ID: 927959424

View in Genome Browser
Species Human (GRCh38)
Location 2:27231591-27231613
Sequence TAGGGGTATTGCCAGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927959424 Original CRISPR TAGGGGTATTGCCAGGGGAG GGG (reversed) Intronic
900386929 1:2414827-2414849 TGGGGGTCCTGCCAGGGGAGGGG + Intergenic
903187815 1:21639211-21639233 TGGGGGTAGTGCCAGGGGTGGGG - Intronic
903781528 1:25823131-25823153 AAGGGGCATTCCCAGGGCAGGGG + Intronic
905272352 1:36795300-36795322 GAGGGGTGTTGCCAAGGGAAGGG + Intergenic
905386952 1:37611667-37611689 TAGTGGCACTGCCAGGGGAAGGG - Exonic
906127413 1:43435734-43435756 TAGGGAAAGAGCCAGGGGAGGGG + Intronic
906212001 1:44017245-44017267 GAGGGGCAGGGCCAGGGGAGCGG - Exonic
907850168 1:58248508-58248530 TAGAGGTGTTCCCAGGGCAGAGG - Intronic
907924134 1:58940191-58940213 CAGGGGTATTCCCAGGGGCAAGG - Intergenic
913957851 1:143320443-143320465 TAGTGGTAGTGCCAGGGCTGAGG + Intergenic
913957921 1:143320683-143320705 CAAGGGTATGGCCAGGGCAGAGG + Intergenic
914052230 1:144146041-144146063 CAAGGGTATGGCCAGGGCAGAGG + Intergenic
914126967 1:144820500-144820522 CAAGGGTATGGCCAGGGCAGAGG - Intergenic
915164390 1:153940575-153940597 TAGGGGCACTGCCAGTGCAGTGG + Exonic
915308925 1:154997490-154997512 AAGGGCCTTTGCCAGGGGAGGGG + Intergenic
915622120 1:157092307-157092329 TAAGGGTCTAGCCTGGGGAGAGG - Exonic
916000561 1:160611208-160611230 AAGTGGTATTGGCAGGAGAGAGG + Intronic
923409260 1:233691075-233691097 TGGGGGAGTGGCCAGGGGAGGGG - Intergenic
923603453 1:235423192-235423214 TGAGGGTACTTCCAGGGGAGGGG + Intronic
1063289346 10:4727626-4727648 AATGAGTATTGCCAGGGAAGAGG + Intergenic
1063377295 10:5561897-5561919 TAGGGGGAATGCCAGGCGAAGGG - Intergenic
1069659088 10:70111760-70111782 GAGGGGTGATGGCAGGGGAGTGG + Exonic
1072479853 10:95800301-95800323 TAGGGATTTTGAAAGGGGAGGGG + Intronic
1072790640 10:98315298-98315320 TTGGGGGCTGGCCAGGGGAGAGG + Intergenic
1073575661 10:104620805-104620827 CAGGGCTCTTGCCTGGGGAGTGG - Intergenic
1074426247 10:113353993-113354015 TAAAGGTATTGCAAAGGGAGGGG + Intergenic
1074446525 10:113525379-113525401 AAGGGTTCATGCCAGGGGAGGGG + Intergenic
1075901367 10:126045074-126045096 AAGGGGTATTGGAAAGGGAGTGG + Intronic
1077010647 11:377748-377770 CAGGGGCACTGCGAGGGGAGAGG - Intronic
1082960977 11:58918613-58918635 GAGGTGTTTTCCCAGGGGAGGGG + Intronic
1086941871 11:92806782-92806804 TAAGGCTGTTGCTAGGGGAGAGG + Intronic
1089081654 11:115781204-115781226 TAGGGACATGACCAGGGGAGGGG - Intergenic
1090137622 11:124214970-124214992 TAGGGGTAATGACAGTGGAATGG - Intergenic
1090140187 11:124249891-124249913 TAGGGGTAATGACAGTGGAATGG - Exonic
1090141183 11:124265147-124265169 TAGGGGTAATGACAGTGGAATGG - Exonic
1091587223 12:1823102-1823124 AAGGGGAGATGCCAGGGGAGTGG + Intronic
1092035630 12:5332274-5332296 TGGGAGAATTTCCAGGGGAGCGG + Intergenic
1092135647 12:6145131-6145153 TAGGGCTAGGGACAGGGGAGAGG + Intergenic
1094388994 12:29928232-29928254 TAGAGTTATTGGGAGGGGAGAGG + Intergenic
1098489755 12:71061669-71061691 CAGGTGTAATGACAGGGGAGGGG - Intronic
1099436425 12:82651485-82651507 TTGGGGTATTTCAAGGGAAGGGG - Intergenic
1100653702 12:96618052-96618074 AATGAGTATTTCCAGGGGAGGGG + Intronic
1101843948 12:108346707-108346729 TAGGGGGATGGCCAGGGGTGAGG - Intergenic
1102832361 12:116015397-116015419 TAGTGTTATTGCCAGGGGATAGG - Intronic
1103080508 12:118020165-118020187 TAGGGGCCTTGGCAGGGGTGGGG + Intronic
1104956631 12:132469747-132469769 TGGGGGTATTGGCAGGGAAAAGG + Intergenic
1105459932 13:20575098-20575120 GAAGGGTAGTGGCAGGGGAGGGG - Intronic
1106195490 13:27490839-27490861 CAATGGTATTGCCATGGGAGTGG + Intergenic
1106398054 13:29400704-29400726 TAAGCGTATTTCCTGGGGAGAGG - Intronic
1106822701 13:33483788-33483810 TGTGAGTATTGCCAGGGAAGAGG - Intergenic
1113715193 13:112500021-112500043 TTGGGGTATTGGCAGGGAAGGGG + Intronic
1120251843 14:82068161-82068183 GAGGAGTAATGCCGGGGGAGAGG + Intergenic
1202889759 14_KI270722v1_random:144942-144964 TAGGGATTTTGAAAGGGGAGGGG + Intergenic
1202930461 14_KI270725v1_random:29391-29413 CAAGGGTATGGCCAGGGCAGAGG - Intergenic
1123421889 15:20142019-20142041 CAAGGGTATGGCCAGGGCAGAGG + Intergenic
1123443193 15:20304616-20304638 CAAGGGTATGGCCAGGGCAGAGG - Intergenic
1123531117 15:21148559-21148581 CAAGGGTATGGCCAGGGCAGAGG + Intergenic
1123784277 15:23653642-23653664 AAGGGGCATTGCCAGGGGTAGGG - Intergenic
1123921906 15:25076127-25076149 AAGGGGTAGCCCCAGGGGAGTGG + Intergenic
1128308361 15:66614833-66614855 TAGGCGTAGGGGCAGGGGAGGGG - Intronic
1129697170 15:77747231-77747253 TGGCTGTGTTGCCAGGGGAGAGG - Intronic
1130583985 15:85165193-85165215 TAGGGATTTTGAAAGGGGAGGGG - Intergenic
1131634782 15:94220179-94220201 GAGGGGAATTGCCAGGGTAACGG + Intergenic
1132201271 15:99956253-99956275 TGGGGGTGTGGCCAGGGGTGTGG + Intergenic
1132866787 16:2097103-2097125 AGGGGGGATTGCCAGAGGAGGGG - Intronic
1135497858 16:22968370-22968392 TTGGGGTATTGCAAGGTGGGCGG - Intergenic
1136718065 16:32301066-32301088 CAAGGGTATGGCCAGGGCAGAGG + Intergenic
1136773909 16:32861080-32861102 CAAGGGTATGGCCAGGGTAGAGG - Intergenic
1136836441 16:33507336-33507358 CAAGGGTATGGCCAGGGCAGAGG + Intergenic
1136862954 16:33713665-33713687 CAAGGGTATGGCCAGGGCAGAGG - Intergenic
1136896700 16:34000439-34000461 CAAGGGTATGGCCAGGGTAGAGG + Intergenic
1137729143 16:50677197-50677219 TAGGAGTCATGGCAGGGGAGTGG - Intronic
1138213177 16:55180208-55180230 CAGGGGCAGTTCCAGGGGAGGGG + Intergenic
1139060417 16:63243853-63243875 TAGGAGTGTTTCCAGAGGAGGGG - Intergenic
1139917326 16:70436907-70436929 GAGGGGTAGGGCCTGGGGAGAGG - Intronic
1140841204 16:78840922-78840944 TAGGACTATTGCCAGTGGAGGGG + Intronic
1203008363 16_KI270728v1_random:216699-216721 CAAGGGTATGGCCAGGGCAGAGG - Intergenic
1203076329 16_KI270728v1_random:1123191-1123213 CAAGGGTATGGCCAGGGTAGAGG - Intergenic
1143338370 17:6190446-6190468 TTGGGGTATGGCCAGGTAAGTGG - Intergenic
1143517256 17:7426087-7426109 TAGGGCCATTGTCAGGGGTGGGG - Intronic
1144144861 17:12387703-12387725 TAGAGGTAGTGCCAGTGCAGAGG + Intergenic
1144584862 17:16481974-16481996 TGGGGGTACTGCCAGGTGCGCGG + Intronic
1144835587 17:18155053-18155075 GATGGGGGTTGCCAGGGGAGTGG + Intronic
1145266683 17:21383054-21383076 TTGGGGACTTGGCAGGGGAGGGG + Intronic
1145863433 17:28226030-28226052 TGGGGACATTGCCTGGGGAGAGG + Intergenic
1147365745 17:39957950-39957972 TAGGGGGATTGGCAGTGGAGGGG + Intergenic
1149532616 17:57407605-57407627 TAGGTGGGTTGCCCGGGGAGTGG + Intronic
1151825109 17:76519648-76519670 AGGGGGAATAGCCAGGGGAGAGG - Intergenic
1154415034 18:14171868-14171890 CAAGGGTATGGCCAGGGCAGAGG + Intergenic
1155429484 18:25740393-25740415 TAGCGGTGTTGGGAGGGGAGGGG + Intergenic
1155671392 18:28376332-28376354 TAGGGTTATGGCCAGGTGAAGGG - Intergenic
1156261025 18:35445193-35445215 TAGGGGCATTGCCAGAGGCCAGG - Intronic
1157121685 18:44917330-44917352 TAGGGTCACTGCCTGGGGAGAGG + Intronic
1157758606 18:50241684-50241706 TAGGGATTTTGAAAGGGGAGGGG + Intronic
1160798309 19:955691-955713 TAGGGGCTGTGCCAGGGAAGGGG + Intronic
1162084140 19:8238292-8238314 GAGGGGTATTGGCTGGGGAGGGG + Intronic
1162598376 19:11647209-11647231 GAAGGGTATTCCTAGGGGAGGGG + Intergenic
1165156711 19:33793131-33793153 TGGGGGGATTCCCAGGGTAGAGG + Intergenic
1166095102 19:40533467-40533489 TAGGGGTTCAGCCAGAGGAGGGG - Intronic
1166343103 19:42150397-42150419 TGGGGGGAATGGCAGGGGAGGGG + Intronic
1166971081 19:46568330-46568352 TATGGGAACTGCCTGGGGAGAGG - Intronic
1167063367 19:47165654-47165676 TAAGCGTAATGCCAGTGGAGTGG + Intronic
1167538233 19:50069027-50069049 TAGGGGTGCAGGCAGGGGAGTGG - Intergenic
1168422448 19:56213471-56213493 CAGGGATCATGCCAGGGGAGTGG - Intergenic
1202691627 1_KI270712v1_random:98465-98487 CAAGGGTATGGCCAGGGCAGAGG + Intergenic
925966154 2:9068295-9068317 TAGGGGGATTCTAAGGGGAGAGG - Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
927959424 2:27231591-27231613 TAGGGGTATTGCCAGGGGAGGGG - Intronic
929376991 2:41299372-41299394 AAGGGGTTTTCTCAGGGGAGAGG - Intergenic
929487498 2:42367891-42367913 TAGGAGTGGTGCCAGGGAAGAGG - Intronic
931342535 2:61415246-61415268 TAGGGTTATGACCAGGGGTGGGG + Intronic
932838684 2:75061170-75061192 TGGGGGCAATTCCAGGGGAGAGG + Intronic
933954761 2:87355485-87355507 CAAGGGTATGGCCAGGGCAGAGG - Intergenic
934238957 2:90251711-90251733 CAAGGGTATGGCCAGGGCAGAGG - Intergenic
934461388 2:94215047-94215069 CAAGGGTATGGCCAGGGCAGAGG - Intergenic
938143354 2:128813548-128813570 AAGGGGAATGGGCAGGGGAGAGG - Intergenic
938415978 2:131104075-131104097 TAGGGGTACTGCCTGGAAAGAGG - Intergenic
940627970 2:156200185-156200207 CAAGGGTACTGCTAGGGGAGAGG - Intergenic
945799624 2:214411292-214411314 TGATGGTATTGCCAGCGGAGTGG + Exonic
947525212 2:230873358-230873380 AGGGGGGATTTCCAGGGGAGGGG + Intronic
948139507 2:235662034-235662056 TTGGGGTATGGCCATAGGAGGGG + Intronic
948564071 2:238872328-238872350 TAGGGGGATTGCAAGGCCAGAGG + Intronic
1173188060 20:40856535-40856557 TGGGGGAATTCCTAGGGGAGTGG - Intergenic
1173268145 20:41505789-41505811 TGAGGCTATTGCCAGGGGAGAGG - Intronic
1173441691 20:43083089-43083111 AATGAGTATTGCCAGGGAAGAGG - Intronic
1176076030 20:63248573-63248595 TGTGGGTATTGGCAGGCGAGGGG - Intronic
1176108374 20:63399975-63399997 TAGGGCTCTGGCCAGAGGAGGGG - Intergenic
1176592473 21:8657987-8658009 CAAGGGTATGGCCAGGGCAGAGG - Intergenic
1177548163 21:22585935-22585957 AATGAGTATTGCCAGGGAAGAGG - Intergenic
1179098008 21:38332880-38332902 TTGGGGTGGAGCCAGGGGAGGGG - Intergenic
1180086619 21:45510516-45510538 GAGGGGCACTGCCGGGGGAGCGG - Intronic
1180275332 22:10635134-10635156 CAAGGGTATGGCCAGGGCAGAGG - Intergenic
1180331885 22:11488684-11488706 TAGGGATTTTGAAAGGGGAGGGG + Intergenic
1180549835 22:16530162-16530184 CAAGGGTATGGCCAGGGCAGAGG - Intergenic
1181354853 22:22291703-22291725 CAAGGGTATGGCCAGGGCAGAGG + Intergenic
1183038039 22:35155045-35155067 TGGGGGTATTGCCTGGGCCGAGG - Intergenic
1183401525 22:37608002-37608024 GAGGGGTCGTGTCAGGGGAGGGG - Intergenic
1183401531 22:37608019-37608041 TGGGGGTGTTGTCAGGGGAGGGG - Intergenic
950272561 3:11630085-11630107 TTTTGGTATTGTCAGGGGAGGGG - Intronic
952561246 3:34596040-34596062 AAGGGGAATGGCCAGGGGAGGGG + Intergenic
953389739 3:42527318-42527340 AGGGGGTATTGGCAGGGGTGGGG - Intronic
953390703 3:42532103-42532125 AAGGGGAAATGCCAGAGGAGAGG + Intronic
955522649 3:59790077-59790099 TACAGGCATTTCCAGGGGAGAGG - Intronic
956316552 3:67943930-67943952 AAGCCATATTGCCAGGGGAGTGG + Intergenic
957090755 3:75727819-75727841 TAGGGATTTTGAAAGGGGAGGGG - Intronic
959447149 3:106454485-106454507 TAGGGGCATTGTCAAGAGAGGGG + Intergenic
960354963 3:116640325-116640347 TAGAGGACTTTCCAGGGGAGGGG - Intronic
961406419 3:126682785-126682807 TAGGGGTATTTACAGGTTAGGGG + Intergenic
961775116 3:129278934-129278956 TCGGGGTATGGCGAGGGGAGGGG + Intronic
962727517 3:138246453-138246475 TTGGTGTATTGCAAGGGGAGAGG + Intronic
962895032 3:139706472-139706494 TCGGGGAATGGCCAGAGGAGGGG - Intergenic
965890130 3:173502769-173502791 TAAAAGTACTGCCAGGGGAGGGG - Intronic
966621572 3:181969727-181969749 TAGGCGCATAGCTAGGGGAGAGG + Intergenic
967325490 3:188234425-188234447 TAGGAATATCGCCATGGGAGTGG + Intronic
967942348 3:194775972-194775994 TAGGGGAATTGGCAGGAAAGGGG - Intergenic
968910112 4:3473216-3473238 TGTGGGTCTTGCAAGGGGAGGGG + Intronic
969344346 4:6562013-6562035 TGAGGGTATTCCCAGGGGTGAGG + Intronic
971799423 4:31269007-31269029 TAAGGGAATTACCAGGGGTGAGG - Intergenic
972934010 4:44109063-44109085 GAGGGATATTGGCAGGGGAGGGG - Intergenic
975289521 4:72660633-72660655 TTGGGGTATTGCTATGGGAAAGG + Intergenic
977927618 4:102718873-102718895 TAGGGATTTTAACAGGGGAGGGG + Intronic
980760070 4:137221374-137221396 AATGGGGATTGCCAGGGGATAGG + Intergenic
980938971 4:139254670-139254692 TGGGGGTATTGGCAGGGAGGTGG - Intergenic
984830561 4:183968778-183968800 CAGGGGTTTGGCCGGGGGAGGGG + Intronic
985161152 4:187046291-187046313 TAGAGGTCTTATCAGGGGAGAGG - Intergenic
986027605 5:3865459-3865481 AAGGGGTATGGCCAGGGGGCAGG - Intergenic
990361243 5:55022199-55022221 TAGCTGTATTTCCAGGGAAGTGG - Intronic
995739199 5:115336995-115337017 GAGGGTCATGGCCAGGGGAGTGG - Intergenic
995848007 5:116514842-116514864 TGGGGGTGATGCAAGGGGAGGGG - Intronic
997014637 5:129918608-129918630 TAGGGGCAATGCCAGGTGAGTGG + Intronic
999400915 5:151263631-151263653 TTGGTGTATTTGCAGGGGAGGGG + Intronic
999901430 5:156090452-156090474 TAGGGATTTTGAAAGGGGAGGGG + Intronic
1000621286 5:163489446-163489468 CAGGGATATTGTCGGGGGAGGGG - Intronic
1000834360 5:166135610-166135632 GGGGGGTATGGCCAGGAGAGGGG + Intergenic
1001928260 5:175655092-175655114 CAGGCGTTGTGCCAGGGGAGAGG - Intergenic
1002706969 5:181168002-181168024 TAGGGGGACTGCCCGGGCAGGGG - Intergenic
1002910572 6:1488159-1488181 AATGGGTATTGCCAGGGGCTGGG + Intergenic
1003164032 6:3660746-3660768 TAGGGGAATGGGCATGGGAGAGG + Intergenic
1003169162 6:3707386-3707408 TAGGGGGATTGCCAGGAGCTGGG + Intergenic
1003785366 6:9479537-9479559 GAGGAGTACTGCCAGGGAAGAGG - Intergenic
1004145193 6:13059280-13059302 AAGGGTGGTTGCCAGGGGAGGGG + Intronic
1005402321 6:25447750-25447772 TACTGGTACTTCCAGGGGAGAGG - Intronic
1007231210 6:40348820-40348842 AAAGGCTATTCCCAGGGGAGGGG - Intergenic
1007753925 6:44086692-44086714 TAGGTGTGGTGGCAGGGGAGAGG + Intergenic
1010928093 6:81767840-81767862 CAGGTGTTCTGCCAGGGGAGTGG - Intergenic
1013500300 6:110742939-110742961 TAGGGGTTTTAAAAGGGGAGGGG - Intronic
1019184041 6:170210544-170210566 TAAGGGCATTGCCAGCAGAGGGG + Intergenic
1019632779 7:2058615-2058637 TGGGAGTGTGGCCAGGGGAGAGG + Intronic
1019632846 7:2058887-2058909 TGGGAGTGTGGCCAGGGGAGAGG + Intronic
1019632867 7:2058964-2058986 TGGGAGTGTGGCCAGGGGAGAGG + Intronic
1021011411 7:15472735-15472757 TAGTGGTATTGCCAGTGTATAGG - Intronic
1022385702 7:29897002-29897024 GAAGGGTATTGCCAGGGGCTGGG - Intronic
1022662348 7:32378794-32378816 TAGGGGTTTTTCAAGGGGAAGGG - Intergenic
1023220990 7:37920184-37920206 TGGTGGTATTGCCAGGCGATGGG + Intronic
1023866780 7:44242137-44242159 TGGGGTCCTTGCCAGGGGAGTGG + Intronic
1024494602 7:50030252-50030274 AAGGGGAATAGCAAGGGGAGGGG + Intronic
1027671378 7:81103990-81104012 CAGGTGTATTGCCAGGGGGTGGG + Intergenic
1027744564 7:82057266-82057288 TAGGGGCAAAGCCAGGGGGGTGG - Intronic
1028080196 7:86566568-86566590 TAGGGTTACTGCCAGGTGTGGGG + Intergenic
1029514224 7:101015959-101015981 TAGGGCCATTCCCAGGGCAGAGG + Intronic
1031289907 7:119921249-119921271 TAGGGGTAGTGACAGTGTAGAGG - Intergenic
1034392513 7:150798164-150798186 TGGGGGTATTTTCTGGGGAGGGG - Intronic
1034405783 7:150901614-150901636 CTGGGGTATGGCGAGGGGAGGGG + Intergenic
1040692499 8:49956976-49956998 AAGGTGTTTTGCCAGGGGATAGG + Intronic
1045811622 8:106227420-106227442 AATGGGTATTGTCAGGGGAGAGG - Intergenic
1049355043 8:142183365-142183387 TAGGGGGGCTCCCAGGGGAGAGG - Intergenic
1049615569 8:143574429-143574451 TGGGGGTAGTGCCAGGTAAGAGG - Intergenic
1049925289 9:401377-401399 CAGGGGAACTCCCAGGGGAGAGG + Intronic
1053691864 9:40590685-40590707 CAAGGGTATGGCCAGGGCAGAGG - Intergenic
1054272939 9:63046806-63046828 CAAGGGTATGGCCAGGGCAGAGG + Intergenic
1054303121 9:63391651-63391673 CAAGGGTATGGCCAGGGCAGAGG - Intergenic
1054401900 9:64718161-64718183 CAAGGGTATGGCCAGGGCAGAGG - Intergenic
1054435506 9:65202476-65202498 CAAGGGTATGGCCAGGGCAGAGG - Intergenic
1054494887 9:65819211-65819233 CAAGGGTATGGCCAGGGCAGAGG + Intergenic
1057201617 9:93143502-93143524 TGGGGGTGCTGCCAGGGAAGTGG + Intergenic
1058756050 9:108084176-108084198 TTGGAGTAGTGCCAGGGGAATGG + Intergenic
1059094849 9:111401372-111401394 TAGGGATTTTGAAAGGGGAGGGG + Intronic
1061389587 9:130310082-130310104 AAGGGGAATGGGCAGGGGAGGGG - Intronic
1062381204 9:136287618-136287640 AATGAGTATTGCCAGGGAAGAGG - Intronic
1203622527 Un_KI270749v1:136820-136842 CAAGGGTATGGCCAGGGCAGAGG - Intergenic
1186190758 X:7065469-7065491 TAGATGTCTTGCCAGTGGAGAGG - Intronic
1186568726 X:10692200-10692222 TAGGGATTTTGAAAGGGGAGGGG - Intronic
1186604101 X:11070995-11071017 TTGGGTTATTGCCATGGAAGGGG - Intergenic
1186834875 X:13427774-13427796 CAAGGGCATTCCCAGGGGAGAGG - Intergenic
1190776961 X:53560384-53560406 TAGGGATATTTCCTGGGGATGGG + Exonic
1192153106 X:68724165-68724187 TAGGGGCAGAGGCAGGGGAGGGG - Intronic
1192169822 X:68847212-68847234 TAGGGGCATTGCCCAGGGAAGGG + Intergenic
1192268293 X:69555553-69555575 TGGGGGAAGTGCCAGGGGTGGGG + Intergenic
1192842469 X:74871293-74871315 TAGGGATTTTGAAAGGGGAGGGG + Intronic
1193174396 X:78375402-78375424 AAAGGCTATTCCCAGGGGAGAGG + Intergenic
1196893985 X:120315565-120315587 GAGGGTTATTGACTGGGGAGGGG - Intergenic
1197758460 X:130012298-130012320 TAGGGCTCTTGCCAGGAGTGTGG - Intronic
1202583093 Y:26402630-26402652 CAAGGGTATGGCCAGGGCAGAGG + Intergenic