ID: 927958741

View in Genome Browser
Species Human (GRCh38)
Location 2:27226152-27226174
Sequence GACCCACTGGGCATCCACAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 301}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927958735_927958741 8 Left 927958735 2:27226121-27226143 CCCTTCACAGGTGTGTAACATGG 0: 1
1: 0
2: 0
3: 16
4: 177
Right 927958741 2:27226152-27226174 GACCCACTGGGCATCCACACTGG 0: 1
1: 0
2: 0
3: 23
4: 301
927958733_927958741 10 Left 927958733 2:27226119-27226141 CCCCCTTCACAGGTGTGTAACAT 0: 1
1: 0
2: 1
3: 11
4: 132
Right 927958741 2:27226152-27226174 GACCCACTGGGCATCCACACTGG 0: 1
1: 0
2: 0
3: 23
4: 301
927958732_927958741 11 Left 927958732 2:27226118-27226140 CCCCCCTTCACAGGTGTGTAACA 0: 1
1: 0
2: 15
3: 7
4: 140
Right 927958741 2:27226152-27226174 GACCCACTGGGCATCCACACTGG 0: 1
1: 0
2: 0
3: 23
4: 301
927958737_927958741 7 Left 927958737 2:27226122-27226144 CCTTCACAGGTGTGTAACATGGA 0: 1
1: 0
2: 0
3: 12
4: 133
Right 927958741 2:27226152-27226174 GACCCACTGGGCATCCACACTGG 0: 1
1: 0
2: 0
3: 23
4: 301
927958731_927958741 19 Left 927958731 2:27226110-27226132 CCATGGCACCCCCCTTCACAGGT 0: 1
1: 0
2: 1
3: 19
4: 176
Right 927958741 2:27226152-27226174 GACCCACTGGGCATCCACACTGG 0: 1
1: 0
2: 0
3: 23
4: 301
927958734_927958741 9 Left 927958734 2:27226120-27226142 CCCCTTCACAGGTGTGTAACATG 0: 1
1: 0
2: 1
3: 20
4: 250
Right 927958741 2:27226152-27226174 GACCCACTGGGCATCCACACTGG 0: 1
1: 0
2: 0
3: 23
4: 301
927958729_927958741 22 Left 927958729 2:27226107-27226129 CCTCCATGGCACCCCCCTTCACA 0: 1
1: 0
2: 0
3: 24
4: 302
Right 927958741 2:27226152-27226174 GACCCACTGGGCATCCACACTGG 0: 1
1: 0
2: 0
3: 23
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927958741 Original CRISPR GACCCACTGGGCATCCACAC TGG Exonic
900323709 1:2097200-2097222 GAACCTCTGGGCATGGACACTGG - Intronic
900594117 1:3472672-3472694 AAACGACTGGGCCTCCACACAGG - Intronic
901083324 1:6595917-6595939 GCTCCACTGTGCATCCCCACAGG + Intronic
902953777 1:19910130-19910152 GACATACTGGGCCTCCACTCGGG - Exonic
904485924 1:30824555-30824577 GAGCCAATGGGCTTCCAGACCGG + Intergenic
907562443 1:55403267-55403289 GAGCCACTGGGCTGCCATACTGG + Intergenic
907842354 1:58170165-58170187 GTCCCAGTGGGGATCCATACTGG - Intronic
908534809 1:65067296-65067318 GGCCCGCTAGGCATCCGCACTGG - Intergenic
911129761 1:94376291-94376313 GTCCCAATGGGGATCCATACTGG + Intergenic
912021309 1:105111546-105111568 GTCCCAGTGGGGATCCATACTGG - Intergenic
912701619 1:111882341-111882363 GCCCTGCTGGGCATCCAAACCGG - Intronic
913469530 1:119174825-119174847 GTCCCAGTGGGGATCCATACTGG - Intergenic
915260576 1:154674016-154674038 GTCCCAGTGGGGATCCATACTGG - Intergenic
915401572 1:155625789-155625811 GTCCCAGTGGGGATCCACACTGG + Intergenic
916114444 1:161475093-161475115 GTCCCAGTGGGGATCCATACTGG - Intergenic
916751538 1:167727250-167727272 CATCCACTTTGCATCCACACTGG + Intronic
916939539 1:169664537-169664559 GTCCCAGTGGGGATCCATACTGG - Intronic
917086140 1:171307379-171307401 GTCCCAGTGGGGATCCATACTGG - Intergenic
917279889 1:173370377-173370399 GTCCCAGTGGGGATCCATACTGG - Intergenic
917281167 1:173379238-173379260 GTCCCAGTGGGGATCCATACTGG - Intergenic
917445785 1:175104989-175105011 GTCCCAGTGGGGATCCATACTGG + Intronic
919256925 1:195138236-195138258 GTCCCAGTGGGGATCCATACTGG - Intergenic
919318081 1:196000157-196000179 GACCCACTGGGCAATGACAGAGG - Intergenic
919558663 1:199092785-199092807 GTCCCAGTGGGGATCCATACTGG - Intergenic
921019708 1:211224714-211224736 GTCCCAGTGGGGATCCATACTGG - Intergenic
922274459 1:224064322-224064344 GACCCACTGGGCACCCGCTAGGG + Intergenic
923434686 1:233956870-233956892 GGCCCCCTAGGAATCCACACAGG + Intronic
1063321688 10:5057710-5057732 GTCCCAGTGGGGATCCATACTGG + Intronic
1063859070 10:10289195-10289217 GTCCCAGTGGGGATCCATACTGG + Intergenic
1064136930 10:12758983-12759005 ATCCCACTGGGCATGCTCACTGG + Intronic
1064603555 10:17016318-17016340 GTCCCAGTGGGGATCCATACTGG + Intronic
1066614560 10:37282104-37282126 GTCCCAGTGGGGATCCATACTGG + Intronic
1067030869 10:42878311-42878333 GCCCCACTTGACATCCACTCAGG - Intergenic
1067056686 10:43056687-43056709 CACCCACTGGGCTTGCACAGAGG - Intergenic
1067078501 10:43201354-43201376 GGCCAACTGGGCCTCCACAGTGG - Intronic
1067452694 10:46392099-46392121 TACCCCCTTGGCATCCACCCAGG + Intergenic
1067584538 10:47467656-47467678 TACCCCCTTGGCATCCACCCAGG - Intronic
1067788380 10:49269750-49269772 GATCCACTGAGCATTCACACAGG + Intergenic
1068240665 10:54297997-54298019 GTCCCAGTGGGGATCCATACTGG - Intronic
1069073000 10:64009440-64009462 AACCCACTGGGCATCCGGATTGG - Intergenic
1069365072 10:67687911-67687933 GTCCCAGTGGGGATCCATACTGG + Intronic
1070824918 10:79385516-79385538 GACACGCTGGGCTTCCACACTGG + Exonic
1072371642 10:94770850-94770872 GTCCCAGTGGGGATCCATACTGG + Intronic
1072455414 10:95571160-95571182 AACACACAGGGCATCCACAGAGG + Intergenic
1073970770 10:109043796-109043818 GTCCCAGTGGGGATCCATACTGG - Intergenic
1074742633 10:116499918-116499940 GTCCCAGTGGGGATCCATACTGG + Intergenic
1075146343 10:119886004-119886026 GTCCCAGTGGGGATCCATACTGG - Intronic
1076731077 10:132439177-132439199 GACCCACTGGCCTTGCACTCTGG - Intergenic
1076853244 10:133103252-133103274 GCCCCGCAGGGCAGCCACACTGG + Intronic
1077748182 11:4932585-4932607 TACCAACTGGGCATCTTCACTGG - Intronic
1078207907 11:9246279-9246301 CACCCACTGAGGTTCCACACCGG + Intronic
1079731199 11:23939063-23939085 GTCCCAGTGGGGATCCATACTGG + Intergenic
1079811641 11:25004787-25004809 GTCCCAGTGGGGATCCATACTGG + Intronic
1081421445 11:42877489-42877511 GTCCCAGTGGGGATCCATACTGG - Intergenic
1081730473 11:45368646-45368668 GACCCTCTGGGGCACCACACAGG - Intergenic
1083167956 11:60903063-60903085 GAACCACTGGGCACACAGACAGG + Intronic
1083896913 11:65624614-65624636 GCCCTCCTGGGCCTCCACACGGG - Intronic
1084015427 11:66377134-66377156 GAACGACTGGACATCCACATGGG - Intergenic
1084174139 11:67415055-67415077 GACCCAGTGGACTTGCACACAGG - Intronic
1084474544 11:69381301-69381323 GAACCATTGGGCATCCTGACTGG - Intergenic
1086077338 11:82868745-82868767 GACTCACTGGGCTGCCACAATGG + Intronic
1086317410 11:85609011-85609033 GTCCCAGTGGGGATCCATACTGG - Intronic
1088359731 11:108977826-108977848 GAGCCACTGGCTATTCACACGGG - Intergenic
1088492565 11:110401899-110401921 GTCCCAGTGGGGATCCATACTGG - Intergenic
1088930865 11:114349411-114349433 GTCCCAATGGGGATCCACACTGG + Intergenic
1090568944 11:128026354-128026376 TCCCCACTGGGCATCCACTGGGG - Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1091623448 12:2106308-2106330 AAGCCACTGGGCACCCACCCCGG + Intronic
1091794150 12:3287782-3287804 GACCCAGTGGGCATCTCAACAGG - Intergenic
1092110805 12:5962921-5962943 GACCCACTGGATAGCCACATGGG + Intronic
1092472329 12:8790786-8790808 GTCCCAGTGGGGATCCATACTGG - Intergenic
1093022800 12:14218875-14218897 GTCCCAGTGGGGATCCACACTGG - Intergenic
1093345272 12:18033799-18033821 GTCCCAGTGGGGATCCATACTGG - Intergenic
1094338080 12:29383241-29383263 GTCCCAGTGGGGATCCATACTGG + Intergenic
1095714537 12:45328242-45328264 GACACACAGGGGAGCCACACAGG - Intronic
1097155677 12:57010530-57010552 GCCCCACTGGCCATGCACACAGG - Intronic
1099376274 12:81898949-81898971 GTCCCAGTGGGGATCCATACTGG - Intergenic
1099576837 12:84393094-84393116 GTCCCAATGGGGATCCATACTGG + Intergenic
1100092171 12:90985124-90985146 GTCCCAGTGGGGATCCATACTGG - Intronic
1101779687 12:107824233-107824255 GTCCCAGTGGGGATCCACGCTGG - Intergenic
1102261378 12:111445421-111445443 GCCTCACATGGCATCCACACGGG - Intronic
1104094589 12:125545430-125545452 GAGACAGTGGACATCCACACTGG - Intronic
1104306208 12:127612772-127612794 GTCCCAGTGGGGATCCATACTGG - Intergenic
1104392352 12:128401736-128401758 GCCCCACTGGACATTCACAGAGG - Intronic
1104767132 12:131337370-131337392 GTCCCAGTGGGGATCCATACTGG - Intergenic
1105762512 13:23527349-23527371 GTCCCAGTGGGGATCCATACTGG - Intergenic
1107419915 13:40236577-40236599 GATCCAAAGGGCATCCACCCAGG + Intergenic
1109424445 13:62152405-62152427 GTCCCAGTTGGGATCCACACTGG - Intergenic
1112538400 13:100283308-100283330 GTCCCAGTGGGGATCCATACTGG - Intronic
1113203900 13:107894799-107894821 GTCCCAGTGGGGATCCATACTGG + Intergenic
1113271595 13:108680743-108680765 GATCCACTGGGGGTCCACAATGG - Intronic
1113551479 13:111196264-111196286 GTCCCAGTGGGGATCCATACTGG + Intronic
1113677444 13:112216280-112216302 AATCCCCTGGGCACCCACACTGG - Intergenic
1115285435 14:31709423-31709445 GTCCCAGTGGGGATCCATACTGG + Intronic
1119640738 14:76312948-76312970 GACACACTGGGCCTGCACAGTGG - Intronic
1119650344 14:76378615-76378637 GACCCACTGGGCAGCAGCCCAGG + Intronic
1122685373 14:103502185-103502207 AATCCACAGGGCATCCACATGGG + Intronic
1122723344 14:103734619-103734641 TACACACTGGGCAGCAACACTGG + Exonic
1122819732 14:104335389-104335411 TCCCCACTGGGCCTCCCCACTGG - Intergenic
1122824741 14:104364160-104364182 GAGCCACAGGGCAGACACACAGG - Intergenic
1124707333 15:31976880-31976902 CACCCACTGGGAATACACACTGG - Intergenic
1125734312 15:41912910-41912932 TACCCACAGGGCATACCCACAGG - Intronic
1126700108 15:51359490-51359512 GTCCCAATGGGGATCCACACTGG - Intronic
1128829328 15:70752345-70752367 CACCCACAGGGCCTCCCCACTGG + Intronic
1131392600 15:92061638-92061660 CACCCACTGTCCATCCCCACTGG + Intronic
1131411230 15:92209812-92209834 GTCCCAGTGGGGATCCATACTGG - Intergenic
1132345971 15:101109015-101109037 CCCCCACTCTGCATCCACACTGG + Intergenic
1132376170 15:101329704-101329726 GACACTGTGGTCATCCACACAGG - Intronic
1138223239 16:55270856-55270878 GAGCCACAGGGCATCCATGCAGG - Intergenic
1139613554 16:68075554-68075576 GTCCCACTGGGCCAGCACACTGG + Intronic
1139965599 16:70743727-70743749 GCCCCTCTGGACATCCACACAGG - Intronic
1142878276 17:2865693-2865715 GACCTTCTGGCCATCCACAAGGG - Intronic
1144340439 17:14305167-14305189 TACGCACTGTCCATCCACACTGG + Intronic
1145284822 17:21497575-21497597 GAGCCAATGGGCAGACACACAGG - Intergenic
1145392702 17:22468189-22468211 GAGCCAATGGGCAGACACACAGG + Intergenic
1146507309 17:33416581-33416603 CACCCACTGGGCGCCCACAGTGG + Intronic
1147345290 17:39788404-39788426 GACCCTCAGGGGTTCCACACAGG + Intronic
1148497267 17:48060308-48060330 GAGCCACTGGGCCCCAACACTGG + Exonic
1149464391 17:56864199-56864221 GACCCAGAGGGCATCCAGCCTGG + Exonic
1151568033 17:74910860-74910882 GTCCCAGTGGGGATCCATACTGG - Intergenic
1152849968 17:82627721-82627743 GACCCACTGGCCTCGCACACAGG + Intronic
1153540327 18:6146843-6146865 GCCCCACTGCTCATCCTCACTGG - Intronic
1156300014 18:35828101-35828123 CACCCACTGGACATTTACACAGG - Intergenic
1157159589 18:45301337-45301359 GCCCCACTGAGCCTCCACGCTGG + Intronic
1157857542 18:51116335-51116357 GTCCCAGTGGGGATCCATACTGG + Intergenic
1158014744 18:52770989-52771011 TTCCCACTGGGCCTCCACAGGGG + Intronic
1158318193 18:56235375-56235397 GACCTGCTCTGCATCCACACAGG - Intergenic
1159059009 18:63495012-63495034 GACCCATTGGGCATTTTCACTGG + Intronic
1159905411 18:74085738-74085760 AAACAACTGGACATCCACACTGG + Intronic
1161598216 19:5163420-5163442 GTCCCAGTGGGGATCCATACTGG + Intronic
1161601888 19:5189147-5189169 GACCCACTGGCCCTCTACTCAGG + Intronic
1161960450 19:7520248-7520270 CACCACCTGCGCATCCACACGGG + Exonic
1162107933 19:8381975-8381997 GTCCCAGTGGGGATCCATACTGG - Intronic
1162237454 19:9320467-9320489 GTCCCAGTGGGGATCCATACTGG + Intergenic
1163263098 19:16203245-16203267 GCCCCTGTGGGCATTCACACTGG + Intronic
1163661389 19:18579959-18579981 GTCCCAGTGGGGATCCATACTGG - Intronic
1164161400 19:22627694-22627716 GACCCAGTGGGCATCCCAGCTGG - Intergenic
1165847101 19:38825228-38825250 GTCCCAGTGGGGATCCATACTGG - Intronic
1167171624 19:47836199-47836221 GACCCTCAGGTCATCCACATGGG - Intronic
1167633542 19:50640008-50640030 GACCCAGTGGGTTTCCACACTGG + Intronic
1168102935 19:54150559-54150581 GACAGCCTGGGCATACACACTGG - Intronic
925065760 2:928023-928045 GACCCACTTGACATCAACAGGGG - Intergenic
925169174 2:1740513-1740535 GACCCACAGAGCAGCAACACTGG + Intronic
926636182 2:15182072-15182094 GGCCAGCTGGGCCTCCACACTGG + Intronic
927958741 2:27226152-27226174 GACCCACTGGGCATCCACACTGG + Exonic
928338704 2:30422573-30422595 CACACACAGGGCATACACACAGG + Intergenic
928451412 2:31381656-31381678 GCCCCACTGGCCATGAACACGGG + Exonic
928617609 2:33055476-33055498 GTCCCAGTGGGGATCCATACTGG + Intronic
929330386 2:40674660-40674682 GTCCCAGTGGGGATCCATACTGG - Intergenic
930038544 2:47103101-47103123 GTCCCAGTGGGGATCCATACTGG - Intronic
931540502 2:63324748-63324770 GTCCCAGTGGGGATCCATACTGG - Intronic
933775907 2:85771038-85771060 GAGCCACTGAGCCTCCACAGGGG - Intronic
934867137 2:97823604-97823626 ATCCCAGTGGGCATCCATACTGG - Intronic
937004330 2:118497388-118497410 GTCCCACTTGGCTCCCACACTGG + Intergenic
937324586 2:120982895-120982917 CATGCACTGGGCATGCACACTGG + Intronic
937861508 2:126714970-126714992 CTCCCACTTGCCATCCACACTGG + Intergenic
938137356 2:128770290-128770312 GACCCAATGGGCACCTGCACAGG + Intergenic
938806179 2:134808899-134808921 GTCCCAGTGGGGATCCATACTGG + Intergenic
938961995 2:136352365-136352387 AAGCCACTGGGCTTCCAGACTGG - Intergenic
939851868 2:147313889-147313911 GTCCCAGTGGGCATCCATACTGG - Intergenic
941243424 2:163069262-163069284 GTCCCAGTGGGGATCCATACTGG - Intergenic
943103061 2:183510456-183510478 GTCCCAGTGGGGATCCACACTGG + Intergenic
943133758 2:183887944-183887966 GTCCCAGTGGGGATCCATACTGG - Intergenic
944539321 2:200741311-200741333 CACACAGTGGACATCCACACAGG + Intergenic
946207349 2:218119430-218119452 GTCCCAGTGGGCATCCATACTGG + Intergenic
947455710 2:230252008-230252030 AACCCTTTGGGCATCCACATTGG - Intronic
947456302 2:230257127-230257149 AACCCTTTGGGCATCCACATTGG - Intronic
947862569 2:233371745-233371767 GAGCAACTGCACATCCACACAGG - Intronic
948123829 2:235550403-235550425 GAGTCACTGAGCATGCACACGGG + Intronic
948770491 2:240249176-240249198 GTCTCACTGGGCTTCCTCACGGG + Intergenic
1169085089 20:2821330-2821352 GAGGCCGTGGGCATCCACACGGG + Intergenic
1171261511 20:23738432-23738454 GTCCCAGTGGGGATCCATACTGG - Intergenic
1171283526 20:23920309-23920331 CACCCACAAGGCATACACACTGG + Intergenic
1172340660 20:34154936-34154958 GTCCCAGTGGGGATCCATACAGG - Intergenic
1172611564 20:36256367-36256389 GACCCACTGGGCCTCTGGACAGG - Exonic
1174926319 20:54763789-54763811 CACCCACTGGACACTCACACAGG - Intergenic
1175791672 20:61743984-61744006 GGCCCCCTGGGCAGGCACACAGG + Intronic
1176146994 20:63569865-63569887 GCCCCACGGGACATCCACAGGGG - Intronic
1176180345 20:63746865-63746887 GACCCACCGGACACACACACGGG + Exonic
1177135074 21:17299293-17299315 GTCCCAGTGGGGATCCATACTGG - Intergenic
1179431991 21:41327915-41327937 GACCCACTGTGCATGCTGACAGG - Intronic
1179611945 21:42557646-42557668 CACCCACTGGGTGCCCACACTGG + Intronic
1182780834 22:32866181-32866203 TAACCACTGGGCATCCACATGGG - Intronic
1183123412 22:35750666-35750688 GAAGCACTGGGCAGCCCCACTGG - Intronic
1183335848 22:37245350-37245372 GAGCCACTGGTCACCCACCCTGG + Intergenic
1184987188 22:48143992-48144014 CACACACTCCGCATCCACACCGG + Intergenic
949125555 3:442313-442335 GACCCACTGGGCAATGACAAGGG + Intergenic
950416654 3:12872771-12872793 GAGCCACTGGCCATGCACATGGG - Intergenic
951239477 3:20272188-20272210 GTCCCAGTGGGGATCCATACTGG - Intergenic
951321259 3:21248729-21248751 GCCACACTGGGCATTCTCACAGG - Intergenic
952925209 3:38315217-38315239 ACCCCACTGGGGATCCACTCAGG - Intronic
952940939 3:38443946-38443968 GTCCCAGTGGGGATCCATACTGG + Intergenic
954159321 3:48709223-48709245 GTCCCAATGGGCAGCCACAGAGG + Intronic
954232261 3:49226568-49226590 GTCCCAGTGGGGATCCATACTGG + Intronic
954300512 3:49698584-49698606 GAGCCACTGGGCAGCCATAAGGG + Intronic
954586987 3:51744835-51744857 GTCCCAGTGGGGATCCATACTGG - Intergenic
954598930 3:51852672-51852694 GTCCCAGTGGGGATCCATACTGG - Intergenic
955233995 3:57123670-57123692 GACCCCGTGGCCATCCACGCCGG + Intronic
956842953 3:73156995-73157017 GTCCCAGTGGGGATCCATACTGG + Intergenic
958575806 3:95949069-95949091 GTCCCAGTGGGGATCCATACTGG + Intergenic
958601393 3:96300292-96300314 GTCCCAGTGGGGATCCATACTGG - Intergenic
958605243 3:96350289-96350311 ATCCCACTGGGCGTCCACAGCGG - Intergenic
964064506 3:152562327-152562349 GTCCCAGTGGGGATCCATACTGG - Intergenic
964619966 3:158711538-158711560 GATCCACTGATCATCCACATGGG + Intronic
965062751 3:163804095-163804117 GTCCCAGTGGGGATCCATACTGG - Intergenic
967583624 3:191187948-191187970 GTCCCAGTGGGGATCCATACTGG - Intergenic
968579433 4:1383087-1383109 GCCCCACTGGGCAGCCTCCCAGG - Intronic
970757964 4:19449723-19449745 GCACCACTGGACATCCACAGGGG - Intergenic
971281201 4:25243864-25243886 GTCCCAGTGGGGATCCATACTGG + Intronic
971634171 4:29034798-29034820 GACCCACTGGCCAGGCACAGTGG - Intergenic
972133302 4:35862682-35862704 GTCCCAGTGGGGATCCATACTGG + Intergenic
973045861 4:45533964-45533986 GTCCCAGTGGGGATCCATACTGG - Intergenic
974187316 4:58460608-58460630 GTCCCAGTGGGGATCCATACTGG - Intergenic
974537138 4:63187147-63187169 GTCCCAATGGGGATCCATACTGG - Intergenic
975047993 4:69827352-69827374 GTCCCAGTGGGGATCCATACTGG - Intronic
975595835 4:76047653-76047675 GTCCCAGTGGGGATCCATACTGG + Intronic
980665213 4:135924821-135924843 GACCCTATGGGCAACCAAACGGG + Intergenic
982701126 4:158660497-158660519 GTCCCAATGGGGATCCATACTGG - Intergenic
984917449 4:184736951-184736973 GTCCCAGTGGGGATCCATACTGG - Intergenic
985489834 5:172629-172651 GACCCTCTGGGCCCACACACAGG - Intronic
986323017 5:6649181-6649203 GACCCCCTGTGTATCCACACTGG - Intronic
986919001 5:12661952-12661974 GGCCCACTGGGAACTCACACTGG - Intergenic
987503563 5:18743643-18743665 GTCCCAGTGGGGATCCACACTGG + Intergenic
987545243 5:19304805-19304827 GTCCCAGTGGGAATCCATACTGG + Intergenic
988357800 5:30200121-30200143 GTCCCAGTGGGGATCCATACTGG - Intergenic
989496241 5:42113831-42113853 GTCCCAGTGGGGATCCATACTGG - Intergenic
989964368 5:50451070-50451092 GTCCCAGTGGGGATCCATACTGG + Intergenic
990116729 5:52399814-52399836 GTCCCAGTGGGGATCCATACTGG - Intergenic
990367872 5:55088660-55088682 GTCCCAGTGGGGATCCATACTGG + Intergenic
990672547 5:58149359-58149381 AACCTACTGGGCATCCTTACAGG - Intergenic
992049356 5:72928828-72928850 GTCCCAGTGGGGATCCATACTGG - Intergenic
992545773 5:77812530-77812552 GTCCCAGTGGGGATCCATACTGG - Intronic
994231737 5:97315749-97315771 GTCCCATTGGGGATCCATACTGG + Intergenic
995040603 5:107584001-107584023 AATCCACTGTGGATCCACACAGG + Intronic
996099235 5:119430328-119430350 GTCCCATTGGGGATCCATACTGG + Intergenic
996336652 5:122390874-122390896 TGCCCACTGGGGAGCCACACTGG + Intronic
997072396 5:130636114-130636136 GTCCCAGTGGGGATCCATACTGG - Intergenic
997625130 5:135326505-135326527 GAAGCACTGGGCATCTGCACCGG - Intronic
997725859 5:136119247-136119269 GACCCCCTAGACATACACACTGG + Intergenic
998915057 5:147003664-147003686 GTCCCAGTGGGGATCCATACTGG - Intronic
1003515949 6:6818843-6818865 GACCCAGTGGGAATCTGCACAGG + Intergenic
1003805782 6:9724816-9724838 GTCCCAGTGGGGATCCATACTGG - Intronic
1003864637 6:10351792-10351814 GACCCACTGAGCTCCCACAGGGG - Intergenic
1006870078 6:37243424-37243446 AACCCACTGGGCAATTACACTGG - Intronic
1007030026 6:38618932-38618954 GTCCCAGTGGGGATCCATACTGG - Intronic
1008587000 6:52959527-52959549 GTCCCAGTGGGGATCCATACTGG + Intergenic
1009470795 6:64027143-64027165 GTCCCAGTGGGGATCCATACTGG - Intronic
1009872771 6:69470656-69470678 GTCCCAGTGGGGATCCATACCGG - Intergenic
1011375055 6:86678867-86678889 GTCCCAGTGGGGATCCATACTGG + Intergenic
1012441566 6:99266291-99266313 GTCCCAGTGGGGATCCATACTGG + Intergenic
1013888674 6:115000497-115000519 GTCCCAGTGGGGATCCACGCTGG - Intergenic
1013907857 6:115238628-115238650 GTCCCAGTGGGGATCCATACTGG + Intergenic
1013977412 6:116093610-116093632 GTCCCAGTGGGGATCCATACTGG - Intergenic
1016184019 6:141178682-141178704 GTCCCAGTGGGGATCCATACTGG - Intergenic
1019614052 7:1950943-1950965 CACCCACTGGCCACCCACCCTGG + Intronic
1021840282 7:24716924-24716946 GACACACTGGGCATCAACCCCGG - Intronic
1023077970 7:36502243-36502265 GTCCCAGTGGGGATCCATACTGG + Intergenic
1023368694 7:39490554-39490576 GGCCCACTGGGCACCCACCATGG - Intronic
1023847538 7:44131010-44131032 GAACCACTGGGCATACCCACAGG - Intergenic
1026110946 7:67458634-67458656 AACCCACTGGGCAGTTACACTGG + Intergenic
1027791103 7:82639599-82639621 GTCCCAGTGGGGATCCATACTGG - Intergenic
1028495240 7:91453806-91453828 GTCCCAGTGGGGATCCATACTGG + Intergenic
1030218160 7:107067944-107067966 ATCCCACTGGGCATTCACATTGG - Intronic
1031702749 7:124945251-124945273 CACCCTCTGTGCATTCACACAGG - Intergenic
1033759262 7:144422403-144422425 GTCCCAGTGGGGATCCATACTGG + Intergenic
1034579993 7:152033762-152033784 GTCCCAGTGGGGATCCATACTGG + Intronic
1034731079 7:153388004-153388026 CCCCCACTGGGCTTCCCCACAGG - Intergenic
1035108063 7:156458481-156458503 GAGCCACTGAGCATCCACTCAGG + Intergenic
1035204928 7:157289154-157289176 GATCCACTGGGCTTCCACTGTGG + Intergenic
1038407902 8:27335664-27335686 GACCCCCAGGGCATGAACACAGG - Intronic
1038638775 8:29307499-29307521 GTCCCAGTGGGGATCCATACTGG - Intergenic
1039275989 8:35934527-35934549 GTCCCACTGGGTATCCATACTGG - Intergenic
1039881909 8:41630457-41630479 GGCCCACTGGGCCTGCAGACAGG - Intergenic
1039921512 8:41896934-41896956 GGCGCACTGGGCGTCCGCACGGG + Intergenic
1040648938 8:49428846-49428868 GTCCCAGTGGGGATCCATACTGG - Intergenic
1040667889 8:49654484-49654506 GTCCCAGTGGGGATCCATACTGG + Intergenic
1040953375 8:52957164-52957186 GTCCCAGTGGGGATCCATACTGG - Intergenic
1040965076 8:53074574-53074596 GTCCCAGTGGGGATCCATACTGG + Intergenic
1040971478 8:53141059-53141081 GTCCCAGTGGGGATCCATACTGG + Intergenic
1040999956 8:53440341-53440363 GTCCCAGTGGGGATCCATACTGG + Intergenic
1041001889 8:53462102-53462124 GTCCCAGTGGGGATCCATACTGG - Intergenic
1041925775 8:63234721-63234743 GACCCACTTGGTTTCCAAACTGG + Intergenic
1044456649 8:92398371-92398393 GTCCCAGTGGGGATCCATACTGG + Intergenic
1047808106 8:128379980-128380002 GTCGCAATGGGGATCCACACTGG + Intergenic
1048641621 8:136369852-136369874 GCCACCCTGGGCATCGACACGGG + Intergenic
1049046250 8:140154376-140154398 GACCCCCTCCGCCTCCACACTGG + Intronic
1049179747 8:141216153-141216175 GAGCCACTGGGCATCCCAGCGGG - Intronic
1050024660 9:1321254-1321276 GACACACTGGGCATCCAAGAAGG - Intergenic
1051935257 9:22437061-22437083 GTCCCAGTGGGGATCCATACTGG - Intergenic
1053376542 9:37611941-37611963 GATCCACTGGGAATCGCCACTGG - Intronic
1055135426 9:72824115-72824137 GACACACTGGGCACTGACACAGG + Intronic
1055231609 9:74073684-74073706 AACCCACTGGGCAGTTACACTGG - Intergenic
1056392805 9:86154757-86154779 GTCCCAGTGGGGATCCATACTGG + Intergenic
1057866906 9:98688720-98688742 CACCCTCTGAGCATCCACATTGG + Intronic
1061133195 9:128719753-128719775 GACCCAGGAGGCATACACACGGG + Exonic
1061206167 9:129164754-129164776 GAGACACTGGACTTCCACACTGG + Intergenic
1061412025 9:130427075-130427097 GACTCACTGGCCAGCCCCACTGG + Intronic
1062054501 9:134463832-134463854 TGCCCACTGGACATCTACACTGG - Intergenic
1062676461 9:137748406-137748428 CACCCACAGGCCATCCACAGTGG - Intronic
1190541440 X:51482139-51482161 GTCCCAGTGGGGATCCATACTGG - Intergenic
1191205956 X:57834493-57834515 GTCCCAGTGGGGATCCATACTGG + Intergenic
1192482783 X:71499674-71499696 GTCCCAGTGGGGATCCATACTGG + Intronic
1195439548 X:104885271-104885293 GTCCCAGTGGGGATCCATACTGG - Intronic
1196127373 X:112114277-112114299 GTCCCAGTGGGGATCCATACTGG + Intergenic
1196381711 X:115098401-115098423 GACCCACCTGGGAGCCACACAGG + Intergenic
1196488963 X:116246020-116246042 GTCCCAGTGGGGATCCATACTGG - Intergenic
1196661964 X:118279401-118279423 GTCCCAGTGGGGATCCATACTGG + Intergenic
1197513384 X:127397531-127397553 GTCCCAGTGGGGATCCATACTGG - Intergenic
1197702211 X:129607965-129607987 GAACCACTGGGCATCGACCCAGG + Intergenic
1200776200 Y:7172307-7172329 GACTCAGTGGGGATCCATACTGG - Intergenic
1200801045 Y:7387352-7387374 GTCCCAGTGGGGATCCATACTGG + Intergenic
1201271953 Y:12264186-12264208 GTCCCAGTGGGTATCCATACTGG + Intergenic
1201429674 Y:13891469-13891491 GTCCCAGTGGGGATCCATACTGG - Intergenic
1201471905 Y:14343457-14343479 GTCCCAATGGGGATCCACACTGG + Intergenic
1201487559 Y:14508839-14508861 GTCCCAGTGGGGATCCATACTGG - Intergenic
1201555715 Y:15263242-15263264 GTCCCAGTGGGGATCCATACTGG - Intergenic
1201648911 Y:16264383-16264405 GTCCCAGTGGGGATCCATACTGG + Intergenic
1201653898 Y:16320917-16320939 GTCCCAGTGGGGATCCATACTGG - Intergenic
1201911076 Y:19134059-19134081 GTCCCAGTGGGGATCCATACTGG - Intergenic
1202057257 Y:20848110-20848132 GACCCACTGTGTATCCAGACTGG - Intergenic
1202272079 Y:23082409-23082431 GTCCCAGTGGGGATCCATACTGG + Intergenic
1202293947 Y:23338273-23338295 GTCCCAGTGGGGATCCATACTGG - Intergenic
1202425076 Y:24716153-24716175 GTCCCAGTGGGGATCCATACTGG + Intergenic
1202445713 Y:24953932-24953954 GTCCCAGTGGGGATCCATACTGG - Intergenic