGCTGCGTCCCACCAGG No data
927951564_927951574 14 Left 927951564 2:27173400-27173422 CCCCTTCCCCAGACAGTGGAGGG No data
Right 927951574 2:27173437-27173459 CTTTTTAGCTGCGTCCCACCAGG No data
927951570_927951574 6 Left 927951570 2:27173408-27173430 CCAGACAGTGGAGGGTCATGACG No data
Right 927951574 2:27173437-27173459 CTTTTTAGCTGCGTCCCACCAGG No data
927951568_927951574 8 Left 927951568 2:27173406-27173428 CCCCAGACAGTGGAGGGTCATGA No data
Right 927951574 2:27173437-27173459 CTTTTTAGCTGCGTCCCACCAGG No data
927951567_927951574 12 Left 927951567 2:27173402-27173424 CCTTCCCCAGACAGTGGAGGGTC No data
Right 927951574 2:27173437-27173459 CTTTTTAGCTGCGTCCCACCAGG No data
927951566_927951574 13 Left 927951566 2:27173401-27173423 CCCTTCCCCAGACAGTGGAGGGT No data
Right 927951574 2:27173437-27173459 CTTTTTAGCTGCGTCCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927951574 Original CRISPR CTTTTTAGCTGCGTCCCACC AGG Intergenic
No off target data available for this crispr