ID: 927956283

View in Genome Browser
Species Human (GRCh38)
Location 2:27209755-27209777
Sequence TTGGGCAGACACTGGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 233}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927956275_927956283 3 Left 927956275 2:27209729-27209751 CCTTTCCGCTCTCCCACAGTGTG 0: 1
1: 0
2: 0
3: 19
4: 190
Right 927956283 2:27209755-27209777 TTGGGCAGACACTGGCTGGCTGG 0: 1
1: 0
2: 2
3: 14
4: 233
927956274_927956283 26 Left 927956274 2:27209706-27209728 CCACTAGGAGAAAGATTAGGCTG 0: 1
1: 0
2: 1
3: 10
4: 129
Right 927956283 2:27209755-27209777 TTGGGCAGACACTGGCTGGCTGG 0: 1
1: 0
2: 2
3: 14
4: 233
927956280_927956283 -10 Left 927956280 2:27209742-27209764 CCACAGTGTGTTCTTGGGCAGAC 0: 1
1: 0
2: 2
3: 14
4: 167
Right 927956283 2:27209755-27209777 TTGGGCAGACACTGGCTGGCTGG 0: 1
1: 0
2: 2
3: 14
4: 233
927956276_927956283 -2 Left 927956276 2:27209734-27209756 CCGCTCTCCCACAGTGTGTTCTT 0: 1
1: 0
2: 3
3: 40
4: 377
Right 927956283 2:27209755-27209777 TTGGGCAGACACTGGCTGGCTGG 0: 1
1: 0
2: 2
3: 14
4: 233
927956273_927956283 27 Left 927956273 2:27209705-27209727 CCCACTAGGAGAAAGATTAGGCT 0: 1
1: 0
2: 0
3: 8
4: 114
Right 927956283 2:27209755-27209777 TTGGGCAGACACTGGCTGGCTGG 0: 1
1: 0
2: 2
3: 14
4: 233
927956279_927956283 -9 Left 927956279 2:27209741-27209763 CCCACAGTGTGTTCTTGGGCAGA 0: 1
1: 0
2: 5
3: 26
4: 249
Right 927956283 2:27209755-27209777 TTGGGCAGACACTGGCTGGCTGG 0: 1
1: 0
2: 2
3: 14
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927956283 Original CRISPR TTGGGCAGACACTGGCTGGC TGG Intronic
900247247 1:1642498-1642520 ATGTGCAGACACTGGCGCGCAGG + Exonic
900258471 1:1709630-1709652 ATGTGCAGACACTGGCGCGCAGG + Exonic
900594794 1:3475860-3475882 GTGGGCAGCCAGAGGCTGGCTGG + Intronic
900641550 1:3690168-3690190 TTGGGCAGGCAGTGGAAGGCAGG + Intronic
901019254 1:6247702-6247724 TGGAGGAGACACTGGCTAGCTGG + Exonic
901056594 1:6451286-6451308 CTGGGCAGTCAGTGGCTGGGCGG + Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
902222920 1:14978179-14978201 TTGGGCACATGCTTGCTGGCAGG + Intronic
902324613 1:15691561-15691583 TTGGGCAGACAGTGCCTCACCGG + Intronic
902465163 1:16613109-16613131 TGGGGAAGAAACTCGCTGGCGGG - Intronic
903155644 1:21440562-21440584 TGGGGAAGAAACTCGCTGGCGGG + Intronic
905825256 1:41021816-41021838 TTGGCCAGCCACAGGCAGGCTGG + Exonic
906319729 1:44808551-44808573 CTGGGAAGAAGCTGGCTGGCTGG - Exonic
907333788 1:53687673-53687695 ATGGGAAGACCCTGGCTGGGTGG - Intronic
910656540 1:89625075-89625097 TCGGGAAGATACTGGCTGACTGG + Intergenic
912550953 1:110484984-110485006 GTGGGCAGAGAGTGGCTGGTGGG - Intergenic
913600298 1:120415494-120415516 TGGGGAAGAAACTCGCTGGCGGG + Intergenic
913994751 1:143642991-143643013 TGGGGAAGAAACTCGCTGGCGGG - Intergenic
914086759 1:144461173-144461195 TGGGGAAGAAACTCGCTGGCGGG - Intronic
914192658 1:145425110-145425132 TGGGGAAGAAACTCGCTGGCGGG - Intergenic
914590568 1:149103059-149103081 TGGGGAAGAAACTCGCTGGCGGG - Intronic
915047052 1:153026738-153026760 TTGGGCAGACACTGTCTAGGTGG - Intergenic
916578694 1:166089049-166089071 CTCGGCAGACACTGTCTGGAAGG + Intronic
919719368 1:200815318-200815340 TTGAGCAGACACTGTATGTCAGG - Intronic
919756415 1:201068931-201068953 TGGGGGAGCCACAGGCTGGCTGG + Intronic
920121954 1:203665395-203665417 TTGGGTAGGCACAGGCTAGCAGG + Intronic
921054683 1:211534939-211534961 CTGGGCAGTAAATGGCTGGCTGG + Intergenic
1063501647 10:6560452-6560474 TTCTGCAAACACTGGCTGGGAGG + Intronic
1064005659 10:11696955-11696977 CTGGGTAGAGGCTGGCTGGCTGG - Intergenic
1065385156 10:25126777-25126799 TTGGGCAGGAACTGTCTGCCTGG - Intergenic
1066956694 10:42179540-42179562 TTGCTCAGAAACTGGCTTGCAGG - Intergenic
1068686996 10:59880893-59880915 CTGGGCAGAGACTGGATAGCAGG - Intronic
1069815416 10:71190885-71190907 TTGAGGAGATATTGGCTGGCAGG + Intergenic
1071837778 10:89436564-89436586 TTAGGCAGGCAGTGGGTGGCAGG - Intronic
1073180286 10:101579254-101579276 CTGGGCAGACACTGGGAGCCGGG + Exonic
1073248860 10:102109569-102109591 TGGGGCAGAAACTGGGTGGTCGG + Intronic
1074079547 10:110156818-110156840 TGGGGCAGCCACTGGGTGGAGGG + Intergenic
1075602081 10:123777219-123777241 ATAGGCAGACACAGGCTGGAAGG - Intronic
1076422577 10:130341617-130341639 TTGGGCATACAATGGAAGGCTGG + Intergenic
1076848561 10:133081957-133081979 GGGTGCAGCCACTGGCTGGCGGG + Intronic
1076902693 10:133347709-133347731 TTGGGCAGTCACAGGCCTGCTGG - Intronic
1077281107 11:1746684-1746706 CTGGGCAGAGGCTGGCTGGGAGG - Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1077403909 11:2374178-2374200 TTGGGCAGACACGCCCAGGCAGG - Intergenic
1078148717 11:8740815-8740837 TGGGGCAGTCACTGAGTGGCAGG - Intronic
1078611061 11:12819987-12820009 GTGGGCAGAGACTGGGTGGTTGG + Intronic
1078927802 11:15890221-15890243 GTGGGCAGACCCAGGCTGCCAGG - Intergenic
1081581124 11:44352881-44352903 TTGGGCTGAAACTGGCCTGCTGG - Intergenic
1082755980 11:57076983-57077005 GTGGGCAGTCAATGGCTGGTTGG - Intergenic
1083018157 11:59477854-59477876 TTGGGCTCACAGTGGCTGCCTGG + Exonic
1083019460 11:59492076-59492098 TTGGGCTCACAGTGGCTGCCTGG + Intergenic
1084486202 11:69449750-69449772 TTGGGCAGACACAGCCTCCCAGG - Intergenic
1084959057 11:72706721-72706743 TGGGTCAGACTCTGGCTGGTGGG - Intronic
1085850033 11:80109414-80109436 ATGGGCAGACACTGAGCGGCAGG + Intergenic
1088526723 11:110763743-110763765 TTGGCCAGTGACTGGCTGCCAGG - Intergenic
1088699760 11:112401176-112401198 TGGGGCTGACATTTGCTGGCTGG + Intergenic
1089894410 11:121914724-121914746 TTGGCCAGTCACTGGCTCCCAGG - Intergenic
1091771942 12:3157784-3157806 CTGGGCAGACGCTGGCAGGCAGG + Intronic
1093512878 12:19949609-19949631 TTTGGCAGAGACTGGCAGGCAGG - Intergenic
1096875945 12:54630685-54630707 TTGGCCAGTCACAGGCTGCCTGG - Intergenic
1099709887 12:86210281-86210303 TGGGGCAGTCACTGGCTTGCAGG + Intronic
1099996151 12:89781121-89781143 TGGGGCAGACACTGGTTGTGTGG + Intergenic
1100608417 12:96170570-96170592 TAGAGCAGAGACTGGCTGGAGGG + Intergenic
1102683171 12:114704221-114704243 GAGGGCAGAAACTGGCTGGAGGG - Intergenic
1104113145 12:125723066-125723088 TGTGGCAGAGACTGGCTGGCTGG + Intergenic
1104979957 12:132569346-132569368 TTGGGCAGGGACTGGGTGGGAGG - Intronic
1105779542 13:23695058-23695080 GTCGGGAGACACTGGCTGGAGGG + Intergenic
1106480878 13:30135988-30136010 ATGGGCGGACACTGGTTTGCAGG + Intergenic
1107770758 13:43786341-43786363 CGGAGCTGACACTGGCTGGCGGG + Intronic
1110436481 13:75482157-75482179 TGGGGCAGACACTGGGTGGCTGG + Intergenic
1113535314 13:111061941-111061963 TAGGGCAGCCACTTGCAGGCTGG - Intergenic
1115457059 14:33615798-33615820 TAGGGCAGACACTGACTCTCTGG - Intronic
1118674225 14:68165455-68165477 TGGGGAAGACAGTGGCTGGTAGG + Intronic
1119871486 14:78021746-78021768 TTGAACACAGACTGGCTGGCTGG + Intergenic
1122693340 14:103541670-103541692 TCTGGCAGAGCCTGGCTGGCAGG - Intergenic
1122794052 14:104196928-104196950 TTGGGCAGACATCGCCTGCCTGG + Intergenic
1122877211 14:104673753-104673775 TTGGGGAGACCCTGGCCTGCTGG + Intergenic
1124722251 15:32120529-32120551 TGTGGCCCACACTGGCTGGCAGG - Intronic
1128325727 15:66722839-66722861 CTTGGCAGACACAGGTTGGCTGG - Intronic
1129152707 15:73699231-73699253 TTTGGCAGACAGTAGCTGGTAGG - Intronic
1129227654 15:74179341-74179363 TGGGCCAGACACTGGGTGGAAGG - Intergenic
1131112931 15:89776697-89776719 TTGGTCAGGCTCTGGCCGGCCGG - Exonic
1131805214 15:96114884-96114906 ATGGGAAGAGGCTGGCTGGCTGG + Intergenic
1132649400 16:1013794-1013816 TTGGGCAGGCAGAGGCTGCCAGG + Intergenic
1132742248 16:1420642-1420664 GAGGGCAGACACCGGCGGGCGGG - Intronic
1132929980 16:2454133-2454155 AAGGGCAGGCACTGGGTGGCTGG + Intronic
1133722966 16:8512104-8512126 TTGGGCACATACTGTATGGCAGG + Intergenic
1135220480 16:20610792-20610814 TTGCTCAGACGCTGGCTGGCAGG + Intronic
1135221149 16:20614911-20614933 TTGCTAAGAGACTGGCTGGCAGG + Intronic
1136006644 16:27334953-27334975 TGGGACAGACCCTGGCTGTCAGG + Intronic
1136221996 16:28835050-28835072 GGGGGCAAACACCGGCTGGCGGG - Exonic
1136517679 16:30777736-30777758 GTGGGGAGACACTTTCTGGCTGG + Intergenic
1137720815 16:50626397-50626419 TGGGACAGAGACTGGCTGGAAGG + Intronic
1137736896 16:50731490-50731512 TTGGGGAGTCTGTGGCTGGCTGG + Intronic
1138161439 16:54758528-54758550 CTGGGTGGACACAGGCTGGCTGG + Intergenic
1138231997 16:55344765-55344787 TTTGGTAGAGGCTGGCTGGCTGG - Intergenic
1139040112 16:62989727-62989749 GTGGGCAAACTCTGGCTGCCAGG + Intergenic
1139103015 16:63791475-63791497 TTGGACAGACAGTTGCTGACAGG - Intergenic
1140683968 16:77415191-77415213 TTGAGCATATACTGGCTGACAGG - Intronic
1141149158 16:81552254-81552276 TTGGGCTGATAAGGGCTGGCTGG + Intronic
1141852737 16:86658551-86658573 TGTGGCAGAGACTGGCTGACAGG - Intergenic
1142687631 17:1586881-1586903 TTGAACAGAGACTGGCTGGGAGG + Intronic
1143660586 17:8322276-8322298 CAAGGCAGACAGTGGCTGGCAGG + Exonic
1143697277 17:8630187-8630209 GGAGGCAGACACTGGCTCGCGGG + Intronic
1145788158 17:27607664-27607686 ATGGGCAGGCACTGGCTCTCAGG + Intronic
1146399763 17:32493659-32493681 CTGGGCAGAAACTGGCAAGCTGG + Exonic
1147140938 17:38460407-38460429 GTGTGCAGACGCTGGCTGGCAGG - Intronic
1147400295 17:40176967-40176989 GTGGGCAGGTACTGGCAGGCAGG - Intergenic
1147605061 17:41769718-41769740 CTGGGCAGACACTGGGGAGCAGG + Intronic
1147918272 17:43901205-43901227 TTGGTCAGCCACTGGGAGGCAGG + Intronic
1148458355 17:47822979-47823001 TTGGACAGGCACTGTCTGGCAGG - Intergenic
1150225660 17:63523259-63523281 GAGGGCAGACGCAGGCTGGCGGG + Intergenic
1151785810 17:76274369-76274391 CTGGGCTGACACAGGCTGGAGGG + Intronic
1151889635 17:76944507-76944529 TGGGGCAGCAACTGGCTGCCAGG + Intronic
1152326883 17:79646810-79646832 TGGGGCAGAGGGTGGCTGGCAGG - Intergenic
1152421522 17:80195824-80195846 TTTGGCTTACGCTGGCTGGCAGG - Intronic
1152568128 17:81109234-81109256 TTGAGCAGAAACTGCCAGGCAGG + Intronic
1153942597 18:9990788-9990810 CTGGACAGACAATGGCTGGTGGG - Intergenic
1155174439 18:23290281-23290303 CTGGGCAGGCCCTTGCTGGCTGG - Intronic
1155989155 18:32261162-32261184 TTGCGCAGTCATTGGCTGGGTGG + Intronic
1156084530 18:33382752-33382774 TTGGGCAGGCACTGGGCTGCAGG + Intronic
1157209682 18:45731136-45731158 GTGGGCTCTCACTGGCTGGCTGG + Exonic
1157436141 18:47671009-47671031 GTGGGAAGAAACTGGCTGGTGGG - Intergenic
1157452787 18:47800858-47800880 TTGGGAAAACAGAGGCTGGCTGG + Intergenic
1157480021 18:48047931-48047953 TGGCTCAGACATTGGCTGGCTGG - Intronic
1160396751 18:78577917-78577939 TTGGGAAGACAGTGTCTGGAAGG - Intergenic
1160591748 18:79948839-79948861 TTGGGGAGACGCTGGTCGGCAGG - Intronic
1160999358 19:1901984-1902006 TAAGTCAGACACTGGCGGGCTGG - Intergenic
1162450182 19:10749699-10749721 ATGAGCACACACTGTCTGGCAGG + Intronic
1162925940 19:13930575-13930597 AGGGGCACATACTGGCTGGCAGG - Exonic
1162966923 19:14160492-14160514 CTGGGGAGACATGGGCTGGCAGG - Intronic
1163170877 19:15530243-15530265 TTGGGCTGACTCTGACTGGCAGG + Intronic
1163931150 19:20393277-20393299 TTGGCCAGACTGTGGCTGGTAGG + Intergenic
1164526755 19:29018683-29018705 TTGGGAAGGCACAGGGTGGCAGG + Intergenic
1164896312 19:31880444-31880466 TTTGGCAGACAAGGGCTTGCAGG - Intergenic
1165589554 19:36955859-36955881 ATGGAAAGAAACTGGCTGGCCGG + Intronic
1165996686 19:39848678-39848700 TGGAGGAGACACTGGCAGGCAGG + Intergenic
1168152574 19:54456807-54456829 TGGGGCTGACCCTGACTGGCAGG + Exonic
927956283 2:27209755-27209777 TTGGGCAGACACTGGCTGGCTGG + Intronic
928926392 2:36584133-36584155 ATTGGCAGACACTGGCAGACTGG + Intronic
929962804 2:46509027-46509049 GTGGGAAGACAGTGGCTGGAAGG - Intronic
932338136 2:70942729-70942751 TGGGTCAGCCACAGGCTGGCAGG - Intronic
934793532 2:97082528-97082550 TTGGGTTGTCACTGTCTGGCAGG - Intergenic
935489449 2:103698611-103698633 TTGGGCAGGCACTGGGCTGCAGG - Intergenic
936284647 2:111172886-111172908 TGGGGCAGACCCTGGCTGGCTGG - Intergenic
936463151 2:112726159-112726181 CAGGGCAGACACAGGCAGGCAGG + Intronic
937251912 2:120529274-120529296 TTGGGCCGCCGCTAGCTGGCAGG - Intergenic
937441083 2:121916818-121916840 TGGGACAGTCACTGGCTGCCAGG - Intergenic
938977792 2:136495785-136495807 TTGGGCCGAGACTCGCGGGCAGG + Intergenic
940585188 2:155639210-155639232 TTTGGCAGGTACAGGCTGGCAGG - Intergenic
942316331 2:174699627-174699649 TTGAGCATTCACTGGCTGCCAGG - Intergenic
942600165 2:177632926-177632948 CTGGGAAAAAACTGGCTGGCTGG - Intronic
945487711 2:210417180-210417202 GTGGGCAGATGCTTGCTGGCAGG + Intergenic
945888451 2:215402201-215402223 TTGGGAAGACTCTAGGTGGCTGG - Intronic
948368546 2:237473797-237473819 CTGCCCAGACCCTGGCTGGCAGG + Intergenic
948632413 2:239310584-239310606 AAGGGCAGACCCAGGCTGGCAGG + Intronic
948659254 2:239497129-239497151 TGGGGCAGTCACTGATTGGCTGG - Intergenic
1169217807 20:3803555-3803577 CAGGGCAGACACTAGCTGGCTGG - Intronic
1171134933 20:22687574-22687596 CTGGGCAGTCACTGTCTGGGTGG + Intergenic
1172408510 20:34705931-34705953 GGGGGCAGGCACTGGCTGGCTGG + Intronic
1173010554 20:39177881-39177903 TAGGGCTGCCACTTGCTGGCTGG - Intergenic
1173054807 20:39601128-39601150 CAGGACAGACACTGGTTGGCAGG - Intergenic
1174529393 20:51199067-51199089 TTGGGCAGAAGCTGACCGGCAGG - Intergenic
1175538848 20:59735684-59735706 TTGGGCAGCCCCTGGGTGCCAGG + Intronic
1175914166 20:62418099-62418121 CTGGTCAGACACTGGCGGGCGGG - Intronic
1176086174 20:63296568-63296590 CTGGGCAGACAGCGGCTGGTGGG - Intronic
1179959369 21:44759476-44759498 TTTGGCTGACAGTGGCTGGTAGG + Intergenic
1180796667 22:18609105-18609127 TTGGACAGAGGTTGGCTGGCAGG + Exonic
1181056293 22:20261951-20261973 TTAGGCAGGCAGTGCCTGGCTGG + Intronic
1181225057 22:21386166-21386188 TTGGACAGAGGTTGGCTGGCAGG - Exonic
1181253575 22:21548647-21548669 TTGGACAGAGGTTGGCTGGCAGG + Exonic
1181855647 22:25779890-25779912 TTGGGCAGGGAGTGGGTGGCAGG + Intronic
1183947488 22:41334899-41334921 TTGCACAGACACTGTCTTGCAGG - Intronic
1185016556 22:48346522-48346544 ATGGGGAGACGCTGGCTGGGGGG + Intergenic
1185221759 22:49632538-49632560 TTCGGAAGACACTGGCTCCCTGG + Intronic
950256381 3:11510097-11510119 TTCTGCAGACACCAGCTGGCTGG - Intronic
951780421 3:26356824-26356846 GTGGTCAGTCACTGGCTGGAAGG + Intergenic
951980426 3:28560159-28560181 TTGGGAAGATATTGGCAGGCTGG - Intergenic
954306382 3:49727716-49727738 CTGGGCAAACACTGTCTGGAAGG + Intronic
954758507 3:52856722-52856744 TTGAGCAGACAGTGGATGTCTGG + Intronic
955345111 3:58155186-58155208 GTGGGCAGACAGAGGCTGGTTGG - Intronic
956552738 3:70479794-70479816 GTGGGCAAACAATGGCTGGCAGG + Intergenic
957275666 3:78088186-78088208 TGGGGCAAACACTGACTGGGAGG + Intergenic
958936500 3:100261230-100261252 TTGGGCAGAACCAGGCAGGCAGG - Intronic
960150093 3:114240573-114240595 TTGGGGAGACTCTTGCTGTCTGG - Intergenic
961404558 3:126668928-126668950 AGGGGCAGTCACTCGCTGGCAGG - Intergenic
967355733 3:188568862-188568884 GTGGGCAGACAGTGGCTGCAGGG + Intronic
968461245 4:726080-726102 TGGGGCAGAGGCTGGCGGGCAGG + Intronic
968978773 4:3835569-3835591 CTGGCCAGAGCCTGGCTGGCAGG + Intergenic
969630699 4:8334246-8334268 TTGGGCAGTGACTGGCTAGAAGG + Intergenic
978964552 4:114725497-114725519 ATGCGCAGCCACAGGCTGGCGGG + Intergenic
982223110 4:153141461-153141483 GTGGTCTGTCACTGGCTGGCTGG - Intergenic
984713201 4:182903209-182903231 TAAGAAAGACACTGGCTGGCAGG + Intronic
985333374 4:188865543-188865565 TTGAGATGACACTGGCTGGATGG + Intergenic
985800731 5:2004129-2004151 ATGGGCAGACTCGGGTTGGCTGG + Intergenic
989173755 5:38499855-38499877 TTGGCCACACACTGGCTTCCTGG + Intronic
990686785 5:58312384-58312406 TTGGGCAGACACGGGAAGGGAGG - Intergenic
991026803 5:62038272-62038294 GTGGGCAGAGATAGGCTGGCTGG + Intergenic
998030268 5:138860831-138860853 TTTTGCACACACTGGCTTGCAGG + Intronic
1002185802 5:177454359-177454381 TTGGGCAGCCAGGGGCTGCCAGG + Intronic
1003564649 6:7213006-7213028 TTGGGCACAGACTGGTTGTCAGG + Intronic
1003565568 6:7219489-7219511 GTGGTCAGGCAGTGGCTGGCGGG + Intronic
1003621643 6:7705951-7705973 TTGGGCAGACTGAGGCTGTCTGG + Intergenic
1003679383 6:8236979-8237001 CTGTCCAGAAACTGGCTGGCTGG - Intergenic
1006098220 6:31669486-31669508 CTGGGCACAAACTGGTTGGCAGG - Exonic
1012408391 6:98927643-98927665 TAGGGCAGTCCATGGCTGGCTGG + Intronic
1016617947 6:146074589-146074611 TTGGGTAGCCACTTCCTGGCAGG + Intronic
1017685755 6:156912683-156912705 ATATGCAGACACAGGCTGGCTGG - Intronic
1018469847 6:164085608-164085630 TAGGGCAGCCACTGGCCGGGCGG - Intergenic
1019317181 7:392114-392136 TTTGGCCGATCCTGGCTGGCTGG - Intergenic
1020557658 7:9690877-9690899 TTGGGCAGGCACTGACCGGCAGG + Intergenic
1021112634 7:16713109-16713131 TGAGTCAGACACAGGCTGGCAGG - Intergenic
1025030220 7:55550782-55550804 TTGCGCAGAAAATGGCTGGAAGG + Intronic
1025190328 7:56891299-56891321 ATGGGCAGACACAGGGTGGAAGG - Intergenic
1025681611 7:63685621-63685643 ATGGGCAGACACAGGGTGGAAGG + Intergenic
1026844075 7:73687705-73687727 TTTGGGAGGCACTGGCTTGCAGG - Intronic
1027197005 7:76037553-76037575 TTGAGCAGACACAGGGAGGCAGG - Intronic
1027702803 7:81488761-81488783 TTAGGCAGATACTTGCTTGCAGG - Intergenic
1038772009 8:30491440-30491462 TTGGGCACACACAGGGTGGGAGG + Intronic
1039434114 8:37547869-37547891 CTGGGCAGTTGCTGGCTGGCTGG + Intergenic
1039438803 8:37580379-37580401 TGGGGCAGAGAGTGTCTGGCAGG + Intergenic
1039478047 8:37851570-37851592 TCGGGCACACACAGGCTGGGAGG + Intergenic
1040435543 8:47387393-47387415 TAGGGCAGACCCTGGCAGGAGGG + Intronic
1041656136 8:60352333-60352355 TTTGTCAGCCACTGGCCGGCTGG - Intergenic
1043346771 8:79307160-79307182 TGGGGCAGCCTCAGGCTGGCGGG + Intergenic
1048163656 8:132042796-132042818 TTGCTTAGACACTGGCTGGTGGG + Intronic
1049352599 8:142172062-142172084 TGGGGCACCCACAGGCTGGCTGG + Intergenic
1049604911 8:143524817-143524839 TGGGGCAGAGCGTGGCTGGCAGG - Intronic
1050527447 9:6558289-6558311 TTGGGCAGAAAGAGGCAGGCAGG + Intronic
1051982875 9:23045776-23045798 TTGGGCAGACACTGTGCTGCAGG + Intergenic
1053412555 9:37925151-37925173 CTGGGCAGACCCTGGTGGGCGGG - Intronic
1055785634 9:79866308-79866330 TTGTGCTGTCACTGGGTGGCTGG - Intergenic
1057380166 9:94560215-94560237 TTGTGCAGAGACTGGCAAGCAGG - Intronic
1057720582 9:97528702-97528724 AGGGGCAGACACCTGCTGGCTGG - Intronic
1061369781 9:130191825-130191847 TGGGGCACACAGCGGCTGGCAGG - Intronic
1061371650 9:130200881-130200903 ATGGGCAGACATTCGCTGGGGGG - Intronic
1061582544 9:131546444-131546466 CTGGGGAGTCTCTGGCTGGCTGG + Intergenic
1061959866 9:133982443-133982465 CATGGCAGACTCTGGCTGGCAGG + Intronic
1062133630 9:134913336-134913358 TGGGGCAGACACTGGGAGGTGGG - Intronic
1186859369 X:13656169-13656191 ATGGACAGACACTGGCTGCTAGG - Intronic
1190735873 X:53255883-53255905 TCAGGGCGACACTGGCTGGCTGG + Exonic
1190879937 X:54484861-54484883 CTGGCCAGACGCTGGCTGGGTGG - Intronic
1192232037 X:69272040-69272062 GTGGGCAGCCCCTGGCTGGGAGG + Intergenic
1192468790 X:71378528-71378550 TTGGGGAGATACTGGGTGGTAGG + Intronic
1195693694 X:107650533-107650555 TTGAGCAGACATTGGGTGGGGGG + Exonic
1196101825 X:111854668-111854690 TTGGGCAAACACAAACTGGCAGG + Intronic
1198507684 X:137317552-137317574 TAGGGCAGAAACATGCTGGCAGG - Intergenic
1200058689 X:153474542-153474564 GTGGACAGAGTCTGGCTGGCAGG + Intronic
1200070646 X:153527376-153527398 CTGGGCAGGCCCGGGCTGGCAGG + Intronic
1201238062 Y:11930670-11930692 ACTGGCAGACACTGGCAGGCTGG + Intergenic